ID: 1163529989

View in Genome Browser
Species Human (GRCh38)
Location 19:17843334-17843356
Sequence CCCAGGGGGTTGGGGGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 863
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 804}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163529989_1163530011 27 Left 1163529989 19:17843334-17843356 CCTTGGACCCCCAACCCCCTGGG 0: 1
1: 0
2: 4
3: 54
4: 804
Right 1163530011 19:17843384-17843406 GCAAAGAGGTGCTCCAGGACTGG 0: 1
1: 0
2: 0
3: 13
4: 172
1163529989_1163530010 22 Left 1163529989 19:17843334-17843356 CCTTGGACCCCCAACCCCCTGGG 0: 1
1: 0
2: 4
3: 54
4: 804
Right 1163530010 19:17843379-17843401 CCTGGGCAAAGAGGTGCTCCAGG 0: 1
1: 0
2: 2
3: 23
4: 248
1163529989_1163530000 4 Left 1163529989 19:17843334-17843356 CCTTGGACCCCCAACCCCCTGGG 0: 1
1: 0
2: 4
3: 54
4: 804
Right 1163530000 19:17843361-17843383 ACCCCAGGCAGAACCCCACCTGG 0: 1
1: 0
2: 1
3: 17
4: 271
1163529989_1163530005 13 Left 1163529989 19:17843334-17843356 CCTTGGACCCCCAACCCCCTGGG 0: 1
1: 0
2: 4
3: 54
4: 804
Right 1163530005 19:17843370-17843392 AGAACCCCACCTGGGCAAAGAGG 0: 1
1: 0
2: 0
3: 17
4: 263
1163529989_1163530002 5 Left 1163529989 19:17843334-17843356 CCTTGGACCCCCAACCCCCTGGG 0: 1
1: 0
2: 4
3: 54
4: 804
Right 1163530002 19:17843362-17843384 CCCCAGGCAGAACCCCACCTGGG 0: 1
1: 1
2: 1
3: 33
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163529989 Original CRISPR CCCAGGGGGTTGGGGGTCCA AGG (reversed) Intronic
900013107 1:132757-132779 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
900043173 1:488744-488766 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
900064610 1:723741-723763 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
900102854 1:970221-970243 CGGAGGGGGTGGGGGGCCCAGGG + Intronic
900280104 1:1861585-1861607 CTCAGGGGGTTGGGGGTTGGTGG + Intronic
900435191 1:2627856-2627878 CCCTGGAGGGAGGGGGTCCAGGG + Intronic
900464819 1:2820586-2820608 GCCAGGGGGCCAGGGGTCCAGGG + Intergenic
900482465 1:2905736-2905758 CCCAGGAGGGTGGGGGTGCCCGG - Intergenic
900717673 1:4155780-4155802 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
900727699 1:4228692-4228714 CTCAGGGGATTCGGGGTCCCAGG - Intergenic
901021929 1:6260346-6260368 CCCAGGGGGTTGGGACTGTAGGG - Intronic
901092160 1:6649106-6649128 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
901255826 1:7825639-7825661 CCCAGCGCTTTGGGAGTCCAAGG + Intronic
901303368 1:8215579-8215601 CCAGGGGTGTTGGGGGTACAGGG + Intergenic
901487106 1:9571711-9571733 CCCAGGAGGTGGGGGTTGCAGGG - Intronic
902066960 1:13696440-13696462 CCCAGCACGTTGGGGGGCCAAGG - Intergenic
902335757 1:15753731-15753753 CCCAGTGGGATGGGGGCTCAAGG + Intergenic
902355037 1:15891738-15891760 CCCAGTGCTTTGGGAGTCCAAGG - Intronic
902367838 1:15989220-15989242 CACAGGGAGGTGGGGGACCAAGG - Intergenic
902443431 1:16446314-16446336 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
902644194 1:17786950-17786972 CCCAGGGTTTTGGGAGGCCAAGG - Intronic
902774014 1:18662821-18662843 CCCAGGACTTTGGGAGTCCAAGG - Intronic
902867505 1:19288990-19289012 CCCAAGGGTGAGGGGGTCCAAGG + Exonic
902994925 1:20217022-20217044 CCCAGGAGTTTGGGGCTGCAGGG - Intergenic
903575471 1:24337164-24337186 CCCAGGTGTCTGAGGGTCCAGGG - Intronic
903745510 1:25584232-25584254 CGCAGGGGGTTGGGGGGCATTGG - Intergenic
904009713 1:27382792-27382814 CGCTGGGGCTTGGGGATCCAGGG - Intronic
904156610 1:28488537-28488559 CCCAGCAGTTTGGGGGGCCAAGG + Intronic
904177571 1:28641716-28641738 CCTAGGAGGTTGGAGGTGCACGG + Intronic
904474189 1:30754279-30754301 CCCAGCGCGTTGGGAGGCCAAGG + Intronic
904528103 1:31149765-31149787 CCCAGGGTTTTGGGAGACCAAGG - Intergenic
906224530 1:44110438-44110460 CCCAGTGCTTTGGGAGTCCAAGG + Intergenic
906851048 1:49250952-49250974 CCTAGGGGGATGGTGGTCCCTGG - Intronic
906983387 1:50656079-50656101 CCCAGGACGTTGGGAGGCCAAGG + Intronic
907038404 1:51236566-51236588 CCCCCGGGGTTGGGGGATCAAGG - Exonic
907142959 1:52205332-52205354 CCCAGGGTGTTGGGACTACAGGG + Intronic
907319866 1:53595442-53595464 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
908496336 1:64698772-64698794 CCCAGCGGCTTGGGAGGCCAAGG + Intergenic
908667730 1:66510844-66510866 CCCACTGCGCTGGGGGTCCAGGG - Intergenic
908791627 1:67788411-67788433 CCCAGGAGGTAGGGGCTGCAGGG - Intronic
908818325 1:68057068-68057090 CCAAGGGGGATGGGTGTCCCTGG - Intergenic
909321624 1:74296023-74296045 CCCAGCAGTTTGGGAGTCCAAGG + Intronic
909435098 1:75631785-75631807 CCCAGCGCTTTGGGGGGCCAAGG - Intergenic
909628617 1:77747506-77747528 CCCAGCGCTTTGGGAGTCCAAGG - Intronic
910584684 1:88866276-88866298 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
910663645 1:89701029-89701051 CCCAGCATTTTGGGGGTCCAAGG + Intronic
910937039 1:92492783-92492805 CCCAGCAGTTTGGGAGTCCAAGG - Intergenic
912173410 1:107128483-107128505 CCCAGGAGGTGGGGGTTTCAGGG - Intergenic
912496334 1:110094492-110094514 CAGAGGGGGTTGGGGGTAAATGG - Intergenic
912591453 1:110824786-110824808 CCTTGGGGGATGGGCGTCCATGG + Intergenic
912695460 1:111838405-111838427 CCCAGCGCGTTGGGAGGCCAAGG + Intronic
912726545 1:112063798-112063820 CCCAGGGGGATGGGGACCCCTGG + Intergenic
913304888 1:117417968-117417990 CCCAGGAGGTTGAGGCTACAGGG + Intronic
915097940 1:153476908-153476930 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
915222972 1:154389856-154389878 CCCAGGACTTTGGGGGGCCAAGG + Intergenic
915893674 1:159794494-159794516 CCCAGCGCTTTGGGGGGCCAAGG + Intergenic
915941874 1:160123464-160123486 CCCACTGTGTTGGGGGTTCAGGG - Intronic
916085868 1:161268797-161268819 CCCAGGGCTTTGGGAGCCCAAGG - Intronic
917329446 1:173867267-173867289 CCCAGTATGTTGGGGGACCACGG + Intergenic
918215696 1:182390991-182391013 CCGAGGGGTTGGGGGGTCCGGGG + Intronic
918323295 1:183384939-183384961 CCCAGTGTTTTGGGAGTCCAGGG + Intronic
920436321 1:205949339-205949361 CAGAGGGGGCTGGGGCTCCAGGG - Intergenic
920848957 1:209615640-209615662 CCCAGAGGGTCAGGGGCCCAGGG - Intronic
921217653 1:212951111-212951133 CCCGGGGGGTTGGGGATGGAGGG - Intronic
921407597 1:214798473-214798495 CCCAGCAGGTTGGGAGGCCAAGG - Intergenic
921574736 1:216821433-216821455 CCCAGGGCTTTGTGGGGCCAAGG + Intronic
922099508 1:222469757-222469779 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
922261545 1:223949253-223949275 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
922735532 1:227976491-227976513 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
922801382 1:228366227-228366249 CCCAGGAGCTGGGGGGCCCACGG + Intronic
922879727 1:228971550-228971572 GCCAGGGAGTTGGTGGTCCGTGG + Intergenic
923505948 1:234607468-234607490 CCCAGAGAGGTGGGGGGCCAGGG - Exonic
924248097 1:242104769-242104791 CCCAGTGTTTTGGGAGTCCAAGG - Intronic
924342710 1:243051429-243051451 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
924534654 1:244924600-244924622 CCCAGGAGTTTGAGGCTCCAGGG - Intergenic
924613224 1:245590655-245590677 CCCAGCACGTTGGGAGTCCAAGG + Intronic
924813347 1:247422301-247422323 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1062907926 10:1191248-1191270 TCCAGGAGGGTGGGGGGCCAGGG + Intronic
1064041710 10:11971811-11971833 CCCAGCGCTTTGGGAGTCCAAGG + Intronic
1064415226 10:15143604-15143626 CCCAGCACTTTGGGGGTCCAAGG + Intronic
1064620241 10:17208037-17208059 CCCAGGCTTTTGGGGGGCCATGG - Intergenic
1064653857 10:17537079-17537101 CCCAGTGGTTTGGGAGGCCACGG - Intergenic
1064795025 10:19002020-19002042 CCCAGTGGTTTGGGAGTCCAAGG + Intergenic
1065046103 10:21748668-21748690 CCCAGGACTTTGGGAGTCCAAGG + Intergenic
1065344550 10:24736331-24736353 CCCAGCGGTTTGGGAGACCAAGG + Intergenic
1065689978 10:28323034-28323056 CCCAGCGGTTTGGGAGGCCAAGG + Intronic
1065695984 10:28380064-28380086 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
1065823147 10:29544886-29544908 CACAGGTGTTTGGGGGTACAGGG + Intronic
1065925703 10:30432941-30432963 CCCAGGAGGTGGGGTGTCCCAGG - Intergenic
1066617674 10:37312078-37312100 CCCAGTAGTTTGGGGGGCCAAGG - Intronic
1066690946 10:38027595-38027617 CCCAGAGGTTTGGGAGGCCAAGG - Intronic
1066733769 10:38454125-38454147 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
1067002263 10:42627252-42627274 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1067280920 10:44872138-44872160 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1067847972 10:49738123-49738145 CCCACAGGGCTAGGGGTCCAGGG - Intronic
1067902977 10:50261728-50261750 CCCAGTGCTTTGGGGGGCCAAGG + Intergenic
1069201948 10:65630396-65630418 CCCAGCGCTTTGGGAGTCCAAGG + Intergenic
1069444198 10:68457920-68457942 CCCAGCAGGTTGGGAGGCCAAGG + Intronic
1069535889 10:69252737-69252759 CCCAGGAGATTGAGGTTCCAGGG + Intronic
1069588856 10:69629960-69629982 CCCAGGGGGTGGGGGCGCCCTGG - Intergenic
1069704690 10:70451058-70451080 CCCAAGAGGCTGGGGGGCCATGG - Intergenic
1069923583 10:71832645-71832667 TCCTGGGGTTTGGGTGTCCATGG - Intronic
1069929319 10:71871900-71871922 CCCAGGAGGTTGAGGCTACAGGG + Intergenic
1069952998 10:72032421-72032443 GACAGGGTGTTGGGGGGCCAGGG - Intergenic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1071845515 10:89517559-89517581 CCCAGGGGTTTGGGAGGCCAAGG - Intronic
1072171645 10:92868888-92868910 CCCAGGAGGTTGAGGCTACAAGG - Intronic
1072650264 10:97289776-97289798 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1072652514 10:97306689-97306711 CCCAGGACTTTGGGGGGCCAAGG + Intergenic
1072946670 10:99816627-99816649 CCCACGGGGTTGGGGACCCATGG - Intronic
1073100703 10:101005077-101005099 CCCAGGGGGTTGAGGCTACAGGG - Intronic
1073199967 10:101727309-101727331 CCTAGGGGGTTGGGGACCCCTGG + Intergenic
1074188624 10:111117010-111117032 GGCTGGGGATTGGGGGTCCAAGG + Intergenic
1075184429 10:120242895-120242917 CCCAAGGGCTTGGGAGGCCATGG + Intergenic
1075327642 10:121547468-121547490 CCCAGGAGTTTGGGGCTGCAGGG - Intronic
1075375790 10:121976920-121976942 CAAAGGGGGTAGGGGGTCAAGGG - Intergenic
1075589001 10:123677992-123678014 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
1075648112 10:124109659-124109681 CCCAGGGAGTTGGGGGTGGGTGG + Intergenic
1076273174 10:129174521-129174543 GCCTGGGGGTTGGGGGGACAGGG - Intergenic
1076435509 10:130438571-130438593 CACAGAGGGATGGGGGTGCATGG - Intergenic
1076443808 10:130498219-130498241 CCCAGGGGGTTTGGGCTCAGAGG + Intergenic
1076874805 10:133210831-133210853 CCCAAGGGGGTGAGGGGCCAGGG + Intronic
1076969444 11:124961-124983 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
1077205232 11:1338830-1338852 CCCACGGGGGTGGGGGGCCCGGG + Intergenic
1077312262 11:1894307-1894329 CCCAGGAGGTTGAGGCTGCAAGG - Intergenic
1077450559 11:2640534-2640556 CCCAGTGCTTTGGGGGGCCAAGG - Intronic
1078076940 11:8170773-8170795 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
1079067742 11:17312307-17312329 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1079239624 11:18713401-18713423 CCCAGCACTTTGGGGGTCCAAGG - Intronic
1080356969 11:31460079-31460101 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1080772809 11:35357894-35357916 CCCAGCGGTTTGGGAGGCCAAGG + Intronic
1082100683 11:48170406-48170428 TCCCGGGGGTTGGGGATCGAGGG + Intronic
1082672557 11:56053320-56053342 CCCAGGACTTTGGGGGGCCAAGG + Intergenic
1082796920 11:57384694-57384716 GCCAGAGGCTTGGGGTTCCATGG - Intergenic
1083646420 11:64173878-64173900 CAACTGGGGTTGGGGGTCCAAGG + Intergenic
1083671760 11:64303905-64303927 CCCAGGGGGGTGGGGTTTCAGGG + Intronic
1083879940 11:65543361-65543383 CCCTGGGGGGTGGGGGTCCTGGG + Intronic
1083979432 11:66154184-66154206 CCCAGTGCTTTGGGAGTCCAAGG + Intronic
1084052181 11:66607140-66607162 CCCATGGGGATGGGGGTACAGGG - Intergenic
1084397283 11:68920556-68920578 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1084792671 11:71484470-71484492 CCCCTGGGGGTGGGGGTGCAGGG + Intronic
1085129532 11:74026229-74026251 CCCAGGAGTTTGCGGGTGCAGGG + Intronic
1085279521 11:75320826-75320848 CCCAGTGGTCTGGGAGTCCAGGG - Intronic
1085305239 11:75482067-75482089 CCCAGGGGCAGGGGGGTCCCGGG - Intronic
1085320110 11:75568854-75568876 TCAAGGTGGGTGGGGGTCCAAGG + Intronic
1085640221 11:78188653-78188675 CCCAGGGGCGTGGCGGTCCGGGG + Exonic
1085922968 11:80981072-80981094 CCCAGGGGGTTGGGAATCCTTGG + Intergenic
1086595853 11:88569725-88569747 CACAGGTAGTGGGGGGTCCATGG - Intronic
1087083553 11:94194940-94194962 CCCTGGGGGCTGGGGTTCCCTGG - Intergenic
1087449875 11:98307332-98307354 CCCAGGATTTTGGGAGTCCATGG + Intergenic
1087888337 11:103506445-103506467 GTCATGGGGTTGGGGGGCCAGGG + Intergenic
1088527840 11:110775822-110775844 CCCAGGAGTTTGGGAGGCCAAGG - Intergenic
1088883221 11:113987655-113987677 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1089378311 11:118010792-118010814 TCACGGGGGCTGGGGGTCCAAGG - Intergenic
1089957627 11:122586511-122586533 CCCAGAGGGTTGGGATTACAGGG - Intergenic
1090023187 11:123145712-123145734 CCCAGCAGTTTGGGAGTCCAAGG - Intronic
1090248971 11:125237874-125237896 TCCATGGGGATGGAGGTCCAGGG - Intronic
1090558577 11:127903702-127903724 TCCAGGGGGTTGGGGGTCTGAGG - Intergenic
1090675411 11:128989706-128989728 CTCGGGGGGTTGGGGGGCTAGGG - Intronic
1090785915 11:130047152-130047174 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
1090790182 11:130085748-130085770 ACCAGGGGCTGGGGGATCCAGGG - Intronic
1090808018 11:130214911-130214933 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1090847788 11:130545648-130545670 CCTAGGGTGTTGGGGGTGAAGGG - Intergenic
1091380346 12:54099-54121 CCCAGCATGTTGGGAGTCCAAGG + Intergenic
1091391986 12:131334-131356 CCCAGGGAGTGGGGGGTCTCTGG - Intronic
1091795232 12:3294287-3294309 CCCTGGGGGCAGGGGGGCCATGG - Intergenic
1092578458 12:9814499-9814521 CCCAGGGGCCTGGGGATCCATGG + Intergenic
1093118726 12:15242627-15242649 CCAAGGGGGTTGGGGGATAAAGG - Intronic
1094561425 12:31557452-31557474 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1096085123 12:48860462-48860484 CCCAGGAGGTTGAGGCTGCAAGG - Intronic
1096111476 12:49031662-49031684 CCCTGAGGTTTGGGGGTCCCTGG + Exonic
1096454497 12:51773856-51773878 GCTAGGGGGTTGGGGGTTTAGGG + Intronic
1096845295 12:54403247-54403269 CACTGGGGCTTGGGGGTCCAAGG + Exonic
1096973669 12:55686210-55686232 CCATGGAAGTTGGGGGTCCAGGG - Intronic
1097587105 12:61528281-61528303 CCCAGGACTTTGGGAGTCCAAGG + Intergenic
1097962141 12:65543047-65543069 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1099686613 12:85897813-85897835 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1100279896 12:93108304-93108326 CCCATGGGGTTGGGTTACCAGGG - Intergenic
1100479938 12:94968257-94968279 CCCAGCAGTTTGGGGGGCCAAGG - Intronic
1100482256 12:94990496-94990518 CCCAGGGGTTTGAGGTTGCAAGG - Intronic
1100523362 12:95397932-95397954 CCCAGCAGGTTGGGAGTCCGAGG + Intergenic
1100837613 12:98581559-98581581 CCCAGTGGTTTGGGAGGCCAGGG + Intergenic
1101166848 12:102046369-102046391 CCCAGGGGGCAGGGGTTGCAGGG - Intronic
1101302414 12:103495685-103495707 GGCAGGGGGGTGGGGGGCCAAGG - Intronic
1101719023 12:107335033-107335055 CCCAGTGCTTTGGGAGTCCAAGG + Intronic
1102170641 12:110839846-110839868 CCCAGGAGTTTGGGAGGCCAAGG + Intergenic
1103072728 12:117958081-117958103 CCCAGGACTTTGGGGGGCCAAGG - Intronic
1103109280 12:118260929-118260951 CCCAGGAGTTTGGGAGGCCAAGG - Intronic
1103630463 12:122255877-122255899 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1103974053 12:124690480-124690502 CCCAGGGCTGTGGGGCTCCAGGG - Intergenic
1104666214 12:130649360-130649382 CCCCAGGGGTTGGGCGGCCACGG - Intronic
1104898519 12:132175817-132175839 CCCTGGGGGGTGGGGGGGCAGGG - Intergenic
1104961811 12:132491655-132491677 TCCAGGGGCTTGGGAGCCCATGG + Intronic
1105380268 13:19880677-19880699 CCCAGGACTTTGGGAGTCCAAGG - Intergenic
1105386216 13:19931873-19931895 CCCAGGACTTTGGGAGTCCAAGG - Intergenic
1105428080 13:20312893-20312915 ACCATGGGGTAGGGGGTTCATGG + Intergenic
1105504426 13:20998111-20998133 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
1105566171 13:21550460-21550482 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1107849929 13:44561054-44561076 CCCGGGGCGTCGGGGGACCAGGG + Intronic
1107916896 13:45161589-45161611 CCCAGCAGGTTGGGAGGCCAAGG + Intronic
1108056833 13:46493727-46493749 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1108214979 13:48175119-48175141 CCCAGGAGTTTGGGAGGCCAAGG - Intergenic
1109711709 13:66169404-66169426 CCCAGGAGGTTGGGGCTGCAGGG - Intergenic
1109764647 13:66878475-66878497 CCCAGCAGTTTGGGAGTCCAAGG - Intronic
1110582704 13:77150390-77150412 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1110599331 13:77353980-77354002 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1110665584 13:78114176-78114198 CCCAGCAGTTTGGGGGGCCAAGG - Intergenic
1110858611 13:80323812-80323834 CCCAGGACTTTGGGGGACCAAGG + Intergenic
1111823062 13:93236422-93236444 GCCTGGGGGTTGGGGATCCCTGG - Intronic
1111913690 13:94339138-94339160 CCCAGGAGGTTGAGGCTGCACGG - Intronic
1113186706 13:107695041-107695063 CCCAGCGTGTTGGGAGGCCAAGG - Intronic
1113805225 13:113107914-113107936 CCCAGGGGCGTGGGTGTCCCGGG + Intronic
1113805312 13:113108152-113108174 CCCAGGGGCGTGGGTGTCCCGGG + Intronic
1113805540 13:113108783-113108805 CCCAGGGGTGTGGGTGTCCCGGG + Intronic
1113805611 13:113108970-113108992 CCCAGGGGTGTGGGTGTCCCGGG + Intronic
1113805692 13:113109191-113109213 CCCAGGGGCGTGGGTGTCCGGGG + Intronic
1113836465 13:113331311-113331333 ACCTGGGGGTTGGGGGCTCAGGG + Intronic
1114376450 14:22151843-22151865 CCCAGGACTTTGGGGGGCCAAGG - Intergenic
1114645764 14:24255252-24255274 GCCTGGGGGTTGAGGGTCAAGGG + Exonic
1115963103 14:38857834-38857856 CCGTGGGGGTTGGGGGGCTAGGG + Intergenic
1116815888 14:49583298-49583320 CCCAGAGCTTTGGGGGCCCAAGG + Intronic
1118300316 14:64609176-64609198 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1118983238 14:70732727-70732749 ACCAGGGGGTTGTGGGTACATGG + Exonic
1119176391 14:72570687-72570709 CCCAGGGACATGGGGATCCAGGG + Intergenic
1119194210 14:72705054-72705076 CCCGGGGGGTTGGGGACCCCTGG - Intronic
1119331161 14:73795010-73795032 CCCAGTGTGTTGGGAGGCCAAGG - Intergenic
1119510455 14:75207241-75207263 CCCAGGGGGTTGAAGCTGCAGGG + Intergenic
1119863304 14:77952836-77952858 CCCAGGGTTTTGGGAGGCCAAGG + Intergenic
1120163474 14:81170021-81170043 CCCAGGGGGTTTTGTGTGCATGG + Intergenic
1120415807 14:84216783-84216805 GCCTGGGGGTGGGGGGTGCAGGG + Intergenic
1120757733 14:88259705-88259727 CCCAGCAGCTTGGGGGGCCAAGG - Intronic
1121042013 14:90757366-90757388 CCCAGGAGTTTGGGGCTGCAGGG + Intronic
1121266210 14:92604142-92604164 CCAAGGTGGGTGGGGGTCCATGG + Intronic
1121333595 14:93063299-93063321 CTCAGGTGGGTGGGGGACCAGGG - Intronic
1121355153 14:93207598-93207620 CCCAGGAGGTTGGGGTTAAAAGG - Intronic
1121614501 14:95304085-95304107 CCCAGCACATTGGGGGTCCAAGG + Intronic
1122222913 14:100252785-100252807 CCCAGGGATTTGGGAGGCCAAGG + Intronic
1122328114 14:100894887-100894909 CCCAGTGGGCAGTGGGTCCAGGG + Intergenic
1122470528 14:101963140-101963162 CCCAGGGGGTTGCTGGAACACGG - Intergenic
1122599550 14:102914566-102914588 CCCTGGGGCCTGGGGGTCCCTGG - Intergenic
1122623633 14:103073477-103073499 CCCAGTGAGCTGGGTGTCCAAGG - Intergenic
1202894228 14_KI270722v1_random:188876-188898 GCCTGGGGGTTGGGGATCCCTGG - Intergenic
1123686284 15:22799866-22799888 CCCAGGAGGTTGAGGCTTCAGGG + Intronic
1123951000 15:25274636-25274658 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1124156244 15:27227233-27227255 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
1124180873 15:27472524-27472546 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1125208868 15:37187426-37187448 GTCAGGGGGTGGGGGGTCAAGGG + Intergenic
1125750217 15:42022803-42022825 GCCAGGGGGTTGGGGGCCCCTGG + Intronic
1126389194 15:48127566-48127588 CCCAGTGCTTTGGGAGTCCAAGG + Intronic
1126599560 15:50415282-50415304 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
1126662112 15:51043497-51043519 TCCAGGGGGGTGGGGGGCAAAGG - Intergenic
1127371918 15:58349377-58349399 CCCAGGACTTTGGGAGTCCAGGG - Intronic
1127494558 15:59497603-59497625 CCCAGGGATTTGGGAGGCCAAGG + Intronic
1127863358 15:63012523-63012545 GCCTGGGGGTTGGAGGTCCCTGG - Intergenic
1128057507 15:64711339-64711361 CCCAGGAGTTTGGGAGGCCAAGG + Intergenic
1128774140 15:70306729-70306751 CCCAGTGGTTTGGGAGCCCAAGG - Intergenic
1129199213 15:73988832-73988854 CTCAAGGGGCTGGGGGTGCAGGG + Intronic
1130087025 15:80786310-80786332 CCTAGGAGGTTGGGGCTGCAGGG - Intronic
1130210572 15:81918262-81918284 CCCAGGAGTTTGGGAGGCCAAGG + Intergenic
1130581907 15:85145196-85145218 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
1130809163 15:87358670-87358692 GCCAGGGGGTTGTGGATGCAGGG - Intergenic
1131248418 15:90815732-90815754 CCCAGGGGGCAGGTGGACCAAGG + Exonic
1132262582 15:100439914-100439936 CCCAGCAGGTTGGGGAGCCATGG - Intronic
1132609718 16:809375-809397 GCCTGGGGGTCGGGGGACCAAGG - Intronic
1132672147 16:1106355-1106377 GCCCAGGGGTTGGGGGGCCATGG - Intergenic
1132675073 16:1118136-1118158 CCCCGGGGGCTGGGGCTACAGGG + Intergenic
1132728284 16:1348233-1348255 CCCAGGTGGGCGGGGGTGCAAGG + Exonic
1132748276 16:1445888-1445910 CTCTGGGGGTTGGGGGACCAAGG + Exonic
1132897623 16:2236502-2236524 CCTAGGGGGATGGGGATCCCGGG - Exonic
1133050827 16:3116321-3116343 CACAGTGGGTTGGGAGTCCGGGG + Intronic
1133549748 16:6842816-6842838 GTCAGGGGGTTGGGGGAACATGG - Intronic
1133586228 16:7198253-7198275 CCCAGGACTTTGGGAGTCCAAGG - Intronic
1133864100 16:9625830-9625852 CCCAGGGTTTTGGGAGGCCAAGG - Intergenic
1133949038 16:10374708-10374730 CCCAGCAGTTTGGGAGTCCAAGG - Intronic
1134082325 16:11333652-11333674 CCCGTGGGGTAGGGGGTCTAGGG - Intronic
1135522352 16:23187182-23187204 CCCAGGAGGTCGGGGCTGCAGGG - Intronic
1135597151 16:23753573-23753595 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1135791787 16:25403421-25403443 CCCAAGGTTTTGGGAGTCCAAGG - Intergenic
1135792016 16:25405678-25405700 CCCAGGGTTTTGGGAGGCCAAGG + Intergenic
1136136192 16:28258361-28258383 CCCAGGAAGTTGGGGGGCCCTGG - Intergenic
1136467750 16:30456758-30456780 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1136494925 16:30636910-30636932 CCCAGCACGTTGGGAGTCCAAGG + Intergenic
1136507933 16:30718121-30718143 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1136518890 16:30784034-30784056 CTCCGGGGCTGGGGGGTCCAGGG + Exonic
1137305963 16:47200109-47200131 TCCAGGGGGTTGGGGACCCCTGG + Intronic
1137731608 16:50694182-50694204 CCCAGGGGGATTGGGGTGGAGGG - Intronic
1138139727 16:54557804-54557826 CCCAGGGGAGAGAGGGTCCAGGG + Intergenic
1139825150 16:69751256-69751278 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1140085676 16:71793966-71793988 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1140316483 16:73902821-73902843 CCCATGAGGCTGAGGGTCCAGGG + Intergenic
1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG + Intronic
1140484263 16:75281538-75281560 CCCATGGACTTGGGGGTGCAAGG + Intergenic
1140502807 16:75449401-75449423 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1140591464 16:76358081-76358103 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
1141508681 16:84498342-84498364 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1141581135 16:84999894-84999916 CCCAGTGCTTTGGGAGTCCAAGG + Intronic
1141586789 16:85039376-85039398 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1141605089 16:85148273-85148295 GCCAGGGGGCTGGGGAACCACGG - Intergenic
1141635526 16:85312064-85312086 CCCAGGGCTCTGGGGGTGCAAGG - Intergenic
1141641044 16:85341748-85341770 CCCAGTGTTTTGGGGGGCCAGGG - Intergenic
1141688269 16:85582491-85582513 CCCAGGGGATGTCGGGTCCAAGG - Intergenic
1141711929 16:85704830-85704852 CCCAGGGCTTTGGGAGGCCAGGG - Intronic
1141835464 16:86536103-86536125 CCCAGCAGTTTGGGGGGCCATGG - Intronic
1142112747 16:88340927-88340949 CCCTGGGGGTTGGGGTAGCAAGG + Intergenic
1142362828 16:89635414-89635436 CCCAGGAGGATGGGGGTCCCAGG + Intronic
1142525769 17:539621-539643 CCCAGAAGGTTGGGGCTGCAGGG + Intronic
1142573151 17:888469-888491 CCCAGGACTTTGGGGGGCCAAGG - Intronic
1142848493 17:2693318-2693340 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1143097002 17:4483486-4483508 CCCAGCAGGTTGGGGTTCCTGGG + Intronic
1143099762 17:4498752-4498774 CCCTGGGGGTGGGGGGCCCGGGG - Intergenic
1143134033 17:4700672-4700694 CCCAGGATTTTGGGGGGCCAAGG + Intronic
1143597666 17:7924994-7925016 CCCAGGACGTTGGGAGGCCAAGG - Intronic
1143736121 17:8913156-8913178 TCCAGGGTGTTGGGGGGTCAGGG + Intronic
1143798463 17:9357618-9357640 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1144596640 17:16575474-16575496 CCCAGGACTTTGGGGGGCCAAGG - Intergenic
1144826448 17:18108153-18108175 CCCAGGGGGTTGGTGTTCGGGGG + Intergenic
1145111123 17:20162394-20162416 CCCAGCACTTTGGGGGTCCAAGG - Intronic
1145221308 17:21091755-21091777 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1145273183 17:21415321-21415343 TCCCGGGGGTTGGGGGACCCTGG - Exonic
1145311376 17:21702765-21702787 TCCCGGGGGTTGGGGGACCCTGG - Exonic
1145319960 17:21760181-21760203 CCCAGCGCTTTGGGGGGCCAAGG + Intergenic
1145971775 17:28960464-28960486 CACTGGGGGTGGCGGGTCCACGG - Intronic
1146105893 17:30036675-30036697 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1146722750 17:35134648-35134670 CCCAGGAGTTTGGGAGGCCAAGG - Intronic
1146771560 17:35572933-35572955 CCCAGGGTTTTGGGAGGCCAAGG + Intergenic
1146851151 17:36222858-36222880 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
1146867068 17:36346726-36346748 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
1147069938 17:37947335-37947357 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
1147081467 17:38026873-38026895 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
1147097413 17:38150830-38150852 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
1147114070 17:38285701-38285723 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1147562531 17:41518008-41518030 CCCAGTGCTTTGGGGGGCCAAGG - Intronic
1147798601 17:43065078-43065100 CCCAGCGCTTTGGGGGGCCAAGG - Intronic
1147888337 17:43699458-43699480 CCCAGGGAGCTGCTGGTCCAAGG - Intergenic
1147888460 17:43700200-43700222 CCCAGTGGGGTGGGGGACCAAGG + Intergenic
1148039742 17:44697332-44697354 CCCAGCAGTTTGGGGGTCCGAGG - Intergenic
1148214992 17:45829599-45829621 CCCTGGAGGTGGGGGCTCCATGG + Exonic
1148221910 17:45868958-45868980 CCCAGTGGTTTGGGAGGCCAAGG + Intergenic
1148253962 17:46112114-46112136 CCCAGGGCTTTGGGAGCCCAAGG + Intronic
1148679836 17:49467281-49467303 CCCAGGTGGGTTGGGGTTCAGGG - Intronic
1148844191 17:50519112-50519134 CCCGGGGGCAGGGGGGTCCATGG + Intronic
1148849834 17:50549197-50549219 CTCCGGGAGTTGGGGGACCAGGG + Intronic
1149664678 17:58357553-58357575 CCCAGGTGGATGTGGTTCCAGGG + Exonic
1149889065 17:60369987-60370009 CCCAGGAGTTTGGGAGGCCAAGG - Intronic
1149927295 17:60714216-60714238 CCCAGTGGTTTGGGAGGCCACGG - Intronic
1150079117 17:62220954-62220976 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
1150644593 17:66970012-66970034 CCAAGGGCGAAGGGGGTCCAGGG - Intronic
1150654653 17:67031859-67031881 CCCTGAGCGTTGGGGGTCCCGGG + Exonic
1150769802 17:68031307-68031329 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1151335754 17:73438729-73438751 CTCGGGGGCTTGGGGGTGCAGGG - Intronic
1151598470 17:75091836-75091858 CTGAGGGGGTTGGGGGGCCAGGG + Intronic
1151695985 17:75717797-75717819 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1152093573 17:78259647-78259669 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
1152119659 17:78410720-78410742 CCCAGGACTTTGGGGGGCCAAGG - Intronic
1152903886 17:82960220-82960242 CCCAGGGGGTCTAAGGTCCAAGG - Intronic
1153250238 18:3114632-3114654 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1153326191 18:3822730-3822752 CCCAAGGGATTGGGGAGCCATGG + Intronic
1153902520 18:9630618-9630640 CCCAAGGGGCTGGAGGTGCAGGG - Intergenic
1154322462 18:13366187-13366209 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1154400766 18:14034695-14034717 CCCTGGGGGATAGGGGTCCCTGG - Intergenic
1154489954 18:14913765-14913787 CCCAGAGGATCTGGGGTCCAAGG - Intergenic
1157575686 18:48741673-48741695 CCCAGCAGGTTGGGAGGCCAAGG - Intronic
1157817525 18:50741004-50741026 CCCAGGAGTTTGGGGCTGCAGGG - Intergenic
1158387550 18:57012430-57012452 CACATGGGGTTGGGAGTCTAGGG + Intronic
1158536322 18:58311435-58311457 CCCAGGGGGTTGAGGGTGCAAGG - Intronic
1158780543 18:60644441-60644463 CCCAGCGGTTTGGGAGGCCAAGG - Intergenic
1159925226 18:74263070-74263092 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1160144653 18:76353583-76353605 TCCTGGGGGTTGGGGGTTTAGGG + Intergenic
1160498806 18:79392241-79392263 CCCAGGAAGTTGGGGCTGCAGGG + Intergenic
1160646249 19:194887-194909 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
1160697636 19:492290-492312 TCTGGGGGGATGGGGGTCCATGG - Intronic
1160920222 19:1516138-1516160 CCCAGGGACCGGGGGGTCCAGGG - Intergenic
1161085740 19:2334110-2334132 CCCACGGGGCTGTGGGTCAAAGG + Intronic
1161193501 19:2972861-2972883 CCCAGGAGGTTGGGACTGCAGGG + Intergenic
1161200553 19:3012465-3012487 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1161473427 19:4472536-4472558 CCCCGGGGGTCTGGGGTTCATGG + Intronic
1161493387 19:4574997-4575019 TCGAGGGGGCTGGGGCTCCAAGG + Intergenic
1161507017 19:4649559-4649581 CACAGGGAGTTGGGGTTCAAGGG + Intronic
1161541040 19:4851724-4851746 CCCAGGGGAGGTGGGGTCCATGG + Intronic
1161564898 19:4996448-4996470 CCCAGGGGGCTGAGGCTGCAAGG - Intronic
1161954034 19:7483067-7483089 CCAAGGGGGGTGGGGTCCCAAGG - Intronic
1161988122 19:7668995-7669017 ACCGGAGGGTTGGGGGCCCAGGG + Intergenic
1162061825 19:8100854-8100876 CCCAGGTGGATGGGTGCCCAGGG + Intronic
1162136272 19:8557370-8557392 CCCAGGAGGTTGAGGCTGCATGG - Intronic
1162331776 19:10034292-10034314 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
1162782302 19:13012590-13012612 GCGCGGGGGTTGGGGGTTCAGGG + Intronic
1163099143 19:15083055-15083077 CCCAGCTGCTTGGGGGGCCAAGG - Intergenic
1163180909 19:15600908-15600930 CCCAGGAGGTTGAGGTTGCAGGG + Intergenic
1163410166 19:17149226-17149248 CCCAGAGCTTTGGGGGGCCAAGG - Intronic
1163529989 19:17843334-17843356 CCCAGGGGGTTGGGGGTCCAAGG - Intronic
1163578064 19:18122142-18122164 CCCAGGGGGTGGGGGGTCATGGG + Intronic
1164044485 19:21524277-21524299 CCCAGGACTTTGGGAGTCCAAGG + Intronic
1164188676 19:22895734-22895756 CCCAGGAGTTTGGGAGACCAAGG - Intergenic
1164588611 19:29493993-29494015 CCCAGGAGTTTGGGGCTGCAGGG + Intergenic
1164915081 19:32045831-32045853 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1165032689 19:33009703-33009725 CCCAGCAGGTTGGGAGGCCAAGG - Intronic
1165287488 19:34853808-34853830 CCCAGGAAGGTGTGGGTCCATGG + Intergenic
1165351376 19:35277709-35277731 GGCAGGGGGCTGGGGGTCCGTGG + Intronic
1165402980 19:35613507-35613529 CCCAGGAGGTTGAGGCTGCAAGG + Intronic
1165419865 19:35717528-35717550 CCCAGGGCCTCGGGGGTCCCGGG + Intergenic
1165976395 19:39680435-39680457 CCCAGTGGTTTGGGAGGCCAAGG + Intergenic
1166065916 19:40358861-40358883 CCCTGGGGGTGGGGTGTTCAGGG + Intronic
1166174450 19:41056726-41056748 CCGAGGGTTTTGGGGGTCAAAGG + Intergenic
1166569180 19:43782919-43782941 CCCTGGGGCTGGTGGGTCCAGGG - Intergenic
1166661815 19:44652266-44652288 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1166771841 19:45288150-45288172 CCCAGGAGGTTGAGGCTACAGGG + Intronic
1166980407 19:46628747-46628769 CCCAGTGCGTTGGGAGGCCAAGG - Intergenic
1167113315 19:47474493-47474515 CCTAGGGGGTTGGGGGCCCAGGG - Intergenic
1167168627 19:47816505-47816527 CCCAGGGGTTTGGGAGGCCAAGG - Intronic
1167174658 19:47857513-47857535 CCCAGGGCTTTGGGAGTCAAGGG - Intergenic
1167241301 19:48344956-48344978 CCCAGCAGTTTGGGGGTCCAAGG - Intronic
1167244060 19:48363473-48363495 CCGGGGGGTCTGGGGGTCCAGGG - Exonic
1167245280 19:48369373-48369395 CCCAGGGTTTTGGGGGTCAGTGG + Intronic
1167273644 19:48521475-48521497 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1167673787 19:50872225-50872247 CCCAGTGCTTTGGGAGTCCAAGG - Intronic
1167697151 19:51021916-51021938 CCCAGGAGTTTGGGAGGCCAAGG + Intergenic
1168252122 19:55147190-55147212 CCCAGTGGGGTGGGGCCCCAAGG + Intronic
1168337508 19:55604985-55605007 GCCCTGGGGTTGGGGGTCTAGGG - Intergenic
1168623073 19:57894288-57894310 CCCAGGAGGTGGGGGTTGCAGGG + Intronic
1168639408 19:58020743-58020765 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
925085311 2:1103017-1103039 ACCAGGGGGCGGGGGCTCCAGGG - Intronic
925362261 2:3287910-3287932 CCCAGGCGGTGGAGGGGCCAAGG + Intronic
926128148 2:10284500-10284522 TCCAGAGGGGTGGGAGTCCAGGG - Intergenic
927423644 2:22957615-22957637 CCCCAGGGGATGGGGGACCATGG - Intergenic
927943678 2:27121817-27121839 CCCAGGGGGTTGGGGACCCCTGG + Intergenic
928182973 2:29082704-29082726 GCCAGGTGGGTGGGGGTCCCTGG - Intergenic
928491876 2:31792900-31792922 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
928513764 2:32026177-32026199 CCCAGGACTTTGGGAGTCCAAGG + Intronic
928910158 2:36412281-36412303 CGCAGGGGGTGGGGGGCGCACGG + Intronic
929470630 2:42188877-42188899 CCCAGCGCTTTGGGAGTCCAAGG + Intronic
929696557 2:44121780-44121802 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
929704236 2:44193962-44193984 CCCAGGGCTTTGGGAGTTCAAGG - Intronic
929916713 2:46142636-46142658 CCCAGGGGAAAGGTGGTCCAGGG - Intronic
929924328 2:46196380-46196402 TGCTGGGGGTTGGGGGTCCTAGG + Intergenic
931330961 2:61282712-61282734 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
931858196 2:66326291-66326313 CCCAGGAGGTTGAGGCTGCAAGG + Intergenic
932202466 2:69843536-69843558 CCCAGTGGTTTGGGAGGCCAAGG + Intronic
932219291 2:69987493-69987515 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
932494034 2:72137793-72137815 CCCTGGGGGGAAGGGGTCCATGG + Intronic
932650832 2:73554453-73554475 CCCAGCAGTTTGGGGGGCCAAGG + Intronic
933832177 2:86219896-86219918 CCCTGGAGATTGGGGGTCCTGGG - Intronic
933836551 2:86250614-86250636 ATCTCGGGGTTGGGGGTCCAGGG - Intronic
935037031 2:99387156-99387178 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
935215160 2:100970197-100970219 CCCTGGGGGTAGGGGGCCCTTGG - Intronic
935707139 2:105866742-105866764 CCCGGGGGGTTGGGGACCCCTGG + Intronic
936228230 2:110677918-110677940 CCCAGGGGGCTGGGGCGCCTGGG - Intronic
936448917 2:112618858-112618880 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
936954938 2:118013964-118013986 CCCAGGGGGCCGGAGGGCCAGGG - Exonic
937205663 2:120235513-120235535 GCCAGGGGGTTGGGGGTTAGGGG + Intergenic
937347065 2:121132601-121132623 CTGTGGGGGTTGGGGGTGCAGGG + Intergenic
937419120 2:121739839-121739861 CCCAGGGGGGTAGTGATCCAAGG + Intronic
938174582 2:129113446-129113468 CCCAGTGCTTTGGGGGTCTAAGG + Intergenic
938250197 2:129808771-129808793 CCCAGTGTGTTGGGAGGCCAAGG - Intergenic
938254424 2:129844252-129844274 CCCAGCACTTTGGGGGTCCAAGG - Intergenic
939374447 2:141345753-141345775 CCCAGGGTTTTGGGAGGCCAAGG - Intronic
939633877 2:144557849-144557871 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
940375634 2:152955016-152955038 CCCAGGGCTTTGGGAGCCCAAGG + Intergenic
940685148 2:156839445-156839467 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
941398052 2:164995620-164995642 CCCAGTGCTTTGGGAGTCCAAGG + Intergenic
941452373 2:165674961-165674983 CCCAGGACTTTGGGAGTCCAAGG - Intronic
941852356 2:170196438-170196460 CCCAGGAGGTTGAGGCTACAGGG + Intronic
942030320 2:171953092-171953114 CCCAGCAGTTTGGGGGACCAAGG + Intronic
942050687 2:172137748-172137770 CCCAGCGCGTTGGGAGGCCAAGG - Intergenic
942160481 2:173180598-173180620 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
942248233 2:174026331-174026353 CCCACAGGGTTGGTGGTGCATGG - Intergenic
942562523 2:177235577-177235599 CCCAGGAGTTTGGGAGGCCAAGG + Intronic
942605513 2:177686314-177686336 CCCAGTGCTTTGGGGGGCCAAGG + Intronic
943153116 2:184138726-184138748 CCCAGAGGGTTGGGTGTCCCTGG + Intergenic
943293098 2:186101181-186101203 CCCAGTGTGTTGGGAGGCCAAGG + Intergenic
943539703 2:189197278-189197300 GCCAGGGGGTTGGGGTGCGATGG + Intergenic
943925858 2:193778864-193778886 CCCAGGTGTTTGGGAGGCCAAGG - Intergenic
944186768 2:196957680-196957702 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
944640581 2:201720636-201720658 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
944792346 2:203143959-203143981 CCCAGGACGTTGGGAGGCCAAGG + Intronic
946027064 2:216678301-216678323 CCCAGGGGGTGGGGGCTGAAGGG + Intronic
946723146 2:222632696-222632718 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
947720665 2:232367736-232367758 AGCAGGCGGTGGGGGGTCCAGGG - Intergenic
948144647 2:235699235-235699257 GTCAGGGGGATGGGGGTCTAGGG + Intronic
948559517 2:238842279-238842301 CCCTGGGGGTAGGGGGCCCAAGG - Intergenic
948939488 2:241188899-241188921 CCAAGGGGCTTTGGGGACCAGGG - Intronic
949014392 2:241701559-241701581 CCCCGGGGGCTCGGGGTCCGGGG + Intergenic
949052674 2:241905517-241905539 CCCCGCAGGTTGGGAGTCCACGG - Intergenic
1169219825 20:3815519-3815541 CCCAGCGATTTGGGGGGCCAAGG + Intergenic
1169390300 20:5185347-5185369 CCCAGGAGGTTGAGGCTTCAAGG + Intronic
1171290734 20:23981620-23981642 CCTGGGGGGTTGGGGGACCCAGG - Intergenic
1172229492 20:33327211-33327233 TCCTGGGGGCTGGGGGTCAAGGG + Intergenic
1172321303 20:33997189-33997211 CCCAGGAGGTTGAGGTTGCAGGG - Intronic
1172868645 20:38120637-38120659 CCAATGGGGGTGGGGGGCCAGGG - Intronic
1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG + Intronic
1172940517 20:38650791-38650813 CCCCGGTGGTTGTGGGTTCAAGG - Intronic
1173458628 20:43224012-43224034 CCCAGGAGGTAGGGGGACTAAGG - Intergenic
1173458838 20:43225530-43225552 CCCAGGAGGTAGGGGGACTAAGG + Intergenic
1174168701 20:48603379-48603401 CCCTGGGTGTTGGGGATGCAGGG - Intergenic
1174334008 20:49844722-49844744 CCCAGGAGGTTGAGGCTACAGGG + Intronic
1174413246 20:50349619-50349641 GCCAGGGGTTTGGGGGACAAAGG - Intergenic
1175149845 20:56925187-56925209 CCCTGGGGGTCGGGGGTCAGGGG + Intergenic
1175819637 20:61901771-61901793 CCCATGGGGTTGGGGTGACAAGG + Intronic
1175838471 20:62011677-62011699 CCCAGGGGGTGTGGACTCCAGGG - Intronic
1175928602 20:62482713-62482735 TGCAGGGGGTGGGGGGTCCCAGG - Intergenic
1175973537 20:62699072-62699094 CCCAGGAGGGTGGGGGTCCCAGG + Intergenic
1176042366 20:63072316-63072338 CCCAGGGGGCCGCGGGTCCGGGG + Intergenic
1176079131 20:63262888-63262910 CCCTGGGGACTGGGGGTCCCAGG - Intronic
1176110265 20:63407724-63407746 CCCAGGAGGTGGGGGGACCTGGG + Intronic
1176271910 20:64239705-64239727 CCCAGGAGGATGGGGGCCAAGGG + Intronic
1176279259 20:64291329-64291351 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
1176427889 21:6560001-6560023 GCCATGGGGCTGGGCGTCCAGGG + Intergenic
1179146628 21:38774119-38774141 CCCCGGAATTTGGGGGTCCATGG + Intergenic
1179215532 21:39364013-39364035 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1179349959 21:40599367-40599389 GCCAGGGGGTTGGGGGCCAAGGG - Intronic
1179511784 21:41878713-41878735 AACGCGGGGTTGGGGGTCCAGGG + Exonic
1179703381 21:43168318-43168340 GCCATGGGGCTGGGCGTCCAGGG + Intergenic
1180163743 21:46009511-46009533 CACCGGGGGTTGGGGGTGGACGG + Intergenic
1180170451 21:46055546-46055568 CCTAGGGGGCAGGGGGTTCAAGG - Intergenic
1180877344 22:19180698-19180720 CCCAGGGGGTTGGGGGCTACAGG + Intronic
1181045250 22:20211238-20211260 CCCAAGGGGTTGGGTGCCCCTGG + Intergenic
1181319815 22:21995597-21995619 CCCAGGGTCTTAGGGCTCCAGGG - Intergenic
1181361103 22:22336750-22336772 CCGGGGGGGCTGGGGGTCAAGGG + Intergenic
1181467035 22:23115903-23115925 CCCAGGGGGTAGGGGGATCAGGG - Intronic
1181523016 22:23460113-23460135 CCCAGGCAGCTGGGGGTCCCAGG - Intergenic
1181692375 22:24571067-24571089 CCCAGGGCTTTGCGAGTCCAAGG - Intronic
1182095580 22:27623158-27623180 CCCAGGGGGTTGGGAGCCCATGG - Intergenic
1182248637 22:28981744-28981766 CCCAGCGTTTTGGGAGTCCAAGG + Intronic
1182275416 22:29185373-29185395 CCCACGGGGTTCAGGGCCCAGGG + Intergenic
1182518973 22:30874660-30874682 CCCAGGGGTTTGAGGGAACAAGG + Intronic
1183434313 22:37784543-37784565 CCCAGGGTCTTGTGTGTCCAGGG - Intergenic
1183705633 22:39473635-39473657 CACAGGGGCTTGGGGATCCCTGG + Intronic
1183902031 22:41013082-41013104 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1184053058 22:42023258-42023280 CCCAGGGGGTCGAGGCTGCAGGG - Intronic
1184410271 22:44322279-44322301 CCCATCAGGTTGGGGCTCCAAGG + Intergenic
1184548366 22:45189399-45189421 CCCAGGAGGTGGAGGCTCCAGGG + Intergenic
1184593162 22:45499284-45499306 TCCTGGGGGATAGGGGTCCATGG + Intergenic
1184701519 22:46176958-46176980 CCCAGGACTTTGGGGGGCCAAGG + Intronic
1185048513 22:48541253-48541275 CCCAGGGGGTATAGGGTCCTGGG - Intronic
1185108167 22:48885814-48885836 CCCAGGTGGGTGGAGCTCCAGGG - Intergenic
1185332871 22:50259478-50259500 CCCAGGAAGATGGGGTTCCAGGG + Intronic
1185381946 22:50513306-50513328 CCCAGCAGTTTGGGGGGCCAAGG + Intronic
950071275 3:10154867-10154889 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
950190673 3:10974234-10974256 CCAAGGGGGATGGGGCACCAGGG - Intergenic
950575909 3:13831976-13831998 CTCCCGGGGTTGGGGGTCCAAGG - Intronic
950613352 3:14139941-14139963 CCCAGGAGGATGGGGTTCCTCGG + Intronic
950696788 3:14706997-14707019 CCCAGCAGTTTGGGAGTCCAAGG + Intronic
950738424 3:15030472-15030494 CCCAGCAGGTTGGGGGCACATGG - Intronic
950894130 3:16432584-16432606 CCCAGTGGTTTGGGAGGCCAAGG + Intronic
951763697 3:26173101-26173123 CCCAGTGCTTTGGGAGTCCAAGG - Intergenic
952366061 3:32675898-32675920 CCCAGGGCTTTGGGAGGCCAAGG + Intergenic
953028961 3:39163855-39163877 CCCAGGGGGTTTTGGTTTCATGG + Intergenic
953525949 3:43690491-43690513 CCCCGCGGGTTGGGGGGCCAGGG - Intronic
953955274 3:47227153-47227175 CCCAGGAGGTTGAGGCTGCAAGG + Intergenic
953995932 3:47520021-47520043 CCCAGCAGGTTGGGAGGCCAAGG + Intergenic
954023848 3:47766313-47766335 CCCAGGACTTTGGGGGGCCAAGG + Intronic
955239978 3:57169751-57169773 CCCAGAGGGCTGAGGGTGCAAGG + Intronic
955347304 3:58170600-58170622 CGCAGGGGGTGGTGGGCCCATGG - Exonic
955778088 3:62455123-62455145 CCCAGGGGGTGGGGGGTGGGGGG - Intronic
956091070 3:65667645-65667667 CCCAGGAGGTTGAGGCTGCACGG - Intronic
956163036 3:66374632-66374654 CCCAGGATTTTGGGGGGCCAAGG + Intronic
956495464 3:69821370-69821392 CTTAGGGGGTTGGGGGTGGAGGG - Intronic
958407306 3:93765053-93765075 CCCAGGACCTTGGGAGTCCAAGG + Intergenic
958775487 3:98478123-98478145 GTCAGGGGGTTGGGGGGCTAGGG - Intergenic
958909561 3:99978642-99978664 CCCAGGACTTTGGGTGTCCAAGG + Intronic
959009897 3:101062574-101062596 CCCAGCGCTTTGGGGGGCCAAGG - Intergenic
959433558 3:106284871-106284893 CCTAGGGGGATGGGTGTCCCTGG - Intergenic
960815830 3:121671391-121671413 TACTGGGAGTTGGGGGTCCAGGG - Intronic
960848503 3:122027438-122027460 CCCAGCACTTTGGGGGTCCAAGG - Intergenic
960897361 3:122519776-122519798 CCCAGGACTTTGGGAGTCCAAGG - Intergenic
962239549 3:133740329-133740351 CTCAGGGGGTTGGGGGCTAAGGG + Intergenic
962751003 3:138434823-138434845 CCCAGGGCGCTGGGGGCCCCGGG - Exonic
963199595 3:142572520-142572542 CCCAGTGCTTTGGGAGTCCAAGG + Intronic
963397921 3:144757167-144757189 CCAAGGTGGGTGGGGGGCCAGGG - Intergenic
963804690 3:149711213-149711235 CCCAGCAGGTTGGGAGGCCAAGG + Intronic
964209674 3:154212854-154212876 CCCTGGGGGTGGGGGATCCATGG + Intronic
964380503 3:156094258-156094280 TCCAGGGGGTTGGGGACCCCTGG + Intronic
965299623 3:166993658-166993680 CCCAGGTGGTTGAGGCTGCAGGG + Intergenic
965304835 3:167051519-167051541 CCCTGGGGGTTGGGGACCCCTGG - Intergenic
965771616 3:172187868-172187890 CCCAGGACTTTGGGGGGCCAAGG - Intronic
966664930 3:182461452-182461474 CCCAGTGGCTTGGGAGGCCAAGG - Intergenic
966875767 3:184320770-184320792 TCCAGGGACTTGGGAGTCCAGGG - Intronic
967208180 3:187142861-187142883 CCCAGTGCTTTGGGGGGCCAAGG + Intronic
967360362 3:188623506-188623528 CCCAGGACTTTGGGGGGCCAAGG - Intronic
968371432 3:198224639-198224661 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
968698251 4:2042860-2042882 CCCAGGGGGTGGGGAGGGCAGGG + Intronic
968855740 4:3120455-3120477 GCCTGGGGGTTGGGGACCCATGG - Intronic
968958405 4:3730539-3730561 CCGTGGGGGCTGGGGGTGCAGGG + Intergenic
969299685 4:6290644-6290666 CCCAGGCCGTTGGGGGTAAAGGG + Intronic
969393633 4:6907157-6907179 CCCAGGGTGTTCAGTGTCCATGG - Intergenic
969606178 4:8203376-8203398 CCCTGGGGGTTGCTGGACCAAGG + Intronic
970913561 4:21307070-21307092 CCCAGGACTTTGGGGGTCCAAGG - Intronic
971277413 4:25211317-25211339 CCTAGGGGGTGGGGGTTGCAAGG - Intronic
971483709 4:27138631-27138653 CCCTGGGGGTTGGGGAGCCCTGG - Intergenic
972543247 4:40057077-40057099 CCCTGGAGGTTAGGGGTCCCGGG + Intronic
972923108 4:43968173-43968195 CCCTGGGGGTTGGGGGCCCTTGG - Intergenic
973889839 4:55357820-55357842 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
973987546 4:56369674-56369696 CCCAGGACTTTGGGAGTCCAAGG + Intronic
973992256 4:56421412-56421434 ACCAGGGGGTGAGGGGGCCATGG - Intronic
975879590 4:78888339-78888361 CCCAGGGTATTGGGGGTATAAGG - Intronic
976175685 4:82349335-82349357 CCCAGGAGGTGGGGGTTGCAGGG + Intergenic
976260933 4:83144175-83144197 CCCAGCGCTTTGGGAGTCCAAGG - Intergenic
976434874 4:85005717-85005739 CCCAGCACGTTGGGGGTCCAAGG + Intergenic
976594277 4:86880102-86880124 CCCAGAAGGTTGGGAGGCCAAGG - Intronic
976634869 4:87277514-87277536 CCCAGCAGTTTGGGGGGCCAAGG - Intergenic
978522871 4:109634947-109634969 ATCAGGGGGTTGGGGGGCTAGGG - Intronic
979260117 4:118637112-118637134 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
979328259 4:119403516-119403538 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
980312330 4:131147520-131147542 CCCAGGGCTTTGGGAGACCAAGG - Intergenic
980715743 4:136626317-136626339 GCCATGGGGTGGGGGGTGCAGGG - Intergenic
980930182 4:139177159-139177181 CCTAGGCGGTTGGGGGTCGGTGG - Exonic
981144032 4:141304268-141304290 CCCAGCAGTTTGGGGGGCCAAGG - Intergenic
981320607 4:143387379-143387401 CCCAGTGCTTTGGGAGTCCAAGG - Intronic
981580510 4:146244729-146244751 CCCAGGGAGTTTGCAGTCCAGGG - Intergenic
982312655 4:154002155-154002177 TATTGGGGGTTGGGGGTCCAAGG + Intergenic
983070457 4:163261741-163261763 CCCAGCAGTTTGGGGGACCAAGG - Intergenic
983332651 4:166351357-166351379 CCCAGGAGGTAGGGGTTGCAGGG - Intergenic
984619213 4:181933010-181933032 CCCAGGGGGTTGGGGGCAAGGGG + Intergenic
984761402 4:183365883-183365905 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
985020181 4:185680710-185680732 CCCAGAGGCTTGGAGGTGCAAGG + Intronic
985783460 5:1882435-1882457 CCCCGGGGGTTTGGGGAGCAGGG + Intronic
985882479 5:2649361-2649383 GTCAGGGGGTTGGGGGCACACGG - Intergenic
986255604 5:6100468-6100490 TCCATGGGGTGGGAGGTCCATGG - Intergenic
986255808 5:6101096-6101118 TCCATGGGGTGGGAGGTCCATGG - Intergenic
986255815 5:6101112-6101134 TCCATGGGGTGGGAGGTCCATGG - Intergenic
986256065 5:6101830-6101852 TCCAGGGAGTGGGAGGTCCATGG - Intergenic
987387461 5:17343456-17343478 CCCAGGAGGTTGGGGCTGCAGGG + Intergenic
988304336 5:29475367-29475389 CCCAGCACGTTGGGAGTCCAAGG + Intergenic
988663661 5:33301423-33301445 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
989000390 5:36754125-36754147 CTTAGGGGATTGGTGGTCCACGG - Intergenic
989472639 5:41838198-41838220 AACAGGGGGCTGGAGGTCCAGGG + Intronic
991158793 5:63470297-63470319 CCCAGCAGGTTGGGAGGCCAAGG + Intergenic
991703616 5:69337708-69337730 CCCAGGGGGCTGAGGATTCAGGG - Intergenic
991909750 5:71550133-71550155 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
992313787 5:75531542-75531564 CCCAGAAGTTTGGGAGTCCAAGG + Intronic
992453061 5:76890712-76890734 CCTAGGGTGTGGGGTGTCCAAGG + Intronic
992961617 5:81961218-81961240 CCCAGGGCTTTGGGGGGTCAAGG - Intergenic
993703518 5:91144554-91144576 CCCAGTGGCTTGGGAGACCAAGG - Intronic
994651189 5:102531059-102531081 CCCAGTGCTTTGGGGGGCCAAGG + Intergenic
996058491 5:119006568-119006590 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
996811653 5:127522464-127522486 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
996923359 5:128794788-128794810 GCCATGGGGTTGGGGGTGGAGGG - Intronic
997249057 5:132374803-132374825 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
997590453 5:135068979-135069001 CCCGAGGGGCTGGGGGTCTAGGG + Intronic
998872931 5:146570572-146570594 CCCAGAGGCTTGGGGACCCATGG + Intergenic
999579652 5:153022660-153022682 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
999686911 5:154111409-154111431 CCCAGCGTGTTGGGAGTCCAAGG + Intronic
999797032 5:154998387-154998409 GTCAGGGGGTTGGGGGGCTAGGG - Intergenic
999863687 5:155677948-155677970 CAAAGGGGGTTGGGGGTCTAGGG + Intergenic
999876996 5:155818594-155818616 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1000181924 5:158819979-158820001 CACAGGGGTTTGCGAGTCCATGG + Intronic
1001251871 5:170152910-170152932 GCCAGGGGGTGGGGGCTGCATGG - Intergenic
1001699218 5:173694692-173694714 CCCAGGACTTTGGGAGTCCAAGG - Intergenic
1001727388 5:173917481-173917503 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
1002028899 5:176414018-176414040 CCCAGGATGGTGGGGCTCCAGGG - Intronic
1002276433 5:178107125-178107147 CCCTGGGGGTGGGGGGACCCAGG + Intergenic
1002566333 5:180114353-180114375 CCCATGAGGCTGGGTGTCCAAGG + Intronic
1002730670 5:181330185-181330207 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
1002753860 6:143919-143941 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
1002765114 6:232687-232709 CCCTGGGGGTTGGGGATGCCTGG + Intergenic
1004515118 6:16315998-16316020 GCCTGGGGGTTGGGGATCCCTGG - Intronic
1004793087 6:19050892-19050914 CCCTGGGGGATGGGCGTCCATGG - Intergenic
1005024659 6:21450875-21450897 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1005640002 6:27786893-27786915 GCCAGGGGCTGGGGGGTGCAAGG + Intergenic
1005741311 6:28793502-28793524 CCCAGGGTTTTGGGAGGCCAAGG + Intergenic
1006228183 6:32558361-32558383 TACAGGGGTTTGGGGGACCAGGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006633098 6:35443368-35443390 TCCAGGGGGCTGGGGGTCTTTGG - Intergenic
1006814408 6:36840378-36840400 CCCAGGGGCTTGGGTGTGGAGGG + Intergenic
1007111087 6:39313890-39313912 ACCAGAGGGTTGGGGGACCTCGG - Intronic
1007426679 6:41750743-41750765 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
1007470730 6:42088612-42088634 CTCAGGGGGTTGGTGCTCCTGGG - Intergenic
1007677453 6:43608602-43608624 CCCAGGAGGTTGAGGCTACAAGG - Intronic
1007842259 6:44726411-44726433 GCCAGGGGGGTGGGAGTACAGGG + Intergenic
1008601147 6:53096652-53096674 CCCAGGACTTTGGGGGGCCAAGG + Intronic
1008607929 6:53158461-53158483 CCTAGGAGGTTGGGGCTGCAAGG + Intergenic
1010105861 6:72166623-72166645 CCCAGAGATTTGGGAGTCCAAGG + Intronic
1010336097 6:74685067-74685089 CCCAGCGGGATGGGTGTCCCTGG - Intergenic
1010422242 6:75688667-75688689 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
1011375993 6:86687502-86687524 CCCAGGTGGTTGCCAGTCCAGGG - Intergenic
1011587488 6:88942444-88942466 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1011594252 6:89001264-89001286 CCCAGGGGTTTGAGGTTACAGGG - Intergenic
1012393629 6:98770929-98770951 CCCAGGAGGTTGAGGCTGCATGG + Intergenic
1012400027 6:98835147-98835169 CCCAGGGGGCTGGTGGACCACGG - Exonic
1013141013 6:107334904-107334926 CCCAGTGCTTTGGGGGGCCAAGG + Intronic
1013220759 6:108075008-108075030 CCCAGAGGGTTGGGCGTTCAAGG - Intronic
1013523908 6:110957326-110957348 CCCAGGAGTTTGAGGGTACAGGG + Intergenic
1013606252 6:111751695-111751717 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1014607468 6:123495127-123495149 CCCAGGAGGTTGGGGCTGCAGGG - Intronic
1014901464 6:126970631-126970653 CCCAGCAGGTTGGGAGGCCAAGG - Intergenic
1015849578 6:137558169-137558191 CCCAGCGCGTTGGGAGGCCAAGG - Intergenic
1016169294 6:140989726-140989748 GTCATGGGGTTGGGGGACCAGGG - Intergenic
1016409337 6:143765564-143765586 CACAGGGGGTGGAGGGACCATGG - Exonic
1016511121 6:144844517-144844539 CCCAGCGGTTTGGGAGGCCAGGG - Intronic
1017203519 6:151780203-151780225 GTCGGGGGGTTGGGGGTCAAGGG + Intronic
1018447684 6:163873330-163873352 CCCAGGAGGTGGGGGTTGCAGGG - Intergenic
1018743772 6:166748754-166748776 CCCAAGGGGATGGGGGCCCGAGG - Intronic
1018743818 6:166748865-166748887 CCCAAGGGGATGGGGGCCCGAGG - Intronic
1018743865 6:166748977-166748999 CCCAAGGGGATGGGGGCCCGAGG - Intronic
1018772274 6:166981815-166981837 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1018957878 6:168423334-168423356 CCCAGCATGTTGGGAGTCCAAGG - Intergenic
1019341744 7:511774-511796 CTCAGGGGGCTGGAGGGCCATGG + Intronic
1019362953 7:614999-615021 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1019499762 7:1359005-1359027 CCCAGAGGGGTGGGGGTCCCTGG + Intergenic
1019588316 7:1816450-1816472 CCCAGGCAGTTGGGGGTCCCAGG + Intronic
1019734608 7:2644576-2644598 CCCTGGAGGGTGGGGGTGCAGGG + Intronic
1019792623 7:3026758-3026780 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1019877671 7:3828905-3828927 CCCAGTGGTTTGGGAGGCCAAGG - Intronic
1019965925 7:4498648-4498670 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1020023514 7:4883260-4883282 CCCCTGGAGTTGGGGGTCCGGGG + Intronic
1021049625 7:15966497-15966519 GTCAGGGGGTAGGGGGTCTAGGG + Intergenic
1022801405 7:33780568-33780590 CCCAGCACTTTGGGGGTCCAAGG - Intergenic
1023401832 7:39796713-39796735 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
1023426765 7:40044884-40044906 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1023871433 7:44264984-44265006 CCCAGAGGGATGGGGGTCAGGGG - Intronic
1023921161 7:44631076-44631098 GCCCGGGGGTTGGGGATCCCTGG + Intronic
1024013903 7:45294131-45294153 CCATGTGAGTTGGGGGTCCAGGG + Intergenic
1024075813 7:45817358-45817380 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
1024647786 7:51383949-51383971 CCCCTGGGGGTGGGGGCCCAGGG + Intergenic
1024712495 7:52032520-52032542 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1025051625 7:55738436-55738458 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
1025176968 7:56806986-56807008 CCCCTGGGGATGGGGGCCCAGGG + Intergenic
1025694824 7:63769400-63769422 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
1026020528 7:66701421-66701443 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1026189530 7:68112227-68112249 CACAGGGGGTTGAGGCTGCAGGG - Intergenic
1026540895 7:71279171-71279193 CACAGAGGGTTGGGAGGCCAAGG - Intronic
1026597932 7:71750138-71750160 CCCAGTGGTTTGGGAGGCCAAGG - Intergenic
1026879747 7:73900938-73900960 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1026880106 7:73902371-73902393 ACCAGGAAGTTGGGGGTCCCTGG + Intergenic
1026930061 7:74218946-74218968 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1027176411 7:75906589-75906611 CCCAGGGGTTTGGGGCAGCAAGG + Intronic
1027545835 7:79526512-79526534 CCCAGGGTGTGGGGGGCTCAGGG - Intergenic
1028463384 7:91121311-91121333 CCAAGGGGGTTGGGGGCTGAAGG + Intronic
1028575937 7:92350605-92350627 CCCAGGGCTTTGGGAGGCCAAGG + Intronic
1028794274 7:94886269-94886291 CCCAGGAGGTTGAGGCTTCAGGG + Intergenic
1028913020 7:96228981-96229003 CCCACGGGGTTGGGGGGACTTGG - Intronic
1029167590 7:98604415-98604437 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1029532735 7:101136123-101136145 CCCAGCGCTTTGGGGGACCAAGG + Intronic
1029859353 7:103552748-103552770 CCCAGGAGTTTGGGAGGCCAAGG - Intronic
1029946986 7:104543149-104543171 GACAGGGGGTGAGGGGTCCAAGG + Intronic
1030576214 7:111289264-111289286 GTCAGGGGGTTGGGGGGCTAGGG + Intronic
1030763601 7:113381669-113381691 CCCAGGAGGTGGGGGTTGCAGGG - Intergenic
1031508659 7:122620980-122621002 CCCAGGAGGTTGAGGGTACATGG - Intronic
1031604158 7:123748742-123748764 CCGGCGGGGTTGGGAGTCCAGGG + Exonic
1031998204 7:128246711-128246733 CCCAGGGCTTTGGGAGGCCAAGG - Intronic
1032052345 7:128657105-128657127 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
1032235183 7:130115463-130115485 CCCAGGATGTTGGGAGGCCAAGG + Intronic
1032287023 7:130546519-130546541 CTCAGGGGGTTATGGATCCAGGG + Intronic
1032626136 7:133592995-133593017 CCCAGGATGTTGGGAGGCCAAGG - Intronic
1032633329 7:133678684-133678706 CCCAGGAGGTTGAGGATACAGGG - Intronic
1032697690 7:134351614-134351636 TCCAGGGGCGGGGGGGTCCATGG - Intergenic
1032790017 7:135235690-135235712 CCCAGCATGTTGGGGGGCCAAGG - Intronic
1033262766 7:139857982-139858004 CCCAGTGTTTTGGGGGGCCAAGG - Intronic
1033442771 7:141395363-141395385 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1033640425 7:143258277-143258299 CCCAGCATTTTGGGGGTCCAAGG + Intronic
1033786256 7:144734595-144734617 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1033822672 7:145152875-145152897 GCCAGGGGGTTGGGATTGCAGGG - Intergenic
1034628168 7:152510067-152510089 CCCAGCAGGTAGGGGCTCCAGGG + Intergenic
1035476876 7:159149975-159149997 CCGAGGGTGTGGGGGATCCAGGG + Intergenic
1036124926 8:6053732-6053754 CCCAGGCAACTGGGGGTCCAGGG - Intergenic
1036156533 8:6347397-6347419 CACAGGGGGTTGGGACTTCACGG - Intergenic
1036414695 8:8536223-8536245 CCCAGTGGTTTGGGAGGCCAAGG - Intergenic
1036423136 8:8616630-8616652 CCCAGCACTTTGGGGGTCCAAGG + Intergenic
1036722167 8:11186450-11186472 CCCAGGAGGTTGAGGCTGCAGGG - Intronic
1036985658 8:13526768-13526790 GCCAGGGGGTTGGGGGACAGGGG + Intergenic
1037118622 8:15256164-15256186 CCCAGGAGGTTGAGGATACAGGG + Intergenic
1037735466 8:21562381-21562403 TCCAGGGGGTTGGGGGTGTGTGG - Intergenic
1037739781 8:21599028-21599050 GTCAGGGGGTTGGGGGGCAAGGG + Intergenic
1038213637 8:25542024-25542046 CCCAGGAGTTTGAGGATCCAGGG - Intergenic
1038218545 8:25585671-25585693 CTCAGGGGCTTGAGGGGCCAGGG - Intergenic
1038315772 8:26483233-26483255 CCCAGGGACTTGGGAGGCCAAGG - Intronic
1039164753 8:34665401-34665423 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1039883853 8:41644502-41644524 CCTGGGGGTCTGGGGGTCCAAGG + Intergenic
1040441125 8:47443493-47443515 CCCAGGAGGTGGGGGTTGCAGGG + Intronic
1041217007 8:55610829-55610851 CCCAGGGCTTTGGGAGGCCAAGG - Intergenic
1041828946 8:62130742-62130764 CTCGGGGATTTGGGGGTCCAAGG + Intergenic
1042126800 8:65546137-65546159 CCCAGCAGGTTGGGAGGCCAAGG - Intergenic
1042653826 8:71072916-71072938 CCCAGGGGTTTGGGAGGCCAAGG + Intergenic
1043142258 8:76604710-76604732 CCCAGGAGGTGGGGGATGCAGGG - Intergenic
1043852312 8:85228969-85228991 CCCAGGTGGATGAGAGTCCATGG - Exonic
1043872328 8:85447645-85447667 CCCAGTACTTTGGGGGTCCAAGG + Intronic
1043932650 8:86108390-86108412 CCAAGGGGTTTGGGAGGCCAAGG - Intronic
1044157658 8:88869264-88869286 CCCAGAGGTTTGGGAGGCCAAGG + Intergenic
1044563989 8:93643449-93643471 CCCAGCATGTTGGGGGGCCAAGG - Intergenic
1045561286 8:103266170-103266192 CCCTCGGGGTTGGGGGTGAAGGG - Intergenic
1046211425 8:111081416-111081438 GGCAGGGGGTTGGGGTTGCAGGG - Intergenic
1047286072 8:123488247-123488269 CCCAGTGGGTTTCGGGTCCGTGG - Intergenic
1048405276 8:134113007-134113029 CCCAGTGCTTTGGGAGTCCAAGG - Intergenic
1048937606 8:139369841-139369863 CCCAGGGGAATGGGGGCCCAAGG + Intergenic
1049555027 8:143277404-143277426 CCCTGGGGTGTGGGGGCCCAGGG + Intergenic
1049676279 8:143890706-143890728 CCCAGTTGGTTCGGGGCCCATGG - Intergenic
1049680356 8:143915383-143915405 CAAAGGGGGCTGGGGCTCCATGG + Exonic
1049745963 8:144263444-144263466 CCCTGGGGGCTGGGGAGCCAGGG - Intronic
1050392488 9:5159922-5159944 CCCAGCAGGTTGGGAGGCCAGGG + Intronic
1050571376 9:6942939-6942961 ACCAGGAGGTTGGGGCTACAAGG - Intronic
1050676041 9:8053868-8053890 CCTAGGGGGATGGGTGTCCCTGG + Intergenic
1051757438 9:20418730-20418752 CCCAGTTTGTTGGGAGTCCAAGG - Intronic
1052763336 9:32614976-32614998 CCCAGCAGGTTGGGAGGCCAAGG - Intergenic
1052917588 9:33935515-33935537 CCCAGTGCTTTGGGGGGCCAAGG - Intronic
1053072063 9:35107560-35107582 GGCAGGGGCCTGGGGGTCCAGGG + Exonic
1053385069 9:37680593-37680615 CCTGGGGTGATGGGGGTCCAGGG + Intronic
1053451548 9:38197998-38198020 CCCTTGGGGTTGGGGCACCATGG - Intergenic
1054828366 9:69596235-69596257 CTCAGGGGTTTGGGAGACCAAGG - Intronic
1055234247 9:74100483-74100505 CCCAGCGCTTTGGGGGTCCAAGG - Intergenic
1056321475 9:85439393-85439415 GTCAGGGGGTTGGGGGTTAATGG + Intergenic
1056437904 9:86590787-86590809 CCCAGAGGTTTGAGGATCCAGGG + Intergenic
1056467352 9:86870784-86870806 CCCAGGAGTTTGGGAGGCCAAGG + Intergenic
1056732415 9:89177944-89177966 CCCTGGGGGCTGGGGGTTCTGGG - Intronic
1056839680 9:89988335-89988357 CCCAGAGGGTTGGTGGTGGAAGG - Intergenic
1056971316 9:91206973-91206995 GCCAGGGGCTTGGGGGTGGAGGG + Intergenic
1057979827 9:99649956-99649978 CCTAGGGGGATGGGTGTCCCTGG - Intergenic
1058494609 9:105542704-105542726 CCCAGGATTTTGGGGGGCCAAGG - Intronic
1059305887 9:113352760-113352782 GCTGGGGGGTTGGGGGTGCAGGG + Intronic
1059335514 9:113566272-113566294 CCCATGGGGTTGGAGGTCAGAGG - Intronic
1059641314 9:116219597-116219619 CCCAGTGGATTTGGGGGCCATGG + Intronic
1060029300 9:120200582-120200604 GCCAGGGGCTGGGGGGTCAAGGG - Intergenic
1060111511 9:120909948-120909970 CCCTGGAGGCTGGGGGTACATGG + Intronic
1060422202 9:123477277-123477299 CCCAGTGCGTTGGGAGGCCAAGG + Intronic
1060423592 9:123486760-123486782 CCCAGAAGGTTGGGGGACCATGG - Intronic
1060555709 9:124506365-124506387 CTCAGGGGTTTGGGGGTGCGGGG - Intronic
1060819593 9:126653750-126653772 CCCAGGGGGCTGGGGATGAAGGG - Intronic
1061004334 9:127920027-127920049 CCCAGGAGGTTGAGGCTGCAAGG + Intergenic
1061029513 9:128071660-128071682 CCCAGTGCTTTGGGGGGCCAAGG - Intronic
1061258560 9:129466830-129466852 CCCAGGGGGTTGAGGCTGTAGGG + Intergenic
1061401438 9:130370507-130370529 CCCAGGGGGGTGGGGGTGTTGGG - Intronic
1061522083 9:131124701-131124723 CCCAGGAGGTTGAGGCTACAGGG - Intergenic
1061547236 9:131311570-131311592 CCCAGCACTTTGGGGGTCCAAGG + Intergenic
1061558021 9:131383992-131384014 CCCAGGAGGCAGAGGGTCCAAGG - Intergenic
1061873340 9:133532084-133532106 CCCGGGAGGGTGGGGTTCCAGGG - Intergenic
1062014863 9:134286311-134286333 CCCAGTGTTTTGGGGGGCCAAGG - Intergenic
1062037527 9:134389388-134389410 CCCAGGGGGTTAGGGGGCCAGGG + Intronic
1062211611 9:135367313-135367335 CCCAGCGCTTTGGGAGTCCAAGG + Intergenic
1062268745 9:135699361-135699383 GCCAAGGGGTTGGGGGCCCAAGG - Intronic
1062342764 9:136101053-136101075 CCCAAGGGGTGGAGGGCCCAGGG - Intergenic
1062397766 9:136359290-136359312 CCCTGGGGGCTGTGGGGCCATGG - Exonic
1062518971 9:136949805-136949827 CACGGTGGGCTGGGGGTCCAGGG + Intronic
1062728640 9:138095932-138095954 GCCAGGGGGTTGGGGGGGCGGGG + Intronic
1062755079 9:138282695-138282717 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
1203578987 Un_KI270745v1:26864-26886 CCCCTGGGGATGGGGGCCCAGGG - Intergenic
1185464305 X:345969-345991 CGCCTGCGGTTGGGGGTCCACGG - Intronic
1185475422 X:412688-412710 CCCAGAGGGTTGAGGCTGCAAGG - Intergenic
1185634668 X:1542930-1542952 CCCAGCAGTTTGGGGGACCAAGG - Intergenic
1185757251 X:2661668-2661690 CACAGGGGGATGGGAGCCCAAGG + Intergenic
1185766498 X:2729900-2729922 CCCAGTGCTTTGGGAGTCCAAGG + Intronic
1185939862 X:4304452-4304474 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1186100038 X:6146037-6146059 CCCAGGAGGTTGAGGCTGCAGGG + Intronic
1186411077 X:9344794-9344816 ACCAGGGAGTTGGAGGTTCAAGG - Intergenic
1187085123 X:16034660-16034682 CCCAGGAGGTTGAGGCTACAGGG - Intergenic
1187198466 X:17110936-17110958 CCCAGGAGGTTGAGGTTGCAGGG + Intronic
1188598291 X:31928352-31928374 CCCAGGACTTTGGGAGTCCAAGG + Intronic
1189262856 X:39690072-39690094 CTCAGGGACTTGGGGGTCCATGG + Intergenic
1189361078 X:40351936-40351958 CCCAGAGGGTTTGGGGTATATGG + Intergenic
1189454578 X:41174345-41174367 CCATGGGGGGTGGGGGTGCAGGG - Intronic
1189471312 X:41316302-41316324 CCCAGGAGGTTGAGGCTGCAGGG + Intergenic
1189909133 X:45792456-45792478 GCCTGGGGGTTGGGGATCCCTGG - Intergenic
1192248533 X:69392227-69392249 CCCAGGGGGTTGGGTGTCGGGGG + Intergenic
1192553826 X:72074363-72074385 CCCAGGGGGATAGGGGTCAATGG - Intergenic
1194240195 X:91435734-91435756 CCCAGGGGGCTGCGGGTCACCGG - Exonic
1194590495 X:95794656-95794678 CCCAGGGGTTTGGGAGGCCAAGG + Intergenic
1197141394 X:123121578-123121600 CCCAGGGGGATGGGCATCCCTGG - Intergenic
1197370688 X:125622105-125622127 CCCAGGGGGTTTGGTGTGGAGGG - Intergenic
1198101888 X:133429238-133429260 CCCAGGAGGTTGAGGCTGCAGGG - Intergenic
1198885141 X:141327296-141327318 CCTAGGGGGATGGCCGTCCATGG - Intergenic
1200256970 X:154587766-154587788 CCCAGGAGGTGGAGGGTGCAGGG + Intergenic
1200260799 X:154616636-154616658 CCCAGGAGGTGGAGGGTGCAGGG - Intergenic
1200416444 Y:2916656-2916678 GCCAGGGGGTAGGGAGTCCCTGG + Intronic
1200795598 Y:7338588-7338610 CCCAGGAGGTGGGGGTTGCAGGG - Intergenic
1201309652 Y:12584845-12584867 CCCAGGACTTTGGGAGTCCAAGG + Intergenic
1201723158 Y:17125033-17125055 CCCAGGTGGTTGAGGCTACAGGG + Intergenic