ID: 1163530094

View in Genome Browser
Species Human (GRCh38)
Location 19:17843785-17843807
Sequence GTACAGCAGGACTTGGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163530086_1163530094 12 Left 1163530086 19:17843750-17843772 CCCTGGGGGCTGGGGGGCACTTC 0: 1
1: 0
2: 3
3: 25
4: 237
Right 1163530094 19:17843785-17843807 GTACAGCAGGACTTGGGTGCTGG 0: 1
1: 0
2: 1
3: 19
4: 194
1163530087_1163530094 11 Left 1163530087 19:17843751-17843773 CCTGGGGGCTGGGGGGCACTTCC 0: 1
1: 0
2: 4
3: 42
4: 322
Right 1163530094 19:17843785-17843807 GTACAGCAGGACTTGGGTGCTGG 0: 1
1: 0
2: 1
3: 19
4: 194
1163530088_1163530094 -10 Left 1163530088 19:17843772-17843794 CCTACCGAATCCTGTACAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1163530094 19:17843785-17843807 GTACAGCAGGACTTGGGTGCTGG 0: 1
1: 0
2: 1
3: 19
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163530094 Original CRISPR GTACAGCAGGACTTGGGTGC TGG Exonic
902256187 1:15190105-15190127 TTAGAGCAGGGCTTGGGGGCAGG + Intronic
903059679 1:20661246-20661268 GTCCAGCAGCACTAAGGTGCGGG + Exonic
905172649 1:36118332-36118354 GTAGAGCAGGAGTAGGGGGCAGG - Intronic
908039172 1:60089005-60089027 GTTTAGCATGACTTGGATGCTGG + Intergenic
913439622 1:118884072-118884094 GTACAACTGGACTTGGCTTCCGG - Exonic
915184091 1:154089537-154089559 CTACAGCTGGACTAGGGTTCAGG + Exonic
919317153 1:195986263-195986285 GTTTAGCAGGACTTGGGGACAGG + Intergenic
920533710 1:206723598-206723620 GCACATCAGGCCCTGGGTGCCGG + Intronic
920574687 1:207050820-207050842 GTCCAGCCGGACCCGGGTGCGGG - Exonic
921406791 1:214789029-214789051 GAAAAGGAGGGCTTGGGTGCTGG + Intergenic
922452065 1:225745430-225745452 ATACAGCAGGACTTGGCATCTGG - Intergenic
922452948 1:225751262-225751284 AGACAGCAGGACCTGGGTGTGGG - Intergenic
922455993 1:225773909-225773931 GTAAAGCAGAGCCTGGGTGCAGG - Intergenic
922725460 1:227920958-227920980 GTACAGCTGGAGCAGGGTGCCGG - Exonic
922819021 1:228471240-228471262 GTACCGCAGTGCTGGGGTGCCGG - Intergenic
1063151160 10:3337719-3337741 GTACAGCAGGAGATGTGGGCAGG - Intergenic
1065705562 10:28468953-28468975 ATACAGCAGGGCTTGGGAGCAGG - Intergenic
1066277080 10:33879856-33879878 GTAGAGCAGGCCTTGGGTCTGGG - Intergenic
1067346537 10:45442411-45442433 TTGAAGAAGGACTTGGGTGCTGG - Intronic
1070646083 10:78203392-78203414 GTAGAGCAGGGTTTGGGTCCAGG - Intergenic
1071542366 10:86498229-86498251 CTACAGCAGGACAAGGGCGCTGG + Intronic
1072632247 10:97154464-97154486 GCATAGCAGGATTTGGGTGAAGG - Intronic
1073204719 10:101762828-101762850 GGACAGCTGGAATTGGGTGTTGG + Intergenic
1075509980 10:123064241-123064263 GTCCTGCTGGACTGGGGTGCTGG - Intergenic
1076472533 10:130728961-130728983 ACCCAGCAGGACTTTGGTGCAGG - Intergenic
1081644301 11:44779014-44779036 GCTCAGCAGGACCTGGGTCCTGG - Intronic
1085283587 11:75346049-75346071 GGCCAGCAGGTCTTGGATGCTGG - Intronic
1087728883 11:101756254-101756276 GCACAGCAGGACTGGAGCGCAGG + Intronic
1089283815 11:117392936-117392958 GTGCAGCAGGCCCTGAGTGCTGG + Intronic
1090621307 11:128563429-128563451 GTACAGCAGGACTTGAACCCAGG - Intronic
1091127077 11:133110008-133110030 GTTCGACAGGACTTGGGTGAAGG + Intronic
1091349169 11:134879381-134879403 TTAGAGCAGGACTTGGGGGCAGG + Intergenic
1092057661 12:5521263-5521285 GTACAGCAGCCCTTATGTGCGGG - Intronic
1096412610 12:51388141-51388163 AATCAGCAGGACTTGGGAGCGGG - Intronic
1096612816 12:52814153-52814175 GAGCAGCAGGGCTTGGTTGCAGG + Exonic
1097193926 12:57233506-57233528 GTAGTGCAGGGCTTGGGTCCAGG + Intronic
1097266101 12:57745663-57745685 ATACAAGAGGACTTGGGAGCGGG - Intronic
1098470785 12:70841022-70841044 GTGCAGAAGAACTTGGTTGCAGG - Intronic
1098538691 12:71625595-71625617 GTCCAGGAGGACTTGGGTCCAGG + Intronic
1101236377 12:102794235-102794257 GTACAGCGGGGCTGGGGAGCAGG + Intergenic
1102114989 12:110396135-110396157 GCACAGCAGGAGGTGGGTGGAGG - Intronic
1103230341 12:119325153-119325175 GTACAGTAGGACTTTAGTGGAGG - Intergenic
1104048852 12:125183381-125183403 CTGCAGCAGAACTGGGGTGCGGG + Intergenic
1104606291 12:130191455-130191477 GGACAGCATGGCATGGGTGCAGG - Intergenic
1104862386 12:131930252-131930274 GTCCGGCAGGATTTAGGTGCAGG + Intronic
1105541895 13:21322965-21322987 GTGCAGATGGACTTGGGTACAGG + Intergenic
1105669830 13:22600800-22600822 GCACAGCAGGAGGTGGGTGGTGG - Intergenic
1106687562 13:32077151-32077173 CATCAGCAGGACTTGGGTGAGGG + Intronic
1112006606 13:95259021-95259043 GGAGAGCAGGAGCTGGGTGCAGG + Intronic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112991901 13:105524633-105524655 GTTCAGCAGGACTTGGACACTGG - Intergenic
1113441684 13:110333994-110334016 ATGGAGCTGGACTTGGGTGCTGG + Intronic
1118359276 14:65042571-65042593 GCACAGCAGGACATGAGTGGTGG - Intronic
1119851125 14:77867349-77867371 GTACAGGAGGACTAGGGGCCAGG + Intronic
1121427164 14:93860540-93860562 GTACAGCAGGGCCTGGGCACTGG - Intergenic
1121741159 14:96253226-96253248 TTACACCAGGACTTGAGTGATGG + Intronic
1121928972 14:97954830-97954852 GTTCAGCAGGAATTATGTGCTGG - Intronic
1122979001 14:105182688-105182710 TGACAGCTGGACTTGGATGCTGG - Intergenic
1123716545 15:23037416-23037438 GTTCAGCTGGACTTAGGTACAGG - Intronic
1123766467 15:23483637-23483659 CTTCAGCAGGACTTGGTTCCTGG - Intergenic
1128710158 15:69865797-69865819 GTACACCAGGATTTGGGTGTGGG + Intergenic
1129100060 15:73253152-73253174 GTACAGCCTGGCTTGGGTGTAGG + Intronic
1129746853 15:78028068-78028090 GGCCAGCAGGAATAGGGTGCAGG - Intronic
1131046627 15:89320712-89320734 GTAAAGCAGGCCTCGGGTCCTGG + Intronic
1133874470 16:9720761-9720783 GTCCAGCAGGATTTGGCTTCTGG - Intergenic
1133997582 16:10759981-10760003 CCACAGCAGGACTTGGGTACAGG + Intronic
1134309200 16:13060506-13060528 GTACAGCAAGCCTTGGGCGATGG + Intronic
1135418860 16:22290683-22290705 GAACAGCAAGTTTTGGGTGCTGG + Intergenic
1137749220 16:50846542-50846564 GGAGAGCAGGACATGGGTGGGGG - Intergenic
1138293546 16:55868123-55868145 CTACAGCAGGAGATGGATGCGGG - Intronic
1143112470 17:4560111-4560133 CTGCACCAGGACTTGGGGGCTGG + Intronic
1144424821 17:15132017-15132039 GTCCAGCAGGACTTGTTTACTGG + Intergenic
1146087941 17:29847641-29847663 GTCCAGCAGGACTTGTTTTCTGG + Intronic
1146562749 17:33885170-33885192 GGACAGCAGGACCTGGATGTGGG - Intronic
1146794242 17:35770007-35770029 GGACAGGAGGCCTTGGGGGCAGG + Intronic
1150118689 17:62579882-62579904 GAGCCACAGGACTTGGGTGCTGG - Intronic
1150457768 17:65321394-65321416 GTAGAGGAGGACTAGGGTGCAGG - Intergenic
1151574293 17:74943933-74943955 GGACACCTGGAGTTGGGTGCAGG - Intronic
1152200246 17:78941286-78941308 CTACAGGAGGACTTTGCTGCAGG + Intergenic
1153618244 18:6953287-6953309 GTACAGCGGGGCTTGTGTTCAGG + Intronic
1155738602 18:29256392-29256414 GTACAGCAGTACTAGGTTACTGG + Intergenic
1156034094 18:32747637-32747659 GTACAGCAGGAGGTGAGTGGTGG - Intronic
1156507815 18:37609631-37609653 GTCCAGCATGACTGGGGTGCAGG + Intergenic
1160378068 18:78429258-78429280 GCACAGCAGGCCTCGGGAGCGGG + Intergenic
1160591606 18:79947883-79947905 GCACAGCAGGACCTGGGGACCGG + Intronic
1161910836 19:7192652-7192674 ACACAGCAGCACTTGTGTGCAGG - Intronic
1161967475 19:7556449-7556471 CTAGAGCATGACTTCGGTGCTGG + Exonic
1162060228 19:8090319-8090341 ATTCACCAGGACTGGGGTGCGGG - Intronic
1162144423 19:8605177-8605199 GTTCAGCAGGAAGTGGGTGCTGG + Exonic
1162576240 19:11500633-11500655 GGACATCAGGACTTGGGTTTGGG - Intronic
1163530094 19:17843785-17843807 GTACAGCAGGACTTGGGTGCTGG + Exonic
1163641450 19:18464718-18464740 TTACGGCAGGAGTAGGGTGCCGG - Intronic
1165384582 19:35502848-35502870 GTAGAGGAGGGCTCGGGTGCTGG + Exonic
1165443977 19:35846453-35846475 GCAGAGCAGGAGTTGGGTGTGGG - Intronic
925159802 2:1676131-1676153 GTGGGGCAGGACCTGGGTGCAGG - Intronic
925465643 2:4105476-4105498 TCACTGCAGGACTGGGGTGCCGG + Intergenic
926409535 2:12588498-12588520 GTATTGCAGTACTTGTGTGCAGG + Intergenic
927096667 2:19752454-19752476 GGAAAGCAGGACATGGGTGTAGG - Intergenic
928281051 2:29946694-29946716 ATATAGCAGGACTTGGAAGCAGG - Intergenic
932122319 2:69113183-69113205 GGACAGCAGGACTAGGGGGAAGG - Intronic
932479091 2:72027916-72027938 GGACAGGATGACTTGGCTGCAGG - Intergenic
936009797 2:108918253-108918275 GCCCAGGAGAACTTGGGTGCAGG - Intronic
937442538 2:121929211-121929233 GTGCACCAGGACTTCGGAGCTGG + Intergenic
937703008 2:124885332-124885354 TTACAGCAGTACTTGGATGAGGG + Intronic
937934181 2:127229486-127229508 GTGCAGCAGGGCTTGGCAGCAGG - Intergenic
938661559 2:133492097-133492119 GTAGAGCAGGGATTGGGGGCAGG - Intronic
941407240 2:165105635-165105657 GTACAGCAGGAATAGAGCGCAGG + Intronic
942052748 2:172155856-172155878 GCACAGCAGGAGTTGAGTGGCGG + Intergenic
945019680 2:205558206-205558228 GTCCAGCAAGACTTGGGTGCAGG + Intronic
945019820 2:205559144-205559166 ATCCAGCAACACTTGGGTGCAGG - Intronic
946008376 2:216544690-216544712 GTACTTAAGGGCTTGGGTGCTGG - Intronic
946168205 2:217878138-217878160 GTTCAGCAAGACTTCAGTGCAGG - Intronic
947986632 2:234453413-234453435 GCACGTCAGGACTTGGCTGCAGG + Intergenic
1169283792 20:4290190-4290212 GTACATCAAGACCTGGGTCCAGG - Intergenic
1169342346 20:4805969-4805991 GTACAGCAGGCCTGGGGCCCAGG + Intronic
1173906179 20:46631488-46631510 ATGCAGCAGGAGTTGGGAGCAGG + Intronic
1174557897 20:51408880-51408902 ATTCAGCAGGACTGGGGTGGAGG + Intronic
1174620622 20:51871853-51871875 ACACAGCTGGAATTGGGTGCTGG - Intergenic
1175318754 20:58070763-58070785 GCACAGCAGGACCTGCGTGTTGG - Intergenic
1175532722 20:59685141-59685163 GCCCAGCAGGAGGTGGGTGCAGG - Intronic
1175573272 20:60040166-60040188 GTGCAGCAGGCCTGGGGTGGGGG - Intergenic
1175811427 20:61860495-61860517 TGCCAGGAGGACTTGGGTGCAGG + Intronic
1176026086 20:62986346-62986368 GAACAGGTGGACTGGGGTGCAGG + Intergenic
1177802643 21:25842928-25842950 GTACAGAAGGGCTTGGGTTTGGG + Intergenic
1179124414 21:38578372-38578394 GTACAGGAGGAGTTGAGTGTTGG - Intronic
1179280904 21:39933532-39933554 GTGCTGCAGGACTTGGTTCCTGG + Intergenic
1179412732 21:41174684-41174706 GTACAGCAGGAACGGGGTGGTGG + Intronic
1179512278 21:41880927-41880949 GTACAGAAGGCCTTGGGAACAGG - Intergenic
1179821543 21:43940065-43940087 GCTCAGCAGGAAGTGGGTGCTGG - Intronic
1181099095 22:20527115-20527137 GTAGAGCAGGACTTGGGTTTAGG - Intronic
1184192594 22:42904764-42904786 GTAAACCAGGATTCGGGTGCAGG - Intronic
950287166 3:11754035-11754057 GAACAGCAGCACTTAGGAGCAGG - Intergenic
951369289 3:21825839-21825861 GTACAGCAGGAGGTGAGCGCCGG + Intronic
953557194 3:43955651-43955673 CAACATAAGGACTTGGGTGCAGG + Intergenic
956147496 3:66205855-66205877 TGAGAGAAGGACTTGGGTGCAGG + Intronic
958437823 3:94119536-94119558 GCACAGCAGGAGTTGAGTGGTGG - Intronic
960543985 3:118891127-118891149 GGTCAGTAGGACTTGGGTCCAGG - Intergenic
960672572 3:120167346-120167368 GGGCAGCAGGACTTGGGGCCCGG + Exonic
961635280 3:128329310-128329332 GCACAGCTGCACTGGGGTGCAGG + Intronic
962479644 3:135787341-135787363 GTACAGCAGTCCCTGGTTGCTGG - Intergenic
962986354 3:140539806-140539828 GTAGAGCTGGACTTGAATGCAGG + Intronic
963067927 3:141278587-141278609 CAACTGCAGGACTTGGGTCCTGG - Intronic
964662071 3:159131312-159131334 GTAGAGAGGGACTTGGGTGGGGG - Intronic
966282843 3:178254820-178254842 ATACTGCAGGAGCTGGGTGCTGG - Intergenic
968465485 4:747833-747855 AAACAGCAGCCCTTGGGTGCTGG - Intronic
968536497 4:1133866-1133888 TTAAAGGAGGCCTTGGGTGCTGG + Intergenic
969934382 4:10666637-10666659 TTACAGCAGGACTGGGTGGCAGG - Intronic
971015777 4:22487483-22487505 GTACAGCAGGAGTTGAGTGGCGG - Intronic
971773509 4:30930152-30930174 GTAGAGGAGGACTTGAGTGTGGG + Intronic
972170527 4:36340459-36340481 GAACATTAGGGCTTGGGTGCAGG + Intronic
974671170 4:65032214-65032236 GTACAGCAGGAGATGAGTGCTGG - Intergenic
982074331 4:151723486-151723508 GTACAGTAGGATTTGGGTTGAGG - Intronic
984732221 4:183078713-183078735 GTACTGCAGGGGTCGGGTGCAGG - Intergenic
985470463 5:39924-39946 GGACTGCAGGGCTTCGGTGCAGG + Intergenic
986649519 5:9949479-9949501 GTACAGCAGGAGGTGAGTGGTGG - Intergenic
986981988 5:13458431-13458453 GTACAGCAGGACAAGGGTGATGG - Intergenic
990449138 5:55918931-55918953 CTACACCTGGACTTGAGTGCAGG - Intronic
992107277 5:73460305-73460327 GAGCAGCAGGACTTGGGGGAAGG - Intergenic
993968540 5:94388271-94388293 GTACAGCAGGAGGTGAGTGGCGG - Intronic
994094957 5:95840061-95840083 GTACATCTCAACTTGGGTGCTGG - Intergenic
995512318 5:112921772-112921794 GGACAGCAGGAATAGGGCGCCGG + Intronic
997027395 5:130081342-130081364 GTGCTGCAGGACTTGGGGGAGGG + Intronic
997883798 5:137613258-137613280 AGACAGCAGGACTTGGGCACTGG + Intergenic
999737360 5:154522608-154522630 CTACAGCTTGACTTGGCTGCTGG - Intergenic
1001314100 5:170630518-170630540 GTCCATCAGGACTTGGGGGAGGG + Intronic
1001722261 5:173866597-173866619 GTACAGCTGGGCCTGGCTGCGGG - Intergenic
1002367416 5:178724089-178724111 GTACAGGAGCAGTTGGGTGTGGG - Intronic
1002386033 5:178868081-178868103 GTACAGGAGCAGTTGGGTGTGGG + Intronic
1003410248 6:5855813-5855835 GTGCAGATGGACATGGGTGCAGG - Intergenic
1005116504 6:22344464-22344486 ATACAGCAGACCTAGGGTGCTGG - Intergenic
1005170223 6:22975785-22975807 TTACAGCAGGAGTTTGGTGTTGG + Intergenic
1005856006 6:29863883-29863905 GAGCAGCAGGAGTTGGGTTCCGG - Intergenic
1006377274 6:33678491-33678513 GTGCAGCAGGGCCTGGTTGCCGG - Exonic
1009300701 6:62015349-62015371 GAGCAGCAGGACATGGGTTCTGG - Intronic
1015948197 6:138524353-138524375 GAACAGGAGGTCTTGGGAGCTGG - Intronic
1016352454 6:143182977-143182999 GAACAGCAGGTCATGTGTGCAGG - Intronic
1016841400 6:148529142-148529164 GTACAGCAGGAGGTGAGTGGCGG - Intronic
1016916483 6:149248763-149248785 GGACAGCAGCACTGGGGGGCTGG - Intronic
1017041211 6:150309925-150309947 ACACAGCAGGAGGTGGGTGCGGG + Intergenic
1026890640 7:73979804-73979826 GTTCAGCAGGACTTGGGGCTTGG + Intergenic
1026904776 7:74056732-74056754 GGAGAGCAGGACTTGGGGACAGG - Intronic
1028147307 7:87332059-87332081 GTAAAGAAGGACTTTGATGCTGG - Intergenic
1028423681 7:90662323-90662345 GCACAGCATAACCTGGGTGCTGG - Intronic
1029485405 7:100836846-100836868 TTACAGCAGGAATGGGGTGGGGG + Intronic
1031639904 7:124149594-124149616 ATACAGCAGAACTTGGGTGTGGG - Intergenic
1032420499 7:131775466-131775488 ATTCAGCAGGTCTTGGGTGTGGG + Intergenic
1032438231 7:131920071-131920093 GTACAGCAGGAGGTGAGTGGAGG - Intergenic
1034971016 7:155419119-155419141 ACAGAGCAGGACTTGGGTGCTGG - Intergenic
1035227773 7:157443087-157443109 GTACAGCAGGAGGTGAGTGGCGG - Intergenic
1035596316 8:860880-860902 GTAAAGTAGGACTAGGGTGGAGG + Intergenic
1037690373 8:21176830-21176852 GCACAGCAGGAGGTGGGTGCAGG - Intergenic
1037690383 8:21176878-21176900 CCACAGCAGGAGGTGGGTGCAGG - Intergenic
1040598156 8:48859926-48859948 GCACAGCAGGACTTTGCAGCAGG - Intergenic
1043982664 8:86659131-86659153 GCACAGCATGACTCGGGTACAGG - Intronic
1047645548 8:126866272-126866294 GCAGAGCTGGACTTGGATGCAGG - Intergenic
1049590102 8:143454879-143454901 GTACTGCAGCACTTGTGTCCGGG + Intronic
1053141664 9:35686350-35686372 GAACAGGAGGACTTGTGTGCAGG - Intronic
1053167210 9:35853288-35853310 TCCCAGCAGGACTTGGGTGCTGG + Intronic
1055339150 9:75263266-75263288 TTACAGCAGGCCTTGGGTCAGGG - Intergenic
1055539755 9:77291092-77291114 GGACAGCAGGAGTTGAGTGGTGG + Intronic
1056905985 9:90648214-90648236 GGACAGCTGGACTGTGGTGCAGG - Intergenic
1057549471 9:96041317-96041339 ATAGAGCAGGACATGGGTCCGGG + Intergenic
1058718466 9:107742518-107742540 GTGCAGCAGGAAGAGGGTGCTGG - Intergenic
1060317062 9:122521782-122521804 GAACAACAGAACTGGGGTGCCGG - Intergenic
1060808265 9:126592380-126592402 GTGCAGCAGGACTTAGGTGGAGG + Intergenic
1061075761 9:128340609-128340631 GCACAGCAGGTTTGGGGTGCGGG + Intergenic
1061195132 9:129103305-129103327 GCCTAGTAGGACTTGGGTGCTGG + Intronic
1062424130 9:136498222-136498244 GGGCAGCAGGAGTTGGGGGCGGG + Intronic
1062547232 9:137069306-137069328 GTACAGCCCCACTGGGGTGCAGG + Intronic
1186647732 X:11525073-11525095 GTACAGCAGGAAATGAGTGATGG - Intronic
1187711689 X:22060834-22060856 GTAAAACAGGACCTGGGTGTGGG - Intronic
1188135086 X:26484833-26484855 ATACAGCAGGGCTTGGATGAAGG + Intergenic
1189481303 X:41394250-41394272 TGACACAAGGACTTGGGTGCAGG - Intergenic
1192562043 X:72133581-72133603 TTACAGCGGGACTAAGGTGCAGG + Intergenic
1193723684 X:85016807-85016829 GAACAGCAGGACTTGAGTTCTGG - Intronic