ID: 1163535113

View in Genome Browser
Species Human (GRCh38)
Location 19:17872412-17872434
Sequence GCTGTGGGTCGGGCTGGCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 357}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163535108_1163535113 -10 Left 1163535108 19:17872399-17872421 CCACTGGCATCGGGCTGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 357
1163535100_1163535113 8 Left 1163535100 19:17872381-17872403 CCCTCATGCTCCTGGTGTCCACT 0: 1
1: 0
2: 1
3: 13
4: 207
Right 1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 357
1163535098_1163535113 29 Left 1163535098 19:17872360-17872382 CCTGGGACTACGGGGTCTTTGCC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 357
1163535101_1163535113 7 Left 1163535101 19:17872382-17872404 CCTCATGCTCCTGGTGTCCACTG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 357
1163535105_1163535113 -2 Left 1163535105 19:17872391-17872413 CCTGGTGTCCACTGGCATCGGGC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163535113 Original CRISPR GCTGTGGGTCGGGCTGGCTC GGG Exonic