ID: 1163535113

View in Genome Browser
Species Human (GRCh38)
Location 19:17872412-17872434
Sequence GCTGTGGGTCGGGCTGGCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 357}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163535100_1163535113 8 Left 1163535100 19:17872381-17872403 CCCTCATGCTCCTGGTGTCCACT 0: 1
1: 0
2: 1
3: 13
4: 207
Right 1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 357
1163535101_1163535113 7 Left 1163535101 19:17872382-17872404 CCTCATGCTCCTGGTGTCCACTG 0: 1
1: 0
2: 2
3: 37
4: 305
Right 1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 357
1163535105_1163535113 -2 Left 1163535105 19:17872391-17872413 CCTGGTGTCCACTGGCATCGGGC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 357
1163535108_1163535113 -10 Left 1163535108 19:17872399-17872421 CCACTGGCATCGGGCTGTGGGTC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 357
1163535098_1163535113 29 Left 1163535098 19:17872360-17872382 CCTGGGACTACGGGGTCTTTGCC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163535113 Original CRISPR GCTGTGGGTCGGGCTGGCTC GGG Exonic
900241130 1:1618106-1618128 GCTGTGGCTGTGGCTGTCTCTGG + Intronic
900626449 1:3610872-3610894 GATGTGGGTCCTGCAGGCTCAGG - Intronic
900639341 1:3681346-3681368 GCTGTGGGCAGGGTGGGCTCGGG + Intronic
900653538 1:3743279-3743301 GCTATGGGCTGGGCTGGCTGAGG - Intergenic
900948326 1:5843763-5843785 GAAGTGGGTCTGCCTGGCTCAGG + Intergenic
901536267 1:9884472-9884494 CCTGTGGGTCCGGGTGGCTCTGG - Intronic
903058230 1:20651722-20651744 GCTGTGGGTGGGGGTTGCTGTGG - Intergenic
903124117 1:21236174-21236196 CCCGTGGGTCGGGAAGGCTCTGG - Intronic
903424774 1:23245585-23245607 GCGGTGGGTTGGGCTGGGTGAGG + Intergenic
903662512 1:24986994-24987016 GCTGTGGCTCTGGCGGGCTAGGG + Intergenic
904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG + Intergenic
904424548 1:30415019-30415041 GATGTAAGTCGAGCTGGCTCAGG - Intergenic
904457659 1:30657245-30657267 GCTGGGGGAGGGGCTGGCCCCGG + Intergenic
904825190 1:33269722-33269744 TCTGTGGGTTGGGCTGGGGCGGG + Intronic
905631514 1:39521570-39521592 GGTGAGGGTCGGGCAGGCTGGGG + Exonic
905666240 1:39764601-39764623 GGTGAGGGTCGGGCAGGCTGGGG - Exonic
906771217 1:48486544-48486566 GGTGTGGGCAGGGCTGGTTCTGG - Intergenic
907241142 1:53081767-53081789 GCTTGTGGTGGGGCTGGCTCTGG - Intronic
909643184 1:77888922-77888944 GCTGTGGTCCGCGCTGGCCCCGG + Intronic
909733964 1:78932955-78932977 GCTGTGAATCAGTCTGGCTCTGG - Intronic
910094885 1:83510478-83510500 GATCTGGGCTGGGCTGGCTCAGG - Intergenic
915142474 1:153776043-153776065 GCTCTGGTTCGGGCTGGCCAAGG + Exonic
915348956 1:155212845-155212867 GCTGGGGCTGGGGCTGGCTCAGG + Intronic
915352143 1:155233471-155233493 GCTGGGGCTGGGGCTGGCTCAGG + Intergenic
915506042 1:156357102-156357124 GCTAGGTGGCGGGCTGGCTCAGG + Intronic
917737962 1:177937397-177937419 GCTGTGGGCTGGGCTGGAGCAGG + Exonic
920336710 1:205249795-205249817 GCTGCTGGTCTGGCTGCCTCTGG - Intronic
921060111 1:211578459-211578481 GCTGTCGGACGTGCTGGCGCTGG - Exonic
922067015 1:222154179-222154201 GCTGTGTGTGGTGCAGGCTCTGG - Intergenic
922689064 1:227672686-227672708 GCTGTGGGTCGGTCGGTCTAGGG + Intronic
923126889 1:231040651-231040673 GCTGGGGTTCGGGGTGGCGCGGG - Intergenic
1062855016 10:775721-775743 GCTGGGGGCCGGGCAGGCACCGG + Intergenic
1067193665 10:44094440-44094462 GCTGTGAGTCCGTCTGGCCCTGG - Intergenic
1067839747 10:49666220-49666242 GCTGGGGCTGGGGCTGACTCTGG - Intergenic
1069784822 10:70981279-70981301 GCTGTGGCTGGGGCTGTCTAGGG + Intergenic
1071388156 10:85142370-85142392 GCTGGTGGTCTCGCTGGCTCAGG - Intergenic
1071439753 10:85679857-85679879 GCAGGGGGTGGGGCTGCCTCAGG - Intronic
1071694491 10:87857519-87857541 GCTGTGAGTTTGGCTGGGTCTGG + Intergenic
1071854054 10:89605213-89605235 GCTGAGGGTTGGGGTGGCTGTGG + Intronic
1072686492 10:97540424-97540446 GCTGGGTGGTGGGCTGGCTCTGG - Intronic
1073103343 10:101018590-101018612 GCTGGGGTTAGGGCTGGTTCGGG + Intronic
1073115075 10:101087368-101087390 GCTGTGCGGTGGCCTGGCTCTGG - Intergenic
1073441685 10:103556116-103556138 GCTGTGGGTCTGTCTGACTGTGG - Intronic
1074288295 10:112119169-112119191 GCTGGGGGTGGGGCTTGCTCAGG - Intergenic
1075710278 10:124527047-124527069 GCTCTGTGGCGGGCAGGCTCTGG - Intronic
1076285133 10:129288165-129288187 GCTGTGGGTTGTGCTTGCTGGGG + Intergenic
1076301750 10:129433600-129433622 GCTGCAGGACTGGCTGGCTCTGG - Intergenic
1076727713 10:132421263-132421285 GCTGGGGGTGGGGCTGGGGCCGG - Intergenic
1076760471 10:132603188-132603210 GCTGTGGGCCAGGCTGCCTCTGG + Intronic
1076887107 10:133267967-133267989 GGTGTCGGGCGGGCTGGCCCGGG + Exonic
1077104155 11:834739-834761 GCTGCAGGTCGGGCGGGCACGGG + Intronic
1077461545 11:2713221-2713243 GATGCAGGTCCGGCTGGCTCGGG - Intronic
1077549296 11:3192969-3192991 ACTGCAGGTGGGGCTGGCTCCGG + Intergenic
1078524381 11:12089585-12089607 CCTGTGGGTAGGCCTGGCTGGGG - Intergenic
1078862261 11:15260117-15260139 GATGTGGGTCGGCCTCCCTCAGG - Intergenic
1079004725 11:16783611-16783633 GCCCTGGGCCGGGCTGGCTGGGG - Intronic
1079137570 11:17784629-17784651 GCTGTGTGTCGGGGAGGCTTGGG - Intergenic
1081570513 11:44287704-44287726 GCTGTGGGTGGGACTGGGACAGG + Intronic
1081644092 11:44777926-44777948 GCTCTGGGGCAAGCTGGCTCAGG + Intronic
1083097489 11:60266577-60266599 TCTCAGGGTCGGGCTGGTTCAGG - Intergenic
1083278626 11:61611653-61611675 GCTGGGGGTGGGGGTGGCCCAGG - Intergenic
1083540004 11:63506000-63506022 GCTGGGGGTGGGGCTGTTTCTGG + Intergenic
1083708040 11:64530065-64530087 GCTGTGGGCTGGGCTGGCTAAGG - Intergenic
1083889727 11:65589775-65589797 GCTGTGGGTGGGCCTGGGGCAGG - Exonic
1084209893 11:67616035-67616057 GCTCTGGGTCGGGCTGCAGCTGG + Intergenic
1084676502 11:70638459-70638481 GCCGGGGGTCAGGCTGGCCCAGG - Intronic
1084847899 11:71915068-71915090 GCTGAAGGTTGGGCTGGCTGTGG - Intronic
1084949201 11:72655317-72655339 GCTGTGGCACTGGCTGGCTGGGG - Intronic
1085392528 11:76189767-76189789 GCTGTGTCTCTGCCTGGCTCTGG - Intronic
1086372351 11:86167938-86167960 ACTGTGGGTTAGTCTGGCTCTGG - Intergenic
1088831409 11:113539909-113539931 GCTGTGGATGTGGCTGGGTCAGG + Intergenic
1089046089 11:115503500-115503522 GCTGTGGGGCGGGCGGGCTGCGG + Intronic
1089067996 11:115676605-115676627 GCCGTGGGTCAGGCTGTCACAGG + Intergenic
1089491652 11:118887762-118887784 GCTGTGAGTGGGGCTGGCCAGGG - Intronic
1090650216 11:128799748-128799770 GCTGTGGGTTGGGAAGGTTCGGG + Intronic
1091358702 11:134957759-134957781 GCTGTGGGAGGGGCGGCCTCTGG - Intergenic
1091584333 12:1807372-1807394 GATCTGGGTGCGGCTGGCTCAGG - Intronic
1091694383 12:2618069-2618091 GCTGAGGGTCCGGATTGCTCAGG + Intronic
1091807058 12:3364355-3364377 GCTGGGGCCAGGGCTGGCTCTGG + Intergenic
1092241712 12:6839886-6839908 GCTGGAGGTGGGGGTGGCTCTGG + Intergenic
1095855641 12:46857755-46857777 GCTGTAGTTCAGGCTTGCTCAGG + Intergenic
1096157567 12:49348991-49349013 GAGGTGGGCTGGGCTGGCTCTGG + Exonic
1096781574 12:53995100-53995122 GTTGTGGGTCTGTCTGCCTCAGG + Intronic
1099364976 12:81758096-81758118 AGTGTGGGTTGAGCTGGCTCTGG - Intronic
1101399477 12:104375198-104375220 GATGTGGGTGGGGCTGGCCTGGG + Intergenic
1102298822 12:111756844-111756866 GCTGTGGGACGTGCTTGCTCTGG + Exonic
1104003436 12:124875227-124875249 GATGTGAGTGGGGCGGGCTCAGG + Intronic
1104038791 12:125116112-125116134 GGTGGGGGTGGGGCTGGCACTGG - Intronic
1104856581 12:131905043-131905065 GCTGTGGGTGGGGTGGGCTGAGG + Intronic
1105209394 13:18249013-18249035 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1106149132 13:27080984-27081006 GCTGAAGGTCGGGGTGGCTGAGG + Intronic
1106611980 13:31292420-31292442 GCTGTGAGTCTGTCTGGTTCTGG + Intronic
1106995001 13:35471058-35471080 GCTGTGCGTGGGTCTGGCCCGGG + Intronic
1107939981 13:45374837-45374859 GCTTTGGGACCCGCTGGCTCAGG + Intergenic
1108387691 13:49916214-49916236 GCTGTGGTGCGGGCTGCATCTGG + Intronic
1110630196 13:77698198-77698220 CCTGGGGCTCGGGCTGGCGCTGG + Intronic
1113400237 13:109985809-109985831 GCTGTGAGTGGGGGTGGCTATGG - Intergenic
1115410823 14:33072698-33072720 GCTGTGGGTCAGGGTGGAACTGG + Intronic
1118621852 14:67620660-67620682 GGCGTGTGTGGGGCTGGCTCGGG - Intronic
1119193139 14:72697878-72697900 GAGGTGGGTGGGGCTGGGTCAGG - Intronic
1119623686 14:76152164-76152186 GATGTGGGTCGGGCCGTCTCCGG + Intronic
1119998642 14:79279269-79279291 GCCGAGGGACTGGCTGGCTCCGG - Intronic
1121588289 14:95079020-95079042 GCTGAGGGTGGGGCTGGGTGTGG + Intergenic
1121906701 14:97752692-97752714 GCTGCTGGTCCTGCTGGCTCTGG - Intronic
1122071726 14:99209468-99209490 GCTCTGGGCTGGGCTGGCCCTGG - Intronic
1122370590 14:101227020-101227042 TCTGTGGGTCGGCCTGCCCCTGG - Intergenic
1122767375 14:104081695-104081717 GCTCTGGGTGGGGCTGGGGCCGG + Intergenic
1123025328 14:105421217-105421239 GCTGTGGGAGGGGCTGCCGCTGG - Intronic
1123039125 14:105483217-105483239 GCTGGGGGCAGGGCTGGCTGAGG + Intergenic
1202863497 14_GL000225v1_random:100359-100381 GGTGTGGGGCGGGCTGTCCCAGG - Intergenic
1123686331 15:22800218-22800240 GGTGTGGGTGGGGTTGGCACTGG - Intronic
1124142346 15:27088453-27088475 GCTGTGTGCCGGGCAGGCTGCGG + Intronic
1125508440 15:40280661-40280683 GCTGAAGAGCGGGCTGGCTCTGG + Intronic
1125928750 15:43584577-43584599 GCTGTGGGTGGGGCTGGGGATGG + Intronic
1125941916 15:43684412-43684434 GCTGTGGGTGGGGCTGGGGATGG + Intergenic
1126413663 15:48396488-48396510 GCAGTGGGTCGTGGTGGGTCTGG - Intergenic
1127765919 15:62185921-62185943 GCTCGTGGTCTGGCTGGCTCAGG + Intergenic
1127879975 15:63148522-63148544 GCTGAGGGTCTGCCGGGCTCTGG + Exonic
1129468783 15:75738761-75738783 GCTGCGGGGCGGGGTGGATCTGG - Intergenic
1129609628 15:77042984-77043006 ACTGTGGGTCAGGCTGGCAAAGG - Exonic
1130059475 15:80559323-80559345 GCTGGGGCTGGGGCTGGGTCTGG - Intronic
1130403753 15:83580229-83580251 GCTGTGCTTCGGGATGGCTGGGG + Intronic
1130546779 15:84862670-84862692 GCTAAGGGTCTGGCTGACTCTGG + Exonic
1131058811 15:89391908-89391930 GCTGGGGGGCGGGCTGGCAGAGG + Intergenic
1131937651 15:97524208-97524230 GCAGAGGGTGAGGCTGGCTCTGG - Intergenic
1132390226 15:101433443-101433465 GCTGGGGTTCAGCCTGGCTCTGG + Intronic
1132519769 16:381802-381824 GCCATGGGCCGGGCTGGCACCGG - Exonic
1132546516 16:535786-535808 GCTGTGGGCCAGGCTGTTTCAGG - Intronic
1132661472 16:1063302-1063324 GCTGTGGGCAGGGCTGACCCCGG + Intergenic
1132699157 16:1214943-1214965 GTGGAGGGTCGGGCTGGCTGAGG - Intronic
1132849894 16:2020246-2020268 GCTCTGGGGCGCGCGGGCTCCGG - Exonic
1132866216 16:2093911-2093933 GCTGTGGCTGTGGCTGTCTCAGG - Exonic
1133128886 16:3664243-3664265 GCGGTGGGTGGGGCGGGCTCCGG - Exonic
1135220939 16:20613525-20613547 GCTGTGAGGCTGGCTGGCTGAGG + Intronic
1136672717 16:31873064-31873086 CCTCTGGGCCGTGCTGGCTCAGG - Intergenic
1137578959 16:49621828-49621850 GCTGTGATTCTGGCTGGCCCTGG - Intronic
1139654474 16:68378958-68378980 TCTGTGGGTTGTGCTGGCTTTGG - Intronic
1140475179 16:75236223-75236245 GCTCTGGGACGAGCCGGCTCTGG + Intronic
1141592217 16:85076840-85076862 GCTGTGGGTGGCCCTGTCTCAGG - Intronic
1141883715 16:86877406-86877428 GCTGTGGCTCTGGCTTTCTCTGG + Intergenic
1141969676 16:87472503-87472525 GCTGTGGCGCGGGCCGGGTCGGG + Intronic
1142228191 16:88887528-88887550 GCTGCGTGTGGGGCAGGCTCAGG + Intronic
1142716663 17:1750805-1750827 GCTGTGGGTGAGGCTGGCCCGGG + Intronic
1142869698 17:2812097-2812119 GCAGAGGGTCCGGCTGACTCTGG - Intronic
1143514162 17:7411152-7411174 CCTGTGTGCCAGGCTGGCTCAGG + Intronic
1144768580 17:17746387-17746409 GGACTGGGTCGGTCTGGCTCTGG + Intronic
1144809343 17:17988764-17988786 GCTGTGGGCCGTGGTGGCTTAGG + Intronic
1144849541 17:18237060-18237082 GCTCTGGGTGGGGCTGGCTGGGG + Intronic
1145063994 17:19749684-19749706 CCTGTGGGCCAGGCTGGCTGTGG + Intergenic
1145826821 17:27883151-27883173 GCTGTGGGTTTTGCTGGTTCAGG - Intronic
1146873413 17:36389921-36389943 GCTGGGGCTGGGGCTGGCACTGG + Intronic
1147609621 17:41793840-41793862 GCTGGGGGAGGGGGTGGCTCTGG + Intergenic
1147743126 17:42679885-42679907 GCTGCGCGTCGTGGTGGCTCTGG - Exonic
1150311183 17:64130294-64130316 GATGTGGGAGGGGCTGGCTCGGG + Intronic
1150482905 17:65524316-65524338 GCTGTGGGTCGGGCAGACCTGGG - Intergenic
1150645190 17:66973503-66973525 GCTGTGGGGCTGCCTGGCTGGGG + Intronic
1151371443 17:73648650-73648672 GCTGTAGGTGGGGCTGGGCCAGG + Intergenic
1151888876 17:76940481-76940503 GCTGTGGGGCGGGCTGAAGCGGG - Exonic
1151937196 17:77269843-77269865 GCTGTGGGACGAGATTGCTCAGG - Intergenic
1151977071 17:77489098-77489120 GCTGAGGGTCAGGCAGGCCCTGG + Intronic
1152382564 17:79949687-79949709 GGGGTGGGCCGGGCTGGCCCCGG + Intronic
1152587524 17:81195686-81195708 GCGGTGGGTGGGGCTGTCTGGGG - Intronic
1152644862 17:81464059-81464081 GCTGTGGGTGGGGCGGGCCGGGG - Exonic
1152687224 17:81700628-81700650 GCTGGGGCTGGGGCTGGCCCTGG - Intronic
1152797877 17:82316868-82316890 GCTGTGGCCCGAGCTGCCTCAGG + Exonic
1157526164 18:48384207-48384229 GCTGTGGGTGGGGCTTGTCCTGG - Intronic
1158964739 18:62612357-62612379 GGTCTGGGTCTGGCTGGGTCTGG + Intergenic
1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG + Exonic
1160288613 18:77569894-77569916 GCTGTAGCTCGGTCTTGCTCTGG + Intergenic
1160452827 18:78977623-78977645 GCTGCGAGTCCAGCTGGCTCTGG + Intergenic
1160807833 19:1000455-1000477 GCTGTGGCTGGGCCTGGCGCTGG + Exonic
1161586717 19:5109667-5109689 GCTGAGGGTCTGGGAGGCTCAGG - Intronic
1161587494 19:5113551-5113573 TCTGTGGCTCAGGCTGGATCGGG + Intronic
1161730627 19:5958625-5958647 GCTGTGGATCTGGCTGCCCCTGG - Intronic
1161855244 19:6760830-6760852 GCTGTGGGTCGGCCTGGCCGGGG + Exonic
1162757115 19:12867015-12867037 GGTGTGGGTGGGGCGGGGTCAGG + Intronic
1162788927 19:13053193-13053215 GATGGGGGTCAGGCTGGCTGAGG + Intronic
1162947362 19:14052046-14052068 GGTGTGGGTCGGGGAGGCTGGGG + Intronic
1163125771 19:15243403-15243425 GCTGGGGGCCGGGCGGGCTTGGG + Exonic
1163493012 19:17627986-17628008 GCGGTGGGTAGGGGAGGCTCTGG - Intronic
1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG + Exonic
1164160506 19:22623148-22623170 GCCGTGGGGCGGGCTGGGGCAGG + Intergenic
1164490073 19:28702205-28702227 GCTGAAGGTTGGGCTGGCTGTGG + Intergenic
1164830589 19:31317210-31317232 GCTGTGGCTCTGGCTGGGGCTGG - Intronic
1165070610 19:33253135-33253157 GCTGTGGGGGCGGCTGCCTCTGG + Intergenic
1165413312 19:35675805-35675827 GCAGGGGGTCAGGCAGGCTCGGG - Intronic
1165642134 19:37398662-37398684 GCTGTGGCTCAAGCTGGCCCAGG - Intergenic
1166523683 19:43497789-43497811 GCTGTGAGTCGAGCTGTCCCTGG + Exonic
1166915988 19:46196418-46196440 GCTGTGGATGGGGCTGACCCAGG - Intergenic
1166918703 19:46213645-46213667 GCTGTGGATGGGGCTGACCCGGG - Intergenic
1166925052 19:46261371-46261393 GCTGTGGATGGGGCTGGCCCGGG + Intergenic
1167561519 19:50228810-50228832 GCTGTGGTCCCGGCTGTCTCAGG + Intronic
1167625624 19:50586534-50586556 GCTGCAGGTCTGGCTGGCTCAGG - Intergenic
1168266673 19:55227357-55227379 GCTGTGGCGCGGCCTGGCCCAGG - Exonic
1168332611 19:55579003-55579025 GCTGAGGGCCGAGCTGGCGCTGG - Exonic
925188121 2:1863549-1863571 TCCGGGGGTCGGGCTGGCGCGGG - Intronic
925508030 2:4591340-4591362 GCTGAAGGTCGGGGTGGCTGTGG - Intergenic
925867468 2:8241408-8241430 TGTGTGGGTTGGGCTTGCTCTGG - Intergenic
927398855 2:22687396-22687418 GCTGTGGGTCAGACTGGCTATGG + Intergenic
927711709 2:25330370-25330392 GGTGGGAGTCGGGCTGTCTCTGG - Intronic
927719037 2:25371579-25371601 GCAGTGGTTGGGGCTGGCTGTGG + Intergenic
928229099 2:29480687-29480709 GAAGTGGGGCTGGCTGGCTCAGG + Intronic
930671913 2:54160269-54160291 GCTGGGGGAAGGGATGGCTCTGG + Intronic
935594706 2:104869637-104869659 GCTGGTGGTGGTGCTGGCTCTGG - Intergenic
935720812 2:105977344-105977366 TTTGTGGGTGGTGCTGGCTCAGG - Intergenic
937031352 2:118743641-118743663 GTTTTGGGTTGGGCAGGCTCTGG - Intergenic
946307854 2:218866153-218866175 GCTGTGGGTGGGGGTTGCACAGG - Intronic
948065991 2:235080748-235080770 GCTGAGAGTACGGCTGGCTCAGG - Intergenic
948703198 2:239773651-239773673 CCTGTGGCTCGGGCTGGAGCTGG - Intronic
948768072 2:240233580-240233602 GCTGTGGGTGGGGCTGGAGGGGG - Intergenic
1168937209 20:1675562-1675584 GCTGTGAGTCAGGCTGGGTTGGG + Intergenic
1169065919 20:2693950-2693972 GCTGTGGGGCGGGCTGGGGCGGG + Intronic
1171121090 20:22569059-22569081 GCTGGCTGGCGGGCTGGCTCGGG - Intergenic
1171524281 20:25797189-25797211 GCTGTGGCTGGGGCTGGGGCTGG - Intronic
1171552546 20:26058694-26058716 GCTGTGGCTGGGGCTGGGGCTGG + Intergenic
1171806935 20:29688914-29688936 GCTGTGGCTGGGGCTGGGGCTGG + Intergenic
1172408475 20:34705768-34705790 GCTGGGGGTAGGGGTGGCTTAGG + Intronic
1172782575 20:37445926-37445948 CCTGTGGGTGGTGCTGGCTTTGG + Intergenic
1174579919 20:51564126-51564148 GCTGGGGGTGGGGCTTTCTCAGG - Intergenic
1175658644 20:60793365-60793387 GCTGAGGGTCTGGCTGGCTGGGG + Intergenic
1175965297 20:62657323-62657345 GCAGGGGGCGGGGCTGGCTCCGG - Intronic
1175976722 20:62714194-62714216 GCTGTGGGCAGCTCTGGCTCTGG + Intronic
1176159067 20:63639430-63639452 GCTGTGGGTGGGGCTGGCGGGGG - Intergenic
1176196241 20:63837379-63837401 CCTGTCAGTCGGGCTGGCCCTGG + Intergenic
1176265457 20:64206827-64206849 ACTGTGGGACGTGCTGGCCCAGG + Intronic
1177404624 21:20649128-20649150 GCTGAGGGTTGGGGTGGCTGTGG - Intergenic
1177516500 21:22158580-22158602 GCTGTGGCTCAAGCAGGCTCAGG - Intergenic
1179263074 21:39775775-39775797 GGTGTGGGTGTGTCTGGCTCAGG - Intronic
1179504078 21:41828594-41828616 GCTGTGGGGCAGGGTGGCCCGGG - Intronic
1179722303 21:43322697-43322719 GCTGAGTGTCGCACTGGCTCAGG - Intergenic
1179730674 21:43365647-43365669 GCTGAGGGTCAGGCTGGCCCTGG + Intergenic
1180156255 21:45978501-45978523 GCTGTGGGTGGGGCAGGTTGTGG + Intergenic
1180698854 22:17770925-17770947 GCTGCGGCTCAGTCTGGCTCCGG - Intronic
1180766873 22:18350381-18350403 GCTGGGGCTGGGGCTGGCGCTGG + Intergenic
1180779440 22:18511997-18512019 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1180783529 22:18534792-18534814 GCCCTGGGGAGGGCTGGCTCAGG - Intergenic
1180812156 22:18769318-18769340 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1181031475 22:20150418-20150440 GCGGTGGGTGGGGCTGGGGCTGG + Intronic
1181127096 22:20708843-20708865 GCCCTGGGGAGGGCTGGCTCAGG - Intronic
1181198315 22:21203565-21203587 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1181240431 22:21474144-21474166 GCCCTGGGGAGGGCTGGCTCAGG - Intergenic
1181401426 22:22652228-22652250 GCTGGGGCTGGGGCTGGCGCTGG + Intergenic
1181508760 22:23379524-23379546 GCTCTGGGTGAGGCTGGCTAGGG + Intergenic
1182356953 22:29726472-29726494 GCTGTTGCTTGGGCTGGCCCAGG - Intronic
1183591229 22:38780396-38780418 GCTTTGGGTCGGCCAGGCCCAGG - Intronic
1183629751 22:39025909-39025931 GCTGTGGGGAGGGCAGCCTCGGG - Intronic
1183731742 22:39622300-39622322 GCTGGGGGTCGGGAGGCCTCCGG + Intronic
1184218822 22:43085890-43085912 GCTCAGGAGCGGGCTGGCTCAGG + Intronic
1185094379 22:48798419-48798441 GCTCTGGGGCGCGCTGGCTTTGG - Intronic
1203228492 22_KI270731v1_random:91272-91294 GCTGGGGCTGGGGCTGGCGCTGG + Intergenic
949427833 3:3938474-3938496 GCTGTGAATCGGTCTGGTTCTGG + Intronic
950577106 3:13838560-13838582 GCTGCTGTTGGGGCTGGCTCAGG + Intronic
953796710 3:45991666-45991688 GCTGTGGGTAAGGCTTCCTCGGG - Intronic
954035781 3:47850302-47850324 GCTGGGGAACGGGCTGGCTGTGG + Intergenic
954374266 3:50185831-50185853 GCTGTTGGTGGGGCTGGCTATGG + Intronic
954538529 3:51378957-51378979 GCAGTGGGTCCAGCTGGATCTGG + Intronic
954715530 3:52524941-52524963 GGTGTGGGCCGGGGTGGCTGTGG - Exonic
955387644 3:58492167-58492189 GCAGTGAGTGGGGCTGGCGCGGG + Intronic
955426711 3:58798743-58798765 GCTGAAGGTTGGGGTGGCTCTGG - Intronic
955554921 3:60126661-60126683 GCTGTGGATTGGGTTGACTCTGG - Intronic
956898222 3:73685499-73685521 GCTGTGGCTTGGGAAGGCTCAGG + Intergenic
960842534 3:121974862-121974884 GATGTGAGTCTGGCTGACTCAGG + Intergenic
961191368 3:124965060-124965082 TGAGTGGGTGGGGCTGGCTCAGG + Intergenic
961441614 3:126956999-126957021 ACAGTGGGGCGGGCTGTCTCAGG + Intronic
961449152 3:126994723-126994745 CCTGTGTGTGGGGCTGGCTGTGG + Intronic
965210277 3:165777745-165777767 GCTGTTGGTCTCGCTGTCTCTGG - Intronic
966096128 3:176205474-176205496 GCTGAGGGTTGGGGTGGCTGTGG - Intergenic
966656492 3:182364393-182364415 GCTGTTGGCAGGGCTGGCACTGG + Intergenic
967171196 3:186824926-186824948 GCTGGGGGTTGGCCTGGCTCAGG - Intergenic
968581783 4:1398697-1398719 GCTGTGGGGCTGGCTTGGTCTGG + Intergenic
968610288 4:1553998-1554020 GCTGTGGGTCATGGGGGCTCAGG - Intergenic
968622765 4:1611133-1611155 CCTGTGAGCCGGGCTGGGTCAGG - Intergenic
968641110 4:1715508-1715530 ACTGTGGGTCAGGGTGGCCCAGG - Intergenic
968829982 4:2928344-2928366 GCTGGGTCTGGGGCTGGCTCGGG - Exonic
970891918 4:21056025-21056047 GCTGTGTGTCGGGGTGGGTAGGG + Intronic
972621221 4:40749995-40750017 GCCCGGGGTCTGGCTGGCTCAGG - Exonic
977105820 4:92882942-92882964 GCTGAAGGTCGGGGTGGCTGTGG + Intronic
983425827 4:167582273-167582295 GCTGTGGGTGGGGCCGGATAAGG + Intergenic
984678341 4:182576990-182577012 GGTGTGGGTGGGGCTGGGACAGG - Intronic
985489496 5:171155-171177 GCTGAGGGCCGGGCAGGCTGTGG - Intronic
985579551 5:689653-689675 GCTCTGGGAGGGGGTGGCTCTGG + Intronic
985594397 5:781712-781734 GCTCTGGGAGGGGGTGGCTCTGG + Intergenic
985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG + Intergenic
985844375 5:2333435-2333457 GCTGTGGGTGTGTCTGGCTGTGG - Intergenic
985893717 5:2737090-2737112 GCCATGGGTCAGGCTGGTTCTGG - Intergenic
986029353 5:3880885-3880907 GCTGGAGCTCGGGCCGGCTCCGG + Intergenic
986118983 5:4812680-4812702 GCTGTGAATCTGTCTGGCTCTGG - Intergenic
986474630 5:8115006-8115028 GATGTGGGGCCGGCTGGCTGGGG - Intergenic
988519869 5:31936077-31936099 GCTGTGGGTGGGTGGGGCTCTGG + Intronic
996421731 5:123270104-123270126 ACGGTGGGTCTGGTTGGCTCTGG - Intergenic
997509524 5:134444188-134444210 GCTGTGGGTCTGGCTGTTTCTGG - Intergenic
997566365 5:134890016-134890038 ACTGAGGGTTGGGGTGGCTCTGG + Intronic
998406700 5:141878333-141878355 GCTCCGGCTCCGGCTGGCTCTGG + Exonic
998936449 5:147234715-147234737 GCTGTGCGTCCTGGTGGCTCCGG + Intergenic
1001261452 5:170233121-170233143 GCGGTGGGCCGGGCTGGCCTCGG + Exonic
1001617747 5:173056583-173056605 GCTCTGGGCCGGGCCGGCGCGGG + Intronic
1002068518 5:176664820-176664842 GCTGGGGGTCAGGCTCCCTCTGG - Intergenic
1002190220 5:177473822-177473844 GACGTGGGTGGGGCTGGCCCTGG - Intronic
1002302115 5:178263126-178263148 GATGGGGATGGGGCTGGCTCTGG + Intronic
1002795954 6:471141-471163 GCTGGGGGTGGGGCAGCCTCTGG - Intergenic
1003216565 6:4118684-4118706 GCTGTGATTGGGGGTGGCTCTGG + Intronic
1003249069 6:4409268-4409290 GCTGTGGATCTGTCTGGTTCTGG - Intergenic
1003844481 6:10158837-10158859 GCTGTGGGTCTGACAGGCACTGG - Intronic
1004669863 6:17785576-17785598 GCAGTGGGTAGGGCTGACTGAGG - Exonic
1005927070 6:30452924-30452946 GCTGGGGGTCGGGCTTCGTCTGG - Intergenic
1007679810 6:43626272-43626294 GCTGCTGGTGGGGCTGGCTGAGG - Exonic
1013059846 6:106622870-106622892 ACTCTGGGTCGGGATGTCTCTGG - Exonic
1013220635 6:108074561-108074583 GCTGTGGTCGGGGCTGGCCCTGG - Exonic
1014419360 6:121222030-121222052 GTTGTGGGCTGGGGTGGCTCTGG - Intronic
1015822448 6:137279094-137279116 GTTGAGGGTGGGGGTGGCTCAGG + Intergenic
1017083702 6:150693693-150693715 GCTGGGTATCGAGCTGGCTCTGG - Intronic
1018043434 6:159945219-159945241 GCTGTGGCTCAAGCAGGCTCAGG + Intergenic
1019218914 6:170459594-170459616 ACTGGGGGTCGGGGTGGCTGGGG + Intergenic
1019431323 7:1001124-1001146 GCTGTGGGTAGGGCAGGGCCAGG + Intronic
1020261098 7:6531221-6531243 GCTGCGGGCCGGGACGGCTCGGG - Intronic
1020263172 7:6542868-6542890 GCTGAGGGTCTGGTTGTCTCTGG + Intronic
1021577362 7:22116508-22116530 GCTCTGAGTCTGGCTGGATCAGG + Intergenic
1021940894 7:25678222-25678244 GCTGGAGGTGGGGCTGGTTCTGG - Intergenic
1022046266 7:26624845-26624867 TCTGTGGGTGGTGCTGGCTTGGG + Intergenic
1023356133 7:39369231-39369253 GCTGGAGGTTGGGCTGGCTGTGG - Intronic
1023866563 7:44241219-44241241 GCTTTGGTCAGGGCTGGCTCCGG - Intronic
1023964149 7:44953340-44953362 GCTGTGGCTCAGGTGGGCTCGGG - Intergenic
1029217647 7:98962819-98962841 GCTGAGGCTCTGGCTGGCCCAGG + Intronic
1031010248 7:116518972-116518994 GCTATGGGTTGGGTTGGCTGGGG - Intergenic
1031975334 7:128090069-128090091 GCTCTGGCTCGGGGTGGCACTGG - Intronic
1034264355 7:149773837-149773859 GCTGCGGGTCTGGGTGGATCGGG - Intergenic
1034275319 7:149821445-149821467 GCTGAGGGCAGGGCTGGCTCTGG - Intergenic
1034285343 7:149880192-149880214 GCAGAGGGCGGGGCTGGCTCAGG - Exonic
1035054950 7:156029007-156029029 GCTGTGGGTCAGCACGGCTCTGG + Intergenic
1035293554 7:157854911-157854933 GATGTGTGTGGGGCTGGATCGGG + Intronic
1035293567 7:157854957-157854979 GGTGTGTGTGGGGCTGGATCGGG + Intronic
1035293579 7:157855003-157855025 GGTGTGTGTGGGGCTGGATCAGG + Intronic
1035293591 7:157855049-157855071 GGTGTGTGTGGGGCTGGATCGGG + Intronic
1035368116 7:158361621-158361643 CCTGAGGGCAGGGCTGGCTCCGG - Intronic
1035573784 8:691065-691087 GCTGTGCTTGGGGCTTGCTCTGG + Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036591643 8:10173927-10173949 GCTGTGGGTTTGGTTGGCTGAGG + Intronic
1037457060 8:19074069-19074091 GCTGCGGGGCGCGGTGGCTCGGG - Intronic
1038035432 8:23682724-23682746 GCTCCGGGTCGCGCTGTCTCTGG + Exonic
1039500571 8:38013434-38013456 GCTGTTGTTCGGGCCTGCTCAGG + Intergenic
1045467602 8:102484798-102484820 GTTCTTGGTCTGGCTGGCTCAGG + Intergenic
1047235597 8:123039565-123039587 GCTTTGGGTAGATCTGGCTCTGG - Intronic
1048993646 8:139775675-139775697 GCTGTGAGTCTGGCAGGCTGGGG + Intronic
1049077214 8:140408168-140408190 GCTATGGGTCTTGATGGCTCTGG - Intronic
1049229101 8:141472954-141472976 GCTGTGGGGCGGGCAGGGTCAGG + Intergenic
1049264537 8:141660408-141660430 GATGAGGGCCAGGCTGGCTCGGG + Intergenic
1049268106 8:141680348-141680370 GCTGTGGGGCAGGCAGGCTCAGG + Intergenic
1049580043 8:143407023-143407045 CCTGTGGGCCGGGCTGGTACCGG - Intergenic
1049654726 8:143792490-143792512 GGTGGGGCTCGGGCTGGCCCAGG + Exonic
1049688888 8:143950183-143950205 CCTGTGGCTGGGGCAGGCTCCGG + Exonic
1051721695 9:20043999-20044021 GCTGATGGTTGGGATGGCTCTGG - Intergenic
1052358728 9:27530882-27530904 GCTATGGGTCTGTCTGACTCTGG - Intergenic
1053129829 9:35608614-35608636 GCTGGGGGTCGGGCTGGGGTAGG + Intronic
1056733749 9:89186595-89186617 GCACTGGGTCAGGCTGGCTTTGG - Intergenic
1057128998 9:92640368-92640390 ACTGTGGGTGAGGATGGCTCTGG - Intronic
1057199872 9:93134249-93134271 GCTGAGGCTCGGGCGCGCTCAGG - Exonic
1059068562 9:111110412-111110434 GCTCTGGGATGGGCTGGCTCTGG - Intergenic
1059248000 9:112864676-112864698 GCTGAAGGTCTGACTGGCTCTGG - Intronic
1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG + Intronic
1060302513 9:122383570-122383592 GCTCTGGGGCGGGATGCCTCGGG - Exonic
1060427900 9:123521858-123521880 GCAGTGGGTCGGGATAGGTCGGG - Intronic
1060897121 9:127225166-127225188 GCTGTGGTTCGGGGCGGCGCCGG + Intronic
1061421407 9:130474702-130474724 GCTGTGATGCTGGCTGGCTCTGG + Intronic
1061579289 9:131527019-131527041 GCTCTGGGTGGGGCTGGGGCCGG + Intronic
1061917715 9:133763816-133763838 GCTCTGGGTGGGGCTAGCCCAGG + Exonic
1061922082 9:133787904-133787926 GCTGTGGGTAGGTCTGGCTGTGG - Intronic
1061962820 9:133997057-133997079 GGTGTGGGTGGTCCTGGCTCAGG - Intergenic
1061970691 9:134043550-134043572 TCTGTGGGTTGGGTTGCCTCTGG - Intronic
1062109104 9:134772434-134772456 ACTGGAGGGCGGGCTGGCTCTGG + Intronic
1062388963 9:136326649-136326671 GCTGTGGGCCTCGCTGGCTGCGG + Intergenic
1203740831 Un_GL000216v2:175653-175675 GGTGTGGGGCGGGCTGTCCCAGG + Intergenic
1186364240 X:8874625-8874647 GCTGTGGGTAGGGCTGTAGCAGG + Intergenic
1186812612 X:13205138-13205160 GCGGTGGGTCTTGCTGTCTCAGG + Intergenic
1187415758 X:19092134-19092156 GCTGTGGATTGGGCTGGCAGAGG - Intronic
1187612281 X:20955554-20955576 GCTGTGGCTCAGGTGGGCTCAGG - Intergenic
1190017124 X:46836761-46836783 GCGGCGGGGCGGGCCGGCTCTGG - Intergenic
1190066847 X:47247431-47247453 GCTGTGGGTGGGGCCTGCCCTGG + Intronic
1190335135 X:49257583-49257605 GCTGTGGTTCAGCCTGACTCGGG + Intronic
1194601612 X:95928107-95928129 GCTGTGAGTCTGTCTGGCCCTGG - Intergenic
1196016504 X:110945081-110945103 GGTGTGGGTCGGGCCGACTAGGG + Intronic
1196866768 X:120077733-120077755 GCTGTGGGTTGGGCCTGCTGAGG + Intergenic
1196866869 X:120078386-120078408 GCTGTGGGTTGGGCCTGCTGAGG + Intergenic
1196876230 X:120157896-120157918 GCTGTGGGTTGGGCCTGCTGAGG - Intergenic
1196876331 X:120158548-120158570 GCTGTGGGTTGGGCCTGCTGAGG - Exonic
1197864959 X:131007991-131008013 GCTGTGGGGTTGGCTGGCACAGG - Intergenic
1198506192 X:137303442-137303464 GATGTGGGTCGGGGAGGCTGGGG + Intergenic
1198858818 X:141047625-141047647 GCTGTGAGTCTGTCTGGTTCTGG - Intergenic
1198903878 X:141539764-141539786 GCTGTGAGTCTGTCTGGTTCTGG + Intergenic