ID: 1163535267

View in Genome Browser
Species Human (GRCh38)
Location 19:17872999-17873021
Sequence CCCCTCTAGCGCGCACACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 17}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163535267_1163535271 -6 Left 1163535267 19:17872999-17873021 CCCACGTGTGCGCGCTAGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1163535271 19:17873016-17873038 GAGGGGACTGCTGACGGCTCCGG 0: 1
1: 0
2: 1
3: 34
4: 187
1163535267_1163535273 -4 Left 1163535267 19:17872999-17873021 CCCACGTGTGCGCGCTAGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1163535273 19:17873018-17873040 GGGGACTGCTGACGGCTCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 117
1163535267_1163535274 8 Left 1163535267 19:17872999-17873021 CCCACGTGTGCGCGCTAGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1163535274 19:17873030-17873052 CGGCTCCGGGGTTCGAAACCTGG 0: 1
1: 0
2: 0
3: 3
4: 62
1163535267_1163535272 -5 Left 1163535267 19:17872999-17873021 CCCACGTGTGCGCGCTAGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1163535272 19:17873017-17873039 AGGGGACTGCTGACGGCTCCGGG 0: 1
1: 0
2: 1
3: 25
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163535267 Original CRISPR CCCCTCTAGCGCGCACACGT GGG (reversed) Intronic
912401693 1:109398262-109398284 CACCTCTAGCGCCCTCAAGTTGG + Intergenic
1094842121 12:34346545-34346567 CCCCTCTGTAGCGCATACGTGGG - Intergenic
1114338998 14:21723587-21723609 GCCCCCTAGAGCCCACACGTAGG - Intergenic
1128076013 15:64825979-64826001 CCCCTCTAGCCCGCACACAGAGG + Intergenic
1142373872 16:89697060-89697082 CCCCTCTACCCAGCACATGTGGG + Exonic
1144107277 17:11997413-11997435 CCCCGCAAGCGCGCTCACCTCGG + Intronic
1152845371 17:82596501-82596523 CCCCGGGACCGCGCACACGTGGG + Intronic
1163535267 19:17872999-17873021 CCCCTCTAGCGCGCACACGTGGG - Intronic
934765466 2:96877860-96877882 CCCCTCTAGCCCCCAGACCTGGG - Intronic
935223267 2:101033026-101033048 CCCCTCTTGAGCTCAGACGTAGG - Intronic
1175140661 20:56858411-56858433 CCCCTCTAGACAGCACCCGTGGG - Intergenic
1181031355 22:20150084-20150106 CCCCTCTAGCCCGCAGTCTTAGG - Intronic
1184388161 22:44187933-44187955 CCCCTCCAGGGCCCACAGGTAGG + Intronic
961448595 3:126992405-126992427 CCCCACTCGCGGGCACACATGGG - Intronic
964476159 3:157099840-157099862 CCACTCTAGAGGGCTCACGTTGG + Intergenic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
1027978172 7:85185358-85185380 CCCCGCTAGCGCACACATGCAGG + Intronic
1186886943 X:13923203-13923225 CCCCACTAGCCAGCACACTTAGG - Intronic
1187682949 X:21786422-21786444 CCACTCTAGGGCGCACACAAAGG + Intergenic
1190316729 X:49156450-49156472 CCCCTCTTGCGCGCAGGCCTGGG - Intergenic