ID: 1163535433

View in Genome Browser
Species Human (GRCh38)
Location 19:17873883-17873905
Sequence CCGCGCCCGTCAGGCGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 38}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163535425_1163535433 16 Left 1163535425 19:17873844-17873866 CCACGTCGGTGTCTGCTGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1163535433 19:17873883-17873905 CCGCGCCCGTCAGGCGCAAGTGG 0: 1
1: 0
2: 0
3: 5
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163535433 Original CRISPR CCGCGCCCGTCAGGCGCAAG TGG Intronic
904652358 1:32014668-32014690 GCGCGCCCGGCAGCCGCAAGAGG - Intronic
904696639 1:32335254-32335276 GCGCGCCCGTGAGGGGCGAGAGG - Intronic
905182271 1:36174846-36174868 CCGGGCCCGGCAGGAGCCAGTGG - Intronic
910292843 1:85616112-85616134 CCGCGTGCGTCAAGCGCCAGCGG - Intergenic
914748332 1:150515430-150515452 CTGCGCCAGCCAGGGGCAAGCGG + Intergenic
1070032684 10:72692443-72692465 CCGTGCCCTTCAGGCGCCTGCGG + Intronic
1071603884 10:86971670-86971692 CCGCGCCCCTCACGCCCCAGCGG + Intronic
1076580947 10:131510504-131510526 CCTCACCCGTGAAGCGCAAGGGG - Intergenic
1084650636 11:70487260-70487282 CCAAGCCCGCCAGGCGGAAGGGG - Intronic
1093302908 12:17476927-17476949 CCGCGCCCAGCCGGCTCAAGTGG + Intergenic
1103763456 12:123266794-123266816 CCGCGCCCGTGGAGAGCAAGTGG + Intronic
1121717135 14:96084314-96084336 CAGCCCCCGTCATGCCCAAGAGG + Intronic
1131070193 15:89461200-89461222 CCCCGCCCAGCAGGCCCAAGTGG - Intergenic
1136913049 16:34159741-34159763 CCGCGCCCGCCACGCCCGAGTGG + Intergenic
1141538431 16:84699827-84699849 CCGCGACCCTCGGGCGGAAGCGG - Intergenic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1152106880 17:78335381-78335403 CCCCTCCCATCAGGCTCAAGGGG + Intergenic
1152625653 17:81386931-81386953 CCGCCCCCGGCCGGCGCAAGTGG - Intergenic
1161279029 19:3435070-3435092 CCTCGCCCATAAGGAGCAAGCGG + Exonic
1161381054 19:3965069-3965091 CCGCGCCCAAGAGGAGCAAGTGG - Intronic
1163535433 19:17873883-17873905 CCGCGCCCGTCAGGCGCAAGTGG + Intronic
1163548227 19:17951588-17951610 CCGGGCCAGTCAGGCTCAAGAGG + Intronic
929071740 2:38038248-38038270 CAGCGCCCCCCGGGCGCAAGGGG + Intronic
938854674 2:135297511-135297533 CCTCACCCGTGAAGCGCAAGGGG - Intronic
945188913 2:207166520-207166542 CCGCGCCCCTCAGAGGGAAGGGG + Intronic
946433062 2:219635719-219635741 CCGAGCCCGTCCGCAGCAAGGGG - Exonic
1170707817 20:18761169-18761191 CCTCGCCCGGGAAGCGCAAGGGG - Intronic
1170821367 20:19758229-19758251 CCCCGCCCGGGAGGAGCAAGAGG - Intergenic
1171767914 20:29300424-29300446 CCGCGCCCGCCACGTGCTAGTGG - Intergenic
1180014645 21:45074398-45074420 CCGCGCCCGTCCGCCGCAGGTGG + Intronic
953909065 3:46882800-46882822 CCGAGCCGCACAGGCGCAAGCGG + Intronic
954063746 3:48089398-48089420 CCGCTCCCGTGAGCCGCATGTGG + Intergenic
966887255 3:184383510-184383532 CCCTGCCCATCAGGTGCAAGTGG + Exonic
967055437 3:185825436-185825458 CCGCGCCAGGCGGGCGGAAGCGG + Intergenic
973931067 4:55793688-55793710 CCGCGCCCGCCCGGGGCGAGGGG - Intergenic
977288688 4:95139869-95139891 CCTCACCCGGCAAGCGCAAGGGG - Intronic
983217663 4:165017111-165017133 CCGCCCCCATGAGGAGCAAGAGG + Intergenic
1003112216 6:3259628-3259650 CAGCGCCAGTCAGGCGGAGGAGG - Intronic
1017877565 6:158536968-158536990 CCGCGCCCGGCCGGCGGAGGCGG - Intronic
1023142905 7:37120332-37120354 CCTCACCCGACAAGCGCAAGGGG + Intronic
1027361529 7:77415643-77415665 CCTCGGCGGTGAGGCGCAAGAGG - Intronic
1032092111 7:128916144-128916166 CCGCGCCCCTCAGGCACCTGCGG - Intergenic
1059769506 9:117413401-117413423 CAGCGCCCGTGAGGCGCCAGGGG - Intronic
1190218266 X:48494199-48494221 CCGCGTCCATCAGGAGGAAGGGG + Intergenic