ID: 1163536195

View in Genome Browser
Species Human (GRCh38)
Location 19:17877967-17877989
Sequence GGCCGACCTGGTTGATGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163536195_1163536199 11 Left 1163536195 19:17877967-17877989 CCTGCTCATCAACCAGGTCGGCC 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1163536199 19:17878001-17878023 GTGTCCAGCGCTGCCTGCTGTGG 0: 1
1: 0
2: 3
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163536195 Original CRISPR GGCCGACCTGGTTGATGAGC AGG (reversed) Exonic
903029026 1:20449404-20449426 GGGGGACCTGATTGATGAGGAGG - Intergenic
913176336 1:116276398-116276420 GGCCTGCCTGGGTGATGACCAGG - Intergenic
921573775 1:216809699-216809721 GGCCCACCTGTTAGATGGGCTGG - Intronic
923009527 1:230077129-230077151 GGCTGTCCTGGATGATGAGAGGG + Intronic
924638109 1:245808060-245808082 GGCCGTCCTGGGTTATGATCTGG - Intronic
1064062892 10:12154088-12154110 GGACGACATGTATGATGAGCCGG - Intronic
1065293691 10:24255389-24255411 GGACGAGCTGGTTGTGGAGCGGG + Intronic
1076607617 10:131699653-131699675 TGCCGACCTGTTTCATGACCAGG - Intergenic
1077319576 11:1935266-1935288 GGCCGAGCTGGGTGATGATGGGG - Intronic
1083668591 11:64288339-64288361 GGCGGACCTGGTGAATGACCTGG + Exonic
1084975087 11:72792676-72792698 GGCTGGCCTGGCTGATGAGAAGG - Intronic
1093364589 12:18277374-18277396 GGCTGACCTGGTTACTGAGAGGG - Intronic
1102068614 12:109999490-109999512 GGCCGACCTGGTCCCTGAGCCGG + Intronic
1104267123 12:127244137-127244159 GGTGGACCTGCGTGATGAGCAGG + Intergenic
1116507275 14:45699640-45699662 GGCCTGCCGGGTTGATTAGCAGG - Intergenic
1119735398 14:76978194-76978216 GGCTGACCTGCTTGTTGAGTCGG - Intergenic
1122032375 14:98921790-98921812 GGCAGAGCTGGCTGATGAGCAGG - Intergenic
1128156692 15:65395972-65395994 GGCCGATCTGTGTGATGACCAGG + Exonic
1132475009 16:130535-130557 GGGCGACCATGCTGATGAGCAGG - Exonic
1132885517 16:2180469-2180491 TGCCAACCTGGCGGATGAGCCGG - Exonic
1133279098 16:4655134-4655156 GGCCGACATGGTGGAGGAGCTGG + Intronic
1134504060 16:14791055-14791077 GGCCCACCTGGGTGAAGAACAGG - Intronic
1134576512 16:15337853-15337875 GGCCCACCTGGGTGAAGAACAGG + Intergenic
1134626135 16:15724217-15724239 GGACGACCTGGTTGTTGATTTGG - Exonic
1134725931 16:16418646-16418668 GGCCCACCTGGGTGAAGAACAGG - Intergenic
1134941503 16:18293213-18293235 GGCCCACCTGGGTGAAGAACAGG + Intergenic
1141419016 16:83899618-83899640 GGCCGACCTGCTGGAGGCGCAGG + Exonic
1145773977 17:27513834-27513856 GGAGGACCTGTGTGATGAGCAGG - Intronic
1148236727 17:45974146-45974168 GGCTTTCCTGGTGGATGAGCTGG + Intronic
1151194427 17:72421523-72421545 GGCTGACCTGGTAGATGGGTAGG - Intergenic
1151595310 17:75074800-75074822 GGTCACTCTGGTTGATGAGCAGG - Intergenic
1154273275 18:12938070-12938092 GGGTCACTTGGTTGATGAGCTGG + Intergenic
1156407707 18:36798502-36798524 GGCCCAGGTGGGTGATGAGCAGG + Exonic
1156791083 18:40975886-40975908 GGCTGACCAGGTAGGTGAGCAGG + Intergenic
1161734935 19:5985958-5985980 GGCTGACCTGGTTGCAGATCAGG - Intergenic
1162009507 19:7803741-7803763 GGCCTAACTGCTTGCTGAGCTGG + Intergenic
1162346253 19:10119663-10119685 GGCCGACCAGGTGGAGGAGGAGG - Exonic
1162561738 19:11421380-11421402 GGCGGACCTGAGTGATGAGGGGG - Intronic
1163536195 19:17877967-17877989 GGCCGACCTGGTTGATGAGCAGG - Exonic
1166364630 19:42272299-42272321 GGCGGACCTGGAGGATGAGCCGG + Intronic
1166625945 19:44356348-44356370 GGCAGAGCTGGTTGATGGTCAGG + Intronic
1168703255 19:58453883-58453905 TTCCCTCCTGGTTGATGAGCAGG + Intronic
925129225 2:1482486-1482508 GGCCCACCTGGGAGGTGAGCAGG + Intronic
925360786 2:3278692-3278714 GGCCGACCTCGCTGATGGTCTGG - Intronic
929941667 2:46338609-46338631 GGCCACCCTTGCTGATGAGCAGG - Intronic
947828089 2:233120012-233120034 GCCCACCCTGGTTGGTGAGCAGG - Intronic
948882861 2:240869265-240869287 GGCCGCCCTGGTCAATGTGCTGG + Exonic
1172011430 20:31848305-31848327 GGCAGACCTGGGTGATGTGCCGG + Intronic
1172426451 20:34859514-34859536 GCCCGACCTGGCTGAGGTGCTGG - Exonic
1173003693 20:39123757-39123779 GGGTGACCTGGTTGAGGGGCAGG + Intergenic
1173036795 20:39419362-39419384 GGTTGACCTGGTTCATGAGGTGG - Intergenic
1176072635 20:63235048-63235070 GGCCAGCCGGGTGGATGAGCTGG + Intergenic
1179563082 21:42229020-42229042 GGCCGACTTGGTGGACCAGCAGG - Intronic
1184458105 22:44622818-44622840 TGCCCACCTGGGTGTTGAGCGGG - Intergenic
950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG + Exonic
952301368 3:32106881-32106903 GGGCGACCTCGTTGCTGGGCTGG + Intronic
955058158 3:55474342-55474364 GGCCGGCCTCGTTGTTGTGCAGG + Exonic
962102247 3:132355176-132355198 GGCTGACGTGGTTGATAAGCGGG - Intronic
963253617 3:143122325-143122347 GGCCGTCCTGGGCTATGAGCGGG + Exonic
988519901 5:31936331-31936353 GTCCTACCTGCTTTATGAGCTGG - Intronic
993720187 5:91314559-91314581 TGCCACCCTGGTTGATGGGCTGG - Intergenic
1018662847 6:166104571-166104593 GATAGACCTGGATGATGAGCTGG - Intergenic
1018958912 6:168432281-168432303 GGCGGAGCTGGAGGATGAGCAGG + Intergenic
1019667320 7:2258374-2258396 GGCAGGCCGGGCTGATGAGCAGG - Intronic
1019724369 7:2593052-2593074 GGCCGACCTGGAGAAGGAGCTGG + Exonic
1022316300 7:29248370-29248392 GGGAGACTTGGTTAATGAGCTGG - Intronic
1024510272 7:50198684-50198706 GGCCCACCTGGTTAAAGTGCAGG - Intergenic
1034437723 7:151071086-151071108 AGCCTACCTGGCTGACGAGCGGG + Exonic
1037815661 8:22110306-22110328 GGCCGAGCTGGGAGAGGAGCAGG - Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1053491063 9:38503044-38503066 AGCTGACATGGTTGATGAGTTGG - Intergenic
1061250618 9:129424307-129424329 GGCCGACCTGAAGGATGAGTAGG + Intergenic
1061256897 9:129458808-129458830 GGCTGACATGGGTGCTGAGCTGG + Intergenic
1187735662 X:22301502-22301524 GGGTGTCCTGGTTAATGAGCTGG + Intergenic
1190117981 X:47638176-47638198 GGATGACCTGGTAGAGGAGCAGG + Exonic
1193394735 X:80970066-80970088 GGCAGACCTGGCTGATCAGAAGG + Intergenic