ID: 1163539860

View in Genome Browser
Species Human (GRCh38)
Location 19:17901590-17901612
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163539855_1163539860 30 Left 1163539855 19:17901537-17901559 CCATGTGGACCTGCAAGTCCAAT No data
Right 1163539860 19:17901590-17901612 CTTTATTAGTAGCGTGAAAATGG No data
1163539856_1163539860 21 Left 1163539856 19:17901546-17901568 CCTGCAAGTCCAATTAAACCTCT No data
Right 1163539860 19:17901590-17901612 CTTTATTAGTAGCGTGAAAATGG No data
1163539857_1163539860 12 Left 1163539857 19:17901555-17901577 CCAATTAAACCTCTTTTTCTCAG No data
Right 1163539860 19:17901590-17901612 CTTTATTAGTAGCGTGAAAATGG No data
1163539859_1163539860 3 Left 1163539859 19:17901564-17901586 CCTCTTTTTCTCAGTCTCAGGTA No data
Right 1163539860 19:17901590-17901612 CTTTATTAGTAGCGTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163539860 Original CRISPR CTTTATTAGTAGCGTGAAAA TGG Intergenic
No off target data available for this crispr