ID: 1163541915

View in Genome Browser
Species Human (GRCh38)
Location 19:17916593-17916615
Sequence CAAGGTGAACAAAGGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163541907_1163541915 15 Left 1163541907 19:17916555-17916577 CCAGATTGGCAGCTATCAGAACA No data
Right 1163541915 19:17916593-17916615 CAAGGTGAACAAAGGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163541915 Original CRISPR CAAGGTGAACAAAGGCTGCA GGG Intergenic
No off target data available for this crispr