ID: 1163543513

View in Genome Browser
Species Human (GRCh38)
Location 19:17926502-17926524
Sequence GGTTATAGAGGCCCACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163543513_1163543519 15 Left 1163543513 19:17926502-17926524 CCAGGCTGTGGGCCTCTATAACC No data
Right 1163543519 19:17926540-17926562 CACATCTTTTGGTCACAGTAAGG No data
1163543513_1163543517 4 Left 1163543513 19:17926502-17926524 CCAGGCTGTGGGCCTCTATAACC No data
Right 1163543517 19:17926529-17926551 TCAGCACCAGACACATCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163543513 Original CRISPR GGTTATAGAGGCCCACAGCC TGG (reversed) Intergenic
No off target data available for this crispr