ID: 1163546972

View in Genome Browser
Species Human (GRCh38)
Location 19:17946504-17946526
Sequence CTGCCTGTCTCCTCCCACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163546972_1163546982 15 Left 1163546972 19:17946504-17946526 CCCACGTGGGAGGAGACAGGCAG No data
Right 1163546982 19:17946542-17946564 CCAGGCCTTGGCCAAACAGGTGG No data
1163546972_1163546976 -10 Left 1163546972 19:17946504-17946526 CCCACGTGGGAGGAGACAGGCAG No data
Right 1163546976 19:17946517-17946539 AGACAGGCAGTGGCACCACTGGG No data
1163546972_1163546977 -3 Left 1163546972 19:17946504-17946526 CCCACGTGGGAGGAGACAGGCAG No data
Right 1163546977 19:17946524-17946546 CAGTGGCACCACTGGGTGCCAGG No data
1163546972_1163546978 3 Left 1163546972 19:17946504-17946526 CCCACGTGGGAGGAGACAGGCAG No data
Right 1163546978 19:17946530-17946552 CACCACTGGGTGCCAGGCCTTGG No data
1163546972_1163546980 12 Left 1163546972 19:17946504-17946526 CCCACGTGGGAGGAGACAGGCAG No data
Right 1163546980 19:17946539-17946561 GTGCCAGGCCTTGGCCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163546972 Original CRISPR CTGCCTGTCTCCTCCCACGT GGG (reversed) Intergenic
No off target data available for this crispr