ID: 1163549511

View in Genome Browser
Species Human (GRCh38)
Location 19:17957824-17957846
Sequence TGTGGAGAGCAGGGCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1123
Summary {0: 1, 1: 0, 2: 9, 3: 107, 4: 1006}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163549511 Original CRISPR TGTGGAGAGCAGGGCAGGAG TGG Intronic
900229376 1:1548665-1548687 TGTGGAAGCCAGGGCAGGGGAGG - Intronic
900330054 1:2129627-2129649 TGTGGGGAGCCAGGCAGGGGGGG + Intronic
900352620 1:2243059-2243081 TGAGCAGAGCAGGGCAGGTGGGG - Intronic
900523938 1:3119416-3119438 TGTGGAGGCCAGGGCTGGATGGG - Intronic
900589527 1:3453541-3453563 TGGGGCGACCAGAGCAGGAGGGG + Intergenic
900890804 1:5448360-5448382 TGAGGAGACAGGGGCAGGAGGGG + Intergenic
900949099 1:5847609-5847631 TGGGGATTGCAGGGCAGAAGGGG + Intergenic
901087172 1:6618046-6618068 TGCTGAGAACAGGGCAGGACTGG + Intronic
901131588 1:6964908-6964930 TTTTGAGAGCTGGGAAGGAGAGG + Intronic
901205028 1:7489750-7489772 TGTGGAGGGCTGGACAGGAAAGG - Intronic
901489748 1:9590541-9590563 TGTGGCCAGCAGGGCAGGAAGGG - Intronic
901553687 1:10015055-10015077 TGTTGAGAGTAGGCCAGGTGTGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902165947 1:14571822-14571844 TGAGGATGGCAGGGAAGGAGAGG + Intergenic
902444442 1:16452962-16452984 TGTGGGGAGAGTGGCAGGAGGGG + Intronic
902630704 1:17702798-17702820 TGGGGATAGCAGGGCAGAGGAGG - Intergenic
902634093 1:17723892-17723914 TGCTGAGAGCGGGGCTGGAGAGG + Intergenic
902654289 1:17856866-17856888 AGTGCAGAGGAGGGCAGGGGCGG + Intergenic
902686213 1:18079315-18079337 AGGGGAGGGCAGGGCAGGAGGGG + Intergenic
902756842 1:18554534-18554556 TGTGTAGTGCGGGGCAGTAGGGG - Intergenic
902800469 1:18826457-18826479 GGTGAAGAGCAGGCCAGGAGTGG + Intergenic
903049576 1:20590604-20590626 TGTGATAAGCACGGCAGGAGGGG - Intronic
903181332 1:21606335-21606357 TGTGGCCAGCAGGGCAACAGAGG + Intronic
903280185 1:22245773-22245795 TGGGTGGGGCAGGGCAGGAGTGG + Intergenic
903329377 1:22589320-22589342 TGAGGAGCGCAGGGCCAGAGAGG - Intronic
903335567 1:22622038-22622060 TGTGGAGAGTGGGGGATGAGGGG + Intergenic
903911218 1:26726955-26726977 TGTGGACAGGAGGGCAGGGCAGG + Intronic
904333758 1:29784237-29784259 TGGGGGGAGCAGGGCTGGATGGG - Intergenic
904410976 1:30324798-30324820 AGGAGAGAGCAGGGAAGGAGAGG + Intergenic
904625232 1:31798603-31798625 TGTGGAGGCCAGGGCAGGGCGGG + Intronic
904806100 1:33133553-33133575 TGAGGAGAGCAGGGCCGGGATGG + Intergenic
904829606 1:33298366-33298388 TGTAGAGACTGGGGCAGGAGTGG + Intronic
904870157 1:33612368-33612390 TGTGGAGGGCAGGAAAGGAATGG - Intronic
904950349 1:34233254-34233276 AGTGGTGAGCAGGACAGGGGAGG + Intergenic
905180733 1:36164614-36164636 AGCGGGGAGCAGGGTAGGAGAGG + Intronic
905285819 1:36879681-36879703 CTTGGAAGGCAGGGCAGGAGTGG + Intronic
905356840 1:37390640-37390662 TTTGCAGAGCAGGGGACGAGGGG + Intergenic
905464353 1:38141424-38141446 TTGGGAGAGCAGGGCTGAAGGGG - Intergenic
905491856 1:38350602-38350624 TGTGGAGAGACTGGCTGGAGTGG - Intergenic
906085898 1:43134528-43134550 TGTGGAAAAGTGGGCAGGAGGGG - Intergenic
906490729 1:46266547-46266569 TGTGGAGAGAATGGGAGGACAGG + Intronic
906511820 1:46414333-46414355 TGTGGCCAGCACGGCAGCAGGGG + Intergenic
906691956 1:47798585-47798607 TCTGGAGGCCAGGGCAGGACAGG - Intronic
907495222 1:54839252-54839274 AGTGGAGAATAAGGCAGGAGAGG + Intronic
907581246 1:55574642-55574664 CTTGGAGAGGAGGGGAGGAGGGG - Intergenic
907586369 1:55621313-55621335 TGCAGAGAGAAGGGGAGGAGGGG - Intergenic
908546629 1:65168580-65168602 TATGGAGAGCAGGCCAGATGTGG - Intronic
908566852 1:65365743-65365765 GTTGGAGAGAAGGGCTGGAGGGG + Intronic
909100568 1:71343183-71343205 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
909377113 1:74952415-74952437 TGTGGAGAGAGAGGCACGAGCGG - Intergenic
910441803 1:87260669-87260691 TGAGGAGAGTAGGGATGGAGAGG + Intergenic
910653773 1:89599432-89599454 TGTGGAGAGCTGGACAGAAGTGG - Intergenic
911646385 1:100341604-100341626 TGTGTAAGGCAAGGCAGGAGAGG + Intergenic
911749543 1:101480790-101480812 AGGTGTGAGCAGGGCAGGAGAGG + Intergenic
912201688 1:107465010-107465032 TGTGGTGAGAAGGGCAGTAGAGG - Intronic
912428767 1:109617366-109617388 TGTGGGGAACAGGCTAGGAGGGG + Exonic
912451603 1:109770753-109770775 TCAGGAGAGCTGGGCTGGAGAGG + Intronic
912668561 1:111605136-111605158 TGTGAAGTGCAGGGCATGACTGG + Intronic
912909653 1:113744998-113745020 AAGGGAGGGCAGGGCAGGAGAGG + Intronic
913228711 1:116723057-116723079 TGTGGAGGGCAGGGCAGGCTTGG - Intergenic
913432018 1:118805681-118805703 TCTGGAGAGCAAAGCAGGAGAGG - Intergenic
913555503 1:119962640-119962662 TGTAGAGAGCAGAGGTGGAGAGG - Intronic
914317641 1:146529366-146529388 AGTGGCCAGCAAGGCAGGAGAGG - Intergenic
914340445 1:146755577-146755599 TGTGGTGGGCAGGGCAGGATGGG - Intergenic
914496715 1:148203994-148204016 AGTGGCCAGCAAGGCAGGAGAGG + Intergenic
915024127 1:152811427-152811449 TGCCTAGATCAGGGCAGGAGGGG + Intronic
915086370 1:153391669-153391691 TGTGGGCAGCAGGGTAGGAATGG - Intergenic
915086491 1:153392656-153392678 TGTGGGCAGCAGGGTAGGAATGG - Intergenic
915457630 1:156051219-156051241 GGTGGAGGGCTGGGCAGGGGTGG + Exonic
915908964 1:159900347-159900369 AGTGGAGAGCAGGGCACGCCAGG - Intergenic
916171003 1:162001682-162001704 TGTGGAAAGCAGGCTAGGAGAGG - Intronic
916393108 1:164354416-164354438 AGGGGAGAGCAGGGGAGGGGAGG + Intergenic
916412317 1:164558938-164558960 TGAGGAAAGTAGGGGAGGAGGGG + Intronic
917981430 1:180272003-180272025 CGAGGTGAGCAGGGCTGGAGGGG + Exonic
919926882 1:202196090-202196112 TGTGGAGAGAAGAGAGGGAGTGG + Intronic
919958307 1:202439870-202439892 TGGGGCAAGCAGGGCAGGAGGGG - Intronic
920188900 1:204179767-204179789 TGTTGAGACCAAGGCTGGAGTGG + Intergenic
920307162 1:205026462-205026484 TGTGGGCAGCTGGGCAAGAGGGG - Intergenic
920431421 1:205921506-205921528 TGTGGAGAGCAGAGCGGAGGGGG + Intronic
920569649 1:207007107-207007129 TCTGGAGATCAGGGCCAGAGAGG + Intronic
920693324 1:208163392-208163414 GGTGGAAAGGAGGGCAGGTGAGG + Intronic
921080119 1:211732373-211732395 TCTGCAGAGCAGGGCTGCAGGGG + Intergenic
921422013 1:214959079-214959101 CTTGGAGGGAAGGGCAGGAGGGG - Intergenic
921792153 1:219302416-219302438 TGTGGAAAGCAGGGGTGGAGAGG - Intergenic
921793085 1:219312203-219312225 TGAGGAGAGCTGGGCAAGTGAGG + Intergenic
922051862 1:221998546-221998568 TGGGGTGAGCATGGAAGGAGAGG - Intergenic
922252123 1:223859044-223859066 TCTAGAGAGCAGGGCAGGGCAGG - Intergenic
922334690 1:224609123-224609145 AGAGATGAGCAGGGCAGGAGAGG - Intronic
922466288 1:225847274-225847296 TGTTGGGAGAAGGGCAGGAGGGG - Intronic
922606752 1:226894329-226894351 TGTGGAGGACAGTGCAGGGGAGG + Intronic
922762867 1:228143196-228143218 TGGGGGGAACAGGGCAGGACCGG + Intronic
922794432 1:228333136-228333158 CGAGGGGAGCAGGGCGGGAGGGG - Intronic
922798091 1:228351447-228351469 TGAGGTGAGGAGTGCAGGAGTGG + Exonic
923629834 1:235642582-235642604 TTTGCAGAGGCGGGCAGGAGGGG + Intronic
923755215 1:236785658-236785680 GGAGGAGAGCAAGGCAGCAGGGG - Intergenic
924385537 1:243495621-243495643 TGGGGACAGCAGGGCCGCAGGGG + Intronic
924679793 1:246220309-246220331 TGGGGAGAGCATGGCGGGTGGGG - Intronic
1062787968 10:281116-281138 TGTGGAGAGCACGGCGGTGGAGG - Intronic
1062833889 10:623710-623732 TGAGGGGAGGAGGGGAGGAGGGG + Intronic
1062930338 10:1348581-1348603 GGAGGAGAGCAGGGCACAAGGGG - Intronic
1062968057 10:1625605-1625627 TGTGAAGAGCAGGGAAGGCATGG + Intronic
1062986727 10:1776123-1776145 TGACATGAGCAGGGCAGGAGAGG + Intergenic
1063116335 10:3074478-3074500 TGTGGAGAGGAGAGGAGGGGAGG + Intronic
1063609558 10:7551647-7551669 TGAGAAGAGGAGGGAAGGAGTGG - Intergenic
1063692110 10:8296822-8296844 AGTGGAGAGGAGGGGAGGGGAGG - Intergenic
1064642178 10:17426196-17426218 TGTTCACAGCAGGGCAGAAGAGG - Intronic
1065209742 10:23391066-23391088 AGATGTGAGCAGGGCAGGAGAGG - Intergenic
1065623302 10:27605853-27605875 TGTGCAGGGCAGGGAAGGGGAGG + Intergenic
1065656722 10:27959185-27959207 AGTGGAGAGGAGGGGAGGGGAGG + Intronic
1067082953 10:43221824-43221846 AGTGGAGAGCAGGGCCTCAGAGG - Intronic
1067097080 10:43308584-43308606 TGTGCTGACCAGGGCAGGGGAGG - Intergenic
1067217844 10:44317171-44317193 GTTTGAGAGCAGGGGAGGAGGGG - Intergenic
1067251283 10:44589080-44589102 GGGGGAGAGAAGGGCAGGGGCGG - Intergenic
1067440816 10:46308414-46308436 AGTGGAGAGGAGGGGAGGGGAGG - Intronic
1067691460 10:48504689-48504711 TGGGCTGAGGAGGGCAGGAGTGG + Intronic
1068300427 10:55131689-55131711 AGTGGAGAGGAGACCAGGAGTGG + Intronic
1068697378 10:59982227-59982249 GGTGGAGGGGAGGGCAGGGGTGG + Intergenic
1068936013 10:62636452-62636474 TGTTGAAAGCATGGCAGGGGAGG - Intronic
1069476362 10:68736479-68736501 TGTGGGGCCCAGGGCAGGATTGG - Intronic
1069744024 10:70703526-70703548 TGGGGAGGGCAGGGCTGGCGGGG + Intronic
1069840489 10:71336519-71336541 TGTGGAGTGAAGGGGAGGAGGGG + Intronic
1069873307 10:71546384-71546406 TGTGGTGAGCAAGGCAGTTGTGG + Intronic
1069900571 10:71704600-71704622 TGGGGAGAGCAGGGGATGAAGGG + Intronic
1070275373 10:75001045-75001067 TGTGGGGGGCAGGGGTGGAGGGG - Intronic
1070541265 10:77417076-77417098 TGGGGAGAGCATCCCAGGAGTGG - Intronic
1070628482 10:78067848-78067870 TGTGGAAGGCAGGGCAGGGGTGG + Intergenic
1070645325 10:78198128-78198150 AGGGGAGAGGAGGGAAGGAGAGG + Intergenic
1070950818 10:80429558-80429580 GGGGCAGGGCAGGGCAGGAGAGG - Intronic
1070950827 10:80429584-80429606 AGGGCAGGGCAGGGCAGGAGAGG - Intronic
1070950840 10:80429620-80429642 GGGGCAGGGCAGGGCAGGAGAGG - Intronic
1070950858 10:80429672-80429694 GGGGCAGGGCAGGGCAGGAGAGG - Intronic
1071778891 10:88820281-88820303 TGTGGACAGGAGGTCAGGACTGG + Exonic
1071819342 10:89264459-89264481 AGTGGAGAGCAGACCTGGAGTGG + Intronic
1071885421 10:89944514-89944536 TTTGAGGAGAAGGGCAGGAGAGG - Intergenic
1071963819 10:90832543-90832565 TGTGGAGAGAGAGGCACGAGCGG - Intronic
1072079232 10:92012139-92012161 GGAGGAGAGCAGGGGAGGGGAGG - Intronic
1072608525 10:97002125-97002147 TGGGGAGGGCACGTCAGGAGGGG + Intronic
1072623517 10:97096408-97096430 AGTGGTGGGGAGGGCAGGAGGGG - Intronic
1072628321 10:97128555-97128577 TGTGGGCATCAGGGCAGGAGGGG - Intronic
1073070558 10:100790771-100790793 TGAGGAAGGCAGGGCAGGAGGGG - Intronic
1073206633 10:101772890-101772912 TGTGGAAGGCAGAGCGGGAGAGG - Intronic
1073360093 10:102891311-102891333 AGGCGTGAGCAGGGCAGGAGAGG - Intronic
1073530056 10:104222568-104222590 TGAGGAGGGCAGGGGAGGACAGG - Intronic
1074287384 10:112110827-112110849 AGGTGAGAGCAGGGCAGGAGAGG - Intergenic
1074407231 10:113189978-113190000 TGGGAAGAGCATGCCAGGAGAGG - Intergenic
1074893370 10:117753772-117753794 GGTGGGGAGCAGGGGAGGAAAGG + Intergenic
1074992098 10:118718194-118718216 TGTGGAAACCTGGGCATGAGTGG - Intronic
1075065708 10:119287706-119287728 TGTGGACAGCAGTGTGGGAGTGG - Intronic
1075136446 10:119790072-119790094 TGGGGAGAGAATGGGAGGAGTGG + Intronic
1075692019 10:124403278-124403300 TATGTAGAGCAGGGCAGAATGGG - Intronic
1076469947 10:130711271-130711293 TGCAGAGGGCAGGGCAGGTGGGG + Intergenic
1076599963 10:131650981-131651003 TGCCGAGCACAGGGCAGGAGCGG + Intergenic
1076692955 10:132233088-132233110 TGGGGACAGCAGGGCGGGACAGG + Intronic
1076738044 10:132467495-132467517 TGAGCTGAGCAGGGGAGGAGGGG + Intergenic
1076769356 10:132654552-132654574 TGGGCAGAGCTGGGCAGCAGCGG + Intronic
1076776344 10:132700043-132700065 TGTGGAGGGCATAGCACGAGGGG + Intronic
1077030072 11:461535-461557 TAGGGAGACCAGGACAGGAGAGG - Intronic
1077073723 11:690257-690279 AGGGGAGGGCAGGGCAGGGGAGG + Intronic
1077132619 11:980860-980882 GGTGGAGGCCAGGCCAGGAGAGG + Intronic
1077309955 11:1883865-1883887 GGTGCTGGGCAGGGCAGGAGGGG + Intronic
1077327861 11:1971454-1971476 GGTGGAGGGCAGGGCCGGAGAGG - Intronic
1077370526 11:2179697-2179719 TGTGGACAGCCGGCCAAGAGGGG - Intergenic
1077378823 11:2218351-2218373 GGGGGTGAGCAGGGGAGGAGTGG + Intergenic
1077433774 11:2528505-2528527 TGCTGAGAGCAGGGCAGGGCAGG + Intronic
1077466053 11:2734272-2734294 GCTGCAGAGCAGGGCAGGGGTGG + Intronic
1077466116 11:2734493-2734515 TGTGGGGAGCAGGGTAGGACGGG + Intronic
1077538912 11:3137472-3137494 TGCGGGGAGCAGGGGAGCAGGGG + Intronic
1077837071 11:5934761-5934783 TGTGGATAGAAGGGCGGGAAAGG + Intronic
1078090171 11:8260095-8260117 TGTGGGGGACTGGGCAGGAGAGG - Intronic
1078643700 11:13118973-13118995 TGTGGTGACCAGGGGTGGAGGGG + Intergenic
1078929312 11:15901192-15901214 TGTGGAGTGAAGGGCAGGAGCGG + Intergenic
1078935166 11:15943195-15943217 TGTGGGGTGCAGGGGAGCAGAGG + Intergenic
1078957139 11:16211703-16211725 TGTGGAGAACAGGAGAAGAGTGG - Intronic
1080365574 11:31570341-31570363 TGTGGAATACAAGGCAGGAGAGG + Intronic
1080434401 11:32226280-32226302 TGGGAAGAGCAGGTGAGGAGCGG - Intergenic
1080967905 11:37234897-37234919 AGATGTGAGCAGGGCAGGAGAGG - Intergenic
1081002503 11:37692344-37692366 AGGGGAGAGGAGGGGAGGAGGGG + Intergenic
1081669366 11:44934642-44934664 GGTGAAGAACAGGGCAGCAGAGG + Exonic
1082132327 11:48506137-48506159 TGGGGAGGGGAGGGCAGGGGAGG - Intergenic
1082160669 11:48884983-48885005 TGTGGATGGCAGGGCTGCAGGGG - Intergenic
1082161697 11:48895423-48895445 TGTGGATGGCAGGGCTGCAGGGG + Intergenic
1082167278 11:48963851-48963873 TGTGGATGGCAGGGCTGCAGGGG + Intergenic
1082236296 11:49822847-49822869 TGTGGATGGCAGGGCTGCAGGGG - Intergenic
1082239748 11:49857355-49857377 TGTGGATGGCAGGGCTGCAGGGG - Intergenic
1082242406 11:49886996-49887018 TGTGGATGGCAGGGCTGCAGGGG + Intergenic
1082565792 11:54676757-54676779 TGGGGAGGGGAGGGCAGGGGAGG - Intergenic
1082609789 11:55282723-55282745 TGTGGATGGCAGGGCTGCAGGGG - Intergenic
1082656893 11:55867801-55867823 TGTGGACGGCAGGGCTGCAGGGG + Intergenic
1083421025 11:62553364-62553386 AGTGGGGAGCAGGGAGGGAGGGG + Intronic
1083607958 11:63990185-63990207 TGTGGAGAGGCAGGCAGCAGTGG + Intronic
1083685573 11:64373142-64373164 GGTGGAGAGTAGGGGAGGGGTGG + Intergenic
1083811991 11:65111511-65111533 TGGGCAGCGCAGGGCAGCAGAGG - Exonic
1083958807 11:66002618-66002640 TGCGGGGAGAAGGGGAGGAGAGG + Intronic
1084315396 11:68342715-68342737 CCAGGAGAGCCGGGCAGGAGCGG - Intronic
1084320898 11:68372888-68372910 TGTGGGGCGAAGGTCAGGAGGGG + Intronic
1084366962 11:68708016-68708038 AGGGCAGAGCAGGGCAGGGGAGG - Exonic
1084374054 11:68764038-68764060 AGAGGACAGCACGGCAGGAGGGG + Intronic
1084458443 11:69282742-69282764 TGTGCACATCAGGGCATGAGAGG - Intergenic
1084788034 11:71454930-71454952 TGTTGACAGCATGGCAGCAGAGG - Intronic
1084900011 11:72302617-72302639 TGTGGTGATCAGAACAGGAGAGG - Intronic
1084902251 11:72318379-72318401 TCTGGAGAACAGGCAAGGAGGGG + Intronic
1085413907 11:76307640-76307662 TGTGGGGAGCAGGGCGGGCGGGG + Intergenic
1085750212 11:79155012-79155034 TGTGGAGAGCAGAGAAGGGAGGG - Intronic
1086268343 11:85028727-85028749 TGTGGGGGCCAGGGCTGGAGAGG + Intronic
1086737040 11:90319834-90319856 AGACGTGAGCAGGGCAGGAGAGG + Intergenic
1088652689 11:111972462-111972484 TGTGGAGAGCAGATGAGAAGGGG - Intronic
1089263355 11:117238826-117238848 TGTGGCCAGCACAGCAGGAGAGG + Exonic
1089321573 11:117630134-117630156 GGGGGACAGAAGGGCAGGAGGGG - Intronic
1089385185 11:118062638-118062660 TGTGGAGGGAGGGCCAGGAGAGG - Intergenic
1089453737 11:118613766-118613788 TGGGGAGGCCAGGGCAGGAGAGG - Intronic
1089497903 11:118916926-118916948 TGGTGAGAGCAGAGCAGCAGGGG + Intronic
1089671030 11:120057127-120057149 AATGGAGAGCAGGGACGGAGAGG - Intergenic
1089680469 11:120116457-120116479 CGCTTAGAGCAGGGCAGGAGAGG - Intronic
1090437012 11:126695509-126695531 TGTGGTGAGCAGAGAAGGTGGGG - Intronic
1090788278 11:130069291-130069313 TGGGCGGAGCAGGGCGGGAGAGG + Intergenic
1090865520 11:130697579-130697601 AGTGGAATGCAGGGTAGGAGAGG - Intronic
1091201675 11:133785262-133785284 CGTGGAGCCCAGGGCAGCAGGGG - Intergenic
1091255598 11:134182204-134182226 TGTGGAGAGAATGCCAGGATTGG - Intronic
1091281034 11:134381807-134381829 TGTGGAGGACAGGGCAGATGTGG - Exonic
1091323787 11:134669296-134669318 GGTGAAGAGCAGGTCAGGACTGG + Intergenic
1202810841 11_KI270721v1_random:26634-26656 GGTGGAGGGCAGGGCCGGAGAGG - Intergenic
1091389071 12:114619-114641 TCTAGACATCAGGGCAGGAGAGG + Intronic
1091637436 12:2208048-2208070 TGAGGACGGCAGGGCTGGAGAGG + Intronic
1092112598 12:5974399-5974421 TAGGGAGGTCAGGGCAGGAGTGG - Intronic
1092743642 12:11653409-11653431 TACGGACAGCAGGGAAGGAGGGG - Intronic
1094624701 12:32112610-32112632 TGAGGAGAGGAGGGCATGAAGGG + Intronic
1095938693 12:47711777-47711799 TGTGGAGGGAAGGGCAGAAAAGG + Intronic
1095954394 12:47798075-47798097 TGGGGACAGGAGGGCAGGTGAGG + Intronic
1095980818 12:47973769-47973791 TGTGGGGAGTGGGGAAGGAGGGG - Intronic
1096131221 12:49160431-49160453 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
1096462917 12:51832543-51832565 TGTGGAGGGGACGGCAGCAGGGG - Intergenic
1096615570 12:52831382-52831404 TGAGGAGAGCAGGCCAGGCGGGG - Intronic
1097134220 12:56837923-56837945 AGAGGTGAGCAGGGCAGGAGAGG - Intergenic
1097173692 12:57130701-57130723 TGTGGAGAGCAGGGAAGGTCAGG + Intronic
1097888959 12:64758793-64758815 TGTGGAGACCAGTGGAGGATGGG - Intronic
1098305109 12:69095158-69095180 TGTGGTGATCAGGCCAGGGGGGG + Intergenic
1098488372 12:71047446-71047468 AGTGGAGAGGAGAGCTGGAGAGG + Exonic
1099121898 12:78700704-78700726 AGAGGAGAGGAGGGGAGGAGAGG + Intergenic
1099147546 12:79065401-79065423 AGTGGAGGGGAGGGGAGGAGAGG + Intronic
1099325860 12:81213687-81213709 AGGGGAGAGGAGGGCAGCAGAGG - Intronic
1099437503 12:82661183-82661205 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
1099631708 12:85156812-85156834 AGTGGGGAGCATGGCAGGAGGGG + Intronic
1099683390 12:85856795-85856817 AGTGGAGAGGAGACCAGGAGTGG + Intergenic
1100355155 12:93821825-93821847 TGTAGACAGCAGGCCAGGTGTGG + Intronic
1100423532 12:94460296-94460318 TGTGGGGAAGAGGGAAGGAGAGG - Intergenic
1101519168 12:105465789-105465811 TGTGGAGTCCAGGAGAGGAGGGG - Intergenic
1101529085 12:105558027-105558049 TGAGGAAAGCAGGACAGGAAAGG - Intergenic
1102246706 12:111361025-111361047 TGTGGAGAGCAGGGCTTGCTGGG + Exonic
1102386563 12:112515202-112515224 TGTGGGGAGAATGGCAGAAGTGG - Intergenic
1102455655 12:113069437-113069459 TGGGGAGACAAGGGGAGGAGAGG - Intronic
1102574004 12:113844498-113844520 GGTGGACAGCAGGTCTGGAGGGG + Intronic
1102902251 12:116647451-116647473 AGGGGAGAGGAGGGGAGGAGAGG - Intergenic
1103161431 12:118732525-118732547 TGGCATGAGCAGGGCAGGAGAGG + Intergenic
1103707142 12:122882330-122882352 ACTGGAGAGCAGGGCAGCAGTGG - Intronic
1104046643 12:125167923-125167945 TGAGGAGAGCATGGCCTGAGAGG + Intergenic
1104067368 12:125316963-125316985 TGTGGTGGGCAGGCAAGGAGAGG - Intronic
1104206947 12:126648260-126648282 GGGCGTGAGCAGGGCAGGAGAGG - Intergenic
1104264996 12:127223632-127223654 TGAGCAGAGCAGGGCAGTGGAGG + Intergenic
1104375928 12:128266061-128266083 TGAGGAGCTCAGGACAGGAGGGG + Intergenic
1104554891 12:129790570-129790592 TATGGAGAGCAGAGGAGAAGAGG - Intronic
1104719136 12:131034931-131034953 TGTGGAGGGGAGGGCTGAAGGGG - Intronic
1104895555 12:132162029-132162051 AGTGGAGGGCAGGGCAGGGCAGG - Intergenic
1105287968 13:19022805-19022827 AGAGGAGAGGAGGGGAGGAGAGG + Intergenic
1105309856 13:19196747-19196769 AGTGTAGATCAGGCCAGGAGCGG + Intergenic
1105495170 13:20924165-20924187 TGTAGAGACCAGGCCGGGAGCGG + Intergenic
1105544635 13:21342588-21342610 GGTGGAGAACAGAGAAGGAGGGG - Intergenic
1106143090 13:27027301-27027323 TGTGGGACGGAGGGCAGGAGAGG + Intergenic
1106235051 13:27854216-27854238 TTTGCAGAGCAGGGAAGGAATGG + Intergenic
1107048726 13:36024182-36024204 TGAGGAGAGCAGGCCAGGCACGG - Intronic
1107549714 13:41463500-41463522 TGTGGTGGGCAGGGCGGGGGCGG + Intronic
1107726744 13:43306799-43306821 TGTAGAGGGTAGAGCAGGAGAGG - Intronic
1108747031 13:53406340-53406362 TGATTTGAGCAGGGCAGGAGTGG + Intergenic
1109273449 13:60279527-60279549 TGGGGAGAGGAGGACAGGACCGG - Intergenic
1110166661 13:72450242-72450264 AGCGGAGAGCAAGGCAGAAGAGG - Intergenic
1110578173 13:77084857-77084879 TGTGGGAAGCAGGGCACTAGTGG - Intronic
1112338853 13:98536652-98536674 AATGGAGAGAAGGGCAGGTGTGG - Intronic
1112871243 13:103973327-103973349 AGGGCAGGGCAGGGCAGGAGAGG - Intergenic
1112900252 13:104349884-104349906 TGTGGGTAGCAGGAAAGGAGAGG - Intergenic
1113808201 13:113122135-113122157 AGTGGTGGGCAGGTCAGGAGGGG + Intergenic
1113912883 13:113852666-113852688 GGTGGTGGGCAGGGCAGGGGCGG - Intronic
1113938227 13:114006147-114006169 GGTGTCCAGCAGGGCAGGAGGGG - Intronic
1113938262 13:114006257-114006279 GGTGTCCAGCAGGGCAGGAGGGG - Intronic
1113938323 13:114006443-114006465 GGTGTCCAGCAGGGCAGGAGGGG - Intronic
1113938383 13:114006629-114006651 GGTGTCCAGCAGGGCAGGAGGGG - Intronic
1113938431 13:114006777-114006799 GGTGTCCAGCAGGGCAGGAGGGG - Intronic
1113938466 13:114006887-114006909 GGTGTCCAGCAGGGCAGGAGGGG - Intronic
1113938501 13:114006997-114007019 GGTGTCCAGCAGGGCAGGAGGGG - Intronic
1113938536 13:114007109-114007131 GGTGTCCAGCAGGGCAGGAGGGG - Intronic
1113938655 13:114007458-114007480 GGTGTCCAGCAGGGCAGGAGGGG - Intronic
1114173501 14:20297953-20297975 TGTGGGGAGAGTGGCAGGAGGGG + Intronic
1114183327 14:20382867-20382889 TGGGCAGAGCAGCGTAGGAGAGG - Intronic
1114654437 14:24307698-24307720 TGTGGAGTGGGGAGCAGGAGAGG + Exonic
1115574744 14:34699922-34699944 TGATGAGAGAAGTGCAGGAGAGG - Intergenic
1115872713 14:37823234-37823256 TGTGGACACCAGGAGAGGAGGGG - Intronic
1116147656 14:41096227-41096249 TGTGAGGAGCAGGGGAGGCGGGG - Intergenic
1117723064 14:58646185-58646207 TGTAGACAGCAGGGGAGGAGTGG - Exonic
1117783385 14:59257823-59257845 TGTGAAGACCAGGGCAGGTGGGG - Intronic
1117912354 14:60648153-60648175 TGTGGAGAACCAGGCGGGAGTGG + Intronic
1118023485 14:61743839-61743861 TGGGAAGAGCAGGGGAGGGGAGG + Intronic
1118149828 14:63177941-63177963 TGTGGAGAGCAAGTGAAGAGAGG - Intergenic
1118171757 14:63395652-63395674 TGGGGAGAGAGGGGGAGGAGAGG + Intronic
1118318231 14:64738295-64738317 TGGGGTGAGGAGGGCAGCAGAGG - Intronic
1118514175 14:66508390-66508412 CGAGGAGAGCGGGGAAGGAGGGG - Exonic
1118598420 14:67453758-67453780 TGTGGAGAGAGGGGCAGAGGAGG + Intronic
1118771109 14:68943353-68943375 TGGGTAGTGCAGGGCAGGACGGG + Intronic
1118882781 14:69843102-69843124 TCTGGGGAGCAGGTCAGCAGTGG - Intergenic
1119212800 14:72845478-72845500 TGTGGAGAGGCCAGCAGGAGTGG - Intronic
1119327444 14:73769198-73769220 GGTGGTGAGCTGGGCAGGTGTGG + Intronic
1119523208 14:75301669-75301691 CGGGGAGAGCAGGGGAGGATAGG + Intergenic
1119574335 14:75704880-75704902 TATGGTGAGCAAGGGAGGAGAGG + Intronic
1119742351 14:77022344-77022366 TGGGGAGAGGAGGGAGGGAGTGG - Intergenic
1119764387 14:77179276-77179298 AGGGGAGGGGAGGGCAGGAGAGG - Intronic
1121583792 14:95049152-95049174 TGAGGAGTGAATGGCAGGAGAGG - Intergenic
1121780943 14:96622126-96622148 AGGGGAGGGGAGGGCAGGAGAGG + Intergenic
1121815049 14:96922849-96922871 CGTGATGAGCAGAGCAGGAGAGG + Intronic
1122117585 14:99535536-99535558 TGTGCAGAGCTGGGCAGCAGGGG - Intronic
1122118810 14:99540987-99541009 TGTGAAAACCAGGCCAGGAGGGG - Intronic
1122182848 14:99968379-99968401 GGCAGTGAGCAGGGCAGGAGAGG + Intergenic
1122238499 14:100346242-100346264 GAAGGAGAGCAGGGCAGGGGTGG + Intronic
1122255887 14:100476153-100476175 TGAGGATACCAGGGCTGGAGAGG + Intronic
1122328242 14:100895571-100895593 TGTGGGGAGCAGGGTCGGGGTGG + Intergenic
1122896091 14:104757822-104757844 GATGGTGTGCAGGGCAGGAGTGG - Intronic
1122972285 14:105157240-105157262 TGTGAAGGTCTGGGCAGGAGCGG - Intronic
1122982910 14:105199604-105199626 TAGGGAGAGCAGGGCAGAGGTGG - Intergenic
1123121877 14:105920458-105920480 TGTGGGGTGCAGGGCAGGAGGGG + Intronic
1123402643 15:20003250-20003272 TGCGGGGTGCAGAGCAGGAGGGG + Intergenic
1123404568 15:20012108-20012130 TGTGGGGTGCAGGGCAGGAGGGG + Intergenic
1123430933 15:20215899-20215921 GGAGCAGGGCAGGGCAGGAGAGG + Intergenic
1123438390 15:20272471-20272493 TGAGGGGAGCAGAGGAGGAGGGG - Intergenic
1123511982 15:21009904-21009926 TGCGGGGTGCAGAGCAGGAGGGG + Intergenic
1123513901 15:21018755-21018777 TGTGGGGTGCAGGGCAGGAGGGG + Intergenic
1123905203 15:24914089-24914111 TGTGGAGAGTGGGGAGGGAGAGG + Intronic
1124199045 15:27660697-27660719 TGTGGGGAGGAGGGCAAGTGAGG - Intergenic
1124222305 15:27861387-27861409 TCTGGGGAGCAGCCCAGGAGAGG + Intronic
1124223531 15:27870109-27870131 TGTGGGGAGAAGGGCAGGCCAGG - Intronic
1124439293 15:29675080-29675102 TGGGGTGAGCAAGGGAGGAGGGG - Intergenic
1124900269 15:33816142-33816164 AGTGGTGAGGAGGGAAGGAGAGG - Intronic
1125031306 15:35078784-35078806 TGGGGAGGGTAGGGGAGGAGCGG - Intergenic
1125191735 15:37001526-37001548 TGTGGTGAACAGGGAAAGAGGGG - Intronic
1125479484 15:40070318-40070340 GGTGGAGAGCAGGGGAGGTCAGG + Intergenic
1125525390 15:40370853-40370875 TGAGGAGAGCAGGGCAGTTGGGG - Exonic
1125737148 15:41934702-41934724 TGTGGACTCCAGAGCAGGAGGGG + Intronic
1125748327 15:42012362-42012384 TGTGGAGAGTGTGGCAAGAGAGG - Intronic
1126208576 15:46074266-46074288 GGTGGATACCAGGGCTGGAGAGG + Intergenic
1127404381 15:58625965-58625987 TATGGAGAACAGGGTAGCAGGGG + Intronic
1127848365 15:62891393-62891415 TGTGGAGAACAGGGCTGTGGTGG - Intergenic
1128349845 15:66881491-66881513 TGTGATGCGCATGGCAGGAGTGG + Intergenic
1128690448 15:69720833-69720855 TGGGTAGTACAGGGCAGGAGAGG + Intergenic
1128738351 15:70066252-70066274 TGGGGAGGGCAGGGGAGGCGTGG + Intronic
1128747773 15:70126579-70126601 GGTGGAGAGCAGGGAGGCAGGGG - Intergenic
1129363657 15:75041168-75041190 TTGGGAGAGCAGGGCAGGGCGGG - Intronic
1129661363 15:77554761-77554783 TGTGGAGATGAGAGCAGGAGGGG + Intergenic
1129698510 15:77754275-77754297 TGTGGAGGGAAGGGAGGGAGGGG + Intronic
1129857235 15:78833130-78833152 TTTGGGGAGCAGGGGAAGAGAGG - Intronic
1129895170 15:79099898-79099920 AGTGGAGAGCAGGTCTGGAGTGG - Intergenic
1130258665 15:82337706-82337728 TGTGGAGGGCCGGGGAGGGGAGG - Intergenic
1130270020 15:82441378-82441400 TGTGGAGGGCCGGGGAGGGGAGG + Intergenic
1130462353 15:84168691-84168713 TGTGGAGGGCCGGGGAGGGGAGG + Intergenic
1130473974 15:84247613-84247635 TGTGGAGGGCCGGGGAGGGGAGG + Intergenic
1130481386 15:84361681-84361703 TGTGGAGGGCCGGGGAGGGGAGG + Intergenic
1130490319 15:84426094-84426116 TGTGGAGGGCCGGGGAGGGGAGG - Intergenic
1130501911 15:84504852-84504874 TGTGGAGGGCCGGGGAGGGGAGG - Intergenic
1130596254 15:85252254-85252276 TGTGGAGGGCCGGGGAGGGGAGG + Intergenic
1130937882 15:88485524-88485546 TTGGGAGGGCAGGGCAGGAAAGG - Intergenic
1130967058 15:88705429-88705451 TGGGGAGAGGAGGGGAGGGGAGG + Intergenic
1131372453 15:91894224-91894246 GTTGGAGAGGAGGGCAGGGGTGG + Intronic
1131933006 15:97466761-97466783 AGAGGAGGGCAGGGGAGGAGAGG + Intergenic
1132163209 15:99562473-99562495 TTTGGAGATGAGGGCGGGAGGGG + Intergenic
1132255687 15:100373881-100373903 GGGGGCGAGCAGGGAAGGAGGGG + Intergenic
1132345022 15:101102861-101102883 TGAGGACAGCAGGGCAGGGCTGG + Intergenic
1132537461 16:489759-489781 GGTGGAGGGCGGTGCAGGAGGGG + Intronic
1132614804 16:835263-835285 TGGGGAGGGCAGGGCAGGGCGGG - Intergenic
1132646972 16:1003642-1003664 AGAGGAGTGCAGGGCATGAGGGG - Intergenic
1132774020 16:1581812-1581834 AGTGGAGGGGAGGGGAGGAGAGG + Intronic
1132787635 16:1666746-1666768 TGTGTAGTACAGAGCAGGAGAGG + Intronic
1132883355 16:2171927-2171949 TGCGGAGAGGCAGGCAGGAGCGG - Intronic
1132937376 16:2488018-2488040 ACTGGAGAACGGGGCAGGAGGGG - Intronic
1132990616 16:2790959-2790981 TGAGGAAAGCAGGGTAGGTGAGG - Intergenic
1133021999 16:2970819-2970841 TGGGGAGAGCAGTGTGGGAGTGG + Intronic
1133570775 16:7038073-7038095 TGTGGAGGGGAGGGCAAGTGGGG - Intronic
1133813271 16:9177456-9177478 AGGGGAGAGGAGGGGAGGAGGGG - Intergenic
1134004249 16:10807323-10807345 TGTGGGGGGCAAGGAAGGAGAGG - Intronic
1134135540 16:11674314-11674336 TGTGGCGAGCGAGGCAGGAGAGG + Intronic
1134249842 16:12566523-12566545 TCTGAAGAGCATGACAGGAGGGG + Intronic
1135137380 16:19895121-19895143 TGGGGAGAGGAGGGCAGGGATGG + Intergenic
1135165774 16:20137909-20137931 TGTACAGAGCAGGGCAGAAAAGG + Intergenic
1135196281 16:20397777-20397799 AGGGAAGAGCAGGGCAGGGGAGG - Intronic
1135247413 16:20868987-20869009 TGTGCAGAGGAGGGAGGGAGAGG - Intronic
1135328691 16:21543841-21543863 TGGGCAGTGCAGGGCAGGACGGG - Intergenic
1135510031 16:23074621-23074643 TGAGGGAAGCAGGGCAGGATAGG - Intronic
1136230774 16:28883975-28883997 AGTGGAGGGCAAGGCAGGAGAGG - Intronic
1136285112 16:29236295-29236317 TGTGGAGAACTGGGGAGCAGTGG + Intergenic
1136339042 16:29629814-29629836 TGGGCAGTGCAGGGCAGGACGGG - Intergenic
1136413398 16:30090149-30090171 GCTGGAGATCAGGGGAGGAGAGG - Intronic
1136853711 16:33635328-33635350 AGGGCAGGGCAGGGCAGGAGAGG - Intergenic
1136995520 16:35186146-35186168 TGTGGCCAGCAATGCAGGAGAGG - Intergenic
1137242912 16:46673511-46673533 AGTGGGGAACAGGGCAGGAAGGG + Intronic
1137477493 16:48822258-48822280 TGTGGAAAGCAGGGGAGAAATGG - Intergenic
1137679667 16:50329472-50329494 TGTGGTGAGCTAGTCAGGAGTGG + Intronic
1137947822 16:52751176-52751198 TGGGGAGAGGAGGGCAGTGGAGG + Intergenic
1138090177 16:54167544-54167566 AGTGGAGAGAAGGGTTGGAGAGG + Intergenic
1138434332 16:56988885-56988907 GAGGGAGAGCAGGGAAGGAGAGG - Intergenic
1138575905 16:57907206-57907228 TAAGCAGAGCAGGGCAGGGGTGG - Intronic
1138615237 16:58160132-58160154 GGTGGAGACCAGGGCAGGGGAGG - Intronic
1138988484 16:62361446-62361468 TGGGAAGAGGAGGGGAGGAGAGG + Intergenic
1139118997 16:63992394-63992416 TGGAGAGAGAAGGGAAGGAGGGG - Intergenic
1139363638 16:66419324-66419346 TGTGGAGAGGAGGGGAGGGAAGG + Intergenic
1139648917 16:68351961-68351983 TCAGGAGAGCAGAGCAGAAGAGG - Intronic
1139653216 16:68372927-68372949 TGTGGCCAGCAGGGCCGCAGGGG + Intronic
1139993843 16:70961829-70961851 TGTGGTGGGCAGGGCAGGATGGG + Intronic
1140026728 16:71297633-71297655 TGGGGAGAGGAAGGCAGGGGAGG - Intergenic
1140127970 16:72133635-72133657 AGGTGTGAGCAGGGCAGGAGAGG + Intronic
1140225256 16:73071583-73071605 TGCAGAGAGGAGGGGAGGAGTGG + Intergenic
1140454275 16:75095734-75095756 TGTGGAGAACCGGGAAGGTGAGG + Intronic
1140628974 16:76829207-76829229 TGTGAAGTGCAGGACAGCAGTGG + Intergenic
1141151039 16:81564965-81564987 TGGGCATTGCAGGGCAGGAGGGG + Intronic
1141625526 16:85259258-85259280 GGTGGAGCACAGGGCAGGACGGG - Intergenic
1141677792 16:85526609-85526631 GGTGGAGAGCAGGGATGGGGAGG + Intergenic
1141723041 16:85767514-85767536 TGGGCAGAGAAGGTCAGGAGAGG - Intergenic
1141821810 16:86451281-86451303 TGGGGAAAGCGAGGCAGGAGAGG - Intergenic
1142041714 16:87898378-87898400 TGGGCAGTGCAGGGCAGGACAGG - Intronic
1142090179 16:88205919-88205941 TGTGGAGAACTGGGGAGCAGTGG + Intergenic
1142196037 16:88739729-88739751 CAGGGAGATCAGGGCAGGAGAGG + Intronic
1142249059 16:88982862-88982884 TGTGGAGCCCAGGACAGGACAGG - Intergenic
1142258802 16:89032557-89032579 AGTGGAGATCAGGGGAGGACGGG - Intergenic
1142322211 16:89390822-89390844 TGCGGAGGGCAGGGCATGTGGGG - Intronic
1142433025 16:90040723-90040745 TGGGGAGCACAGGGCTGGAGGGG + Intronic
1203115303 16_KI270728v1_random:1483773-1483795 GGAGCAGGGCAGGGCAGGAGAGG - Intergenic
1142515073 17:422478-422500 TGTGGCCAGAAGGGGAGGAGGGG + Intronic
1142702321 17:1670775-1670797 TGATGAGAGCAGGCCAGGCGCGG - Intronic
1143631187 17:8141216-8141238 GGAGGCGAGCAGGGCAGCAGCGG - Exonic
1143798293 17:9356491-9356513 TGAGCAGAGAAGGGCAGGTGTGG - Intronic
1144005382 17:11094887-11094909 GGAGCAGAGCAGGGGAGGAGTGG - Intergenic
1144326473 17:14186613-14186635 TGTGGTGAGCAAGACAGGTGTGG - Intronic
1144475351 17:15583488-15583510 TGTGGTGAGCAAGACAGGTGTGG - Intronic
1144848326 17:18231467-18231489 GGTGGACAGCAGGGCCTGAGGGG - Intronic
1144848989 17:18234572-18234594 AGTGGAGGGCAGAGCAGGAATGG + Intronic
1144949314 17:18985470-18985492 GGTGCAGAGCTGGGCAGGGGTGG + Intronic
1145062436 17:19741620-19741642 TCTGGAGAGCAGGCCCAGAGGGG - Intronic
1146163683 17:30572810-30572832 GGTGGTGGGCAGGGCAGGATGGG - Intergenic
1146523790 17:33548586-33548608 AATGGAGAGTAGAGCAGGAGAGG - Intronic
1146676971 17:34780453-34780475 TGTGCAGAACAGGGCATGAGAGG - Intergenic
1146955512 17:36934659-36934681 TGAGGACAGCAGGGCTGGACTGG + Intergenic
1147135293 17:38430499-38430521 TGAGCAGAGCAGTGCAGGAGTGG + Intronic
1147142216 17:38466270-38466292 GGTGGAGGCCCGGGCAGGAGGGG - Exonic
1147266197 17:39236503-39236525 CGGGGAGAGGAGGGTAGGAGGGG - Intergenic
1147286276 17:39404603-39404625 TATGGGGGGCAGGGGAGGAGGGG + Intronic
1147338061 17:39738809-39738831 TTTGGAGGGCAGTGAAGGAGAGG + Exonic
1147439339 17:40437873-40437895 TGGGGAGATCAGGGCAGAGGTGG - Intergenic
1147961657 17:44171165-44171187 TGTGGTCTGCAGGGAAGGAGGGG - Intronic
1148093200 17:45034939-45034961 ACTGGAGAGCAGGGCAAGTGTGG + Exonic
1148646335 17:49221666-49221688 TGGGAAGACCAGGACAGGAGAGG + Intronic
1148744916 17:49912754-49912776 CCTGGAGAGCAGGGAAGAAGAGG - Intergenic
1148894809 17:50833497-50833519 GGTGCTGAGGAGGGCAGGAGAGG - Intergenic
1149361702 17:55901957-55901979 TGTGGAAAGCAGGGCTTGGGAGG + Intergenic
1149781231 17:59398046-59398068 TGAGGAGAGCAGGGCACAAAGGG + Exonic
1150156936 17:62861511-62861533 TGTGGACAGGAAGGCAAGAGTGG + Intergenic
1150289656 17:63973933-63973955 TCTGGAGGGCTGGGCAGAAGGGG - Intergenic
1150915993 17:69437435-69437457 GGTGGAGAGGAAGGCAGGAGAGG + Intronic
1151135444 17:71942142-71942164 TGTGGAGAGGAGGTGTGGAGAGG - Intergenic
1151186871 17:72371210-72371232 TCTGGAGAGAAGGGGAGAAGGGG - Intergenic
1151227259 17:72656474-72656496 TGTGTAGAGTGGGACAGGAGAGG + Intronic
1151310304 17:73288680-73288702 TGTGGGCAGAAGGGGAGGAGAGG - Intronic
1151698013 17:75727874-75727896 GGAGGACAGCAGGGCAGGAGGGG + Intronic
1151705036 17:75762971-75762993 TGCTGAGTGCAGGGCGGGAGGGG + Intronic
1151768591 17:76145189-76145211 GATGGAATGCAGGGCAGGAGGGG + Exonic
1151816179 17:76472568-76472590 TGTGGAGCCCAGTACAGGAGGGG + Intronic
1152228266 17:79102564-79102586 CCTGGGGAGCAGGGAAGGAGGGG + Intronic
1152410420 17:80120238-80120260 TGAGGAGGGGAGGGGAGGAGGGG - Intergenic
1152633119 17:81419557-81419579 TGTGGGGAGCGGGGAAGGTGTGG + Intronic
1152774402 17:82191518-82191540 GGTGGAAGGGAGGGCAGGAGAGG - Intronic
1152778332 17:82215645-82215667 TGTGGGGGGCAGGGAAGGAAGGG - Intergenic
1152778346 17:82215682-82215704 TGGGGGGGGCAGGGAAGGAGGGG - Intergenic
1152793811 17:82296907-82296929 GGTGGAGAGGAGGGAGGGAGGGG - Intergenic
1152794723 17:82301380-82301402 AGGGGTGAGCTGGGCAGGAGGGG + Intergenic
1152817687 17:82418226-82418248 TGCTGGGAGCAGGGCAGGTGCGG - Intronic
1152923155 17:83075956-83075978 TGTGGGGAGCACGGCGGGAGGGG + Intergenic
1153407627 18:4758624-4758646 GGTGGAGGGCAGTGGAGGAGAGG - Intergenic
1153971160 18:10228556-10228578 AGTGGTTAGCAGGGCAGGAGGGG - Intergenic
1154126781 18:11698738-11698760 TGAAGAGAAGAGGGCAGGAGAGG + Intronic
1154202584 18:12309187-12309209 TGTAGAGATCGGGGCGGGAGGGG - Intronic
1154399146 18:14018547-14018569 TGTGAAGTGCAGGGCAGGGAGGG + Intergenic
1154966757 18:21366265-21366287 AGAGGAAAGCAGGGAAGGAGAGG - Intronic
1155307381 18:24492108-24492130 TGTGCAGAGCGGAGCTGGAGTGG - Intergenic
1155558497 18:27049194-27049216 AGTGGAGAGGAGGGAAGTAGTGG + Intronic
1155912153 18:31516350-31516372 TGGGGAAAGAAGGGAAGGAGAGG + Intronic
1156406926 18:36791536-36791558 TCAGGAGAGCAGGGCAAGATAGG + Intronic
1156526167 18:37769187-37769209 TGTGGATTGCAGGGCAGTAGGGG + Intergenic
1156556598 18:38075507-38075529 TGTGGAAATCAGGGAATGAGAGG - Intergenic
1156781478 18:40855819-40855841 TTAGGAGAGTAAGGCAGGAGTGG - Intergenic
1157569604 18:48703790-48703812 TGTGGAGTGAAGGGCAGGGTGGG + Intronic
1157768965 18:50327651-50327673 TCAGTAGAGCAGGGCTGGAGTGG + Intergenic
1158125536 18:54096052-54096074 TGAGGAGAGCAGGAGAGGAAGGG - Intergenic
1158321664 18:56270554-56270576 AGGGGAGGGCAGGGGAGGAGAGG + Intergenic
1158462281 18:57656805-57656827 TGGGGAGAGAAGGGAGGGAGGGG + Intronic
1159054907 18:63453761-63453783 GACGGTGAGCAGGGCAGGAGAGG - Intergenic
1159109493 18:64040759-64040781 TGTGGAGAACAGGGGAGAACAGG + Intergenic
1159270440 18:66142248-66142270 TGGGGAGTGCAGGAAAGGAGAGG + Intergenic
1160305703 18:77733745-77733767 TTTGGAGACAAGGGCTGGAGAGG + Intergenic
1160404210 18:78634106-78634128 TGAGGAAAGCAAGGCAGAAGCGG - Intergenic
1160816755 19:1039624-1039646 TCTGCAGAGGATGGCAGGAGGGG - Intergenic
1160835271 19:1122023-1122045 AGGGGAGAGGAGGGCAGGATGGG - Intronic
1160895452 19:1400084-1400106 CGTGCAGAGCAGGGCTGGAGAGG + Intronic
1160895503 19:1400231-1400253 GGTGCAGAGCAGGGCTGGGGAGG + Intronic
1160962867 19:1731835-1731857 TATGGAAAGGAGGGTAGGAGTGG + Intergenic
1161030729 19:2056705-2056727 GGAGGAGAGGAGGGGAGGAGAGG - Intergenic
1161053450 19:2177705-2177727 AGCGGAGAGCAGGGCTGGCGAGG - Intronic
1161086851 19:2339413-2339435 TGTGTAGGGCTGGGCAGGTGTGG + Intronic
1161118358 19:2511887-2511909 TGGAGAGAGGAGGGCAGGGGAGG + Exonic
1161415687 19:4145304-4145326 TGGGGAAAGAAGGGGAGGAGGGG + Intergenic
1161474554 19:4477019-4477041 TGAGTGGAGCAAGGCAGGAGGGG + Intronic
1161905353 19:7152452-7152474 CGTGGAGACCAGCTCAGGAGAGG + Intronic
1161978887 19:7620450-7620472 CGTGGGGGGCAGGGCAGGGGTGG + Intronic
1162209154 19:9077796-9077818 AGTGGGGACCAGGGCAGGATTGG - Intergenic
1162228379 19:9243845-9243867 TGCAGAGACCAGGGAAGGAGGGG + Intergenic
1162283764 19:9722005-9722027 TGAGCACAGCAGGGCAGGAGGGG - Intergenic
1162301229 19:9846288-9846310 TAGGGAGAGCAGAGCAGTAGAGG + Intronic
1162496234 19:11024796-11024818 TGAGGAGAGCCAGGCAGGTGGGG - Intronic
1163444939 19:17340732-17340754 TGAGTAGGGCAGGGCAGGAGGGG - Intronic
1163463851 19:17455126-17455148 GGTGGAGAGCTGGGAGGGAGTGG - Intronic
1163549511 19:17957824-17957846 TGTGGAGAGCAGGGCAGGAGTGG + Intronic
1163677561 19:18662948-18662970 TGAGGAGGGCAGGGAAGGAAAGG - Intronic
1163692158 19:18743879-18743901 AAGGGAGAGAAGGGCAGGAGGGG - Intronic
1163795918 19:19337940-19337962 GGTGGAGCCCAGGACAGGAGAGG - Intronic
1164270286 19:23666682-23666704 TTTGGTGAGCCAGGCAGGAGAGG + Intronic
1164828895 19:31305174-31305196 TGTGGAGGGGGTGGCAGGAGAGG - Intronic
1164859798 19:31554024-31554046 TGGGGAGAGCAGGGAAGGGTGGG - Intergenic
1165026531 19:32966597-32966619 TGGGGATGGCAGGGGAGGAGTGG - Intronic
1165094346 19:33402339-33402361 TGTGGGAAGCAGAGGAGGAGGGG + Intronic
1165775257 19:38400616-38400638 TGTGGTCAGCAGAGTAGGAGTGG + Intergenic
1165908523 19:39208846-39208868 TGTAGAGTGTAGGGCGGGAGTGG - Intergenic
1166035440 19:40164857-40164879 CGTGGAGAGCAAGGGAGAAGAGG - Intergenic
1166502113 19:43349313-43349335 AGTGGATAGGAGGGCAGCAGGGG + Intergenic
1166507999 19:43384139-43384161 AGTGGATAGGAGGGCAGCAGGGG - Intergenic
1166982385 19:46639014-46639036 TGCGGAGAGAGGGACAGGAGAGG + Intergenic
1167089236 19:47332035-47332057 GGTGGCTGGCAGGGCAGGAGAGG - Intergenic
1167212096 19:48139722-48139744 TGTGGGGTGCAGGGAAGGGGAGG - Intronic
1167357042 19:49010618-49010640 AGGGCAGGGCAGGGCAGGAGGGG - Intronic
1167622946 19:50568874-50568896 GGTAGAGAGATGGGCAGGAGAGG + Intergenic
1167954691 19:53055320-53055342 TGAGCAGAGCAGGGCAGGGCAGG + Intergenic
1167954692 19:53055325-53055347 AGAGCAGGGCAGGGCAGGAGAGG + Intergenic
1168353233 19:55688058-55688080 TTGGGAGGGCGGGGCAGGAGAGG + Intronic
1168411059 19:56140831-56140853 TGTGGAGATCAGGGGAGGCCGGG - Intronic
1168517107 19:57017648-57017670 TGAGGAGGGGAGGGAAGGAGAGG - Intergenic
1168517147 19:57017749-57017771 TGAGGAGGGGAGGGAAGGAGAGG - Intergenic
1168691075 19:58377968-58377990 TGTGGGGAGGTGGGCAGGATGGG - Intronic
1168721513 19:58557289-58557311 TGTGGAGCACAGCCCAGGAGAGG - Intronic
925084708 2:1099179-1099201 TCTGGAGAGCAGGGGAGGAGTGG - Intronic
925108633 2:1314492-1314514 TGGGTGGAGCAGGGCAGGAGTGG + Intronic
925277106 2:2657868-2657890 TTTGCAGAGATGGGCAGGAGAGG - Intergenic
925887243 2:8403430-8403452 TCTCTAGAGCAGGGCAGGAATGG + Intergenic
926125237 2:10267861-10267883 GGTGGAGGGCAGGGCTGGGGAGG - Intergenic
926150869 2:10424997-10425019 GATGGAGGGCAGGGCAGGCGAGG - Intronic
926215999 2:10905696-10905718 TGGGGAAAGGAGGGCTGGAGAGG + Intergenic
926277233 2:11413591-11413613 GGTGGAGAGCATTTCAGGAGAGG + Intergenic
926299225 2:11590275-11590297 TGTGGGGAACAGGGCAAGAATGG - Intronic
926686458 2:15702120-15702142 AGAGATGAGCAGGGCAGGAGAGG - Intronic
926793912 2:16603175-16603197 TGTGCAGGGCAAGGCTGGAGTGG - Intronic
927069131 2:19507522-19507544 TGTAGAGAGCATGGGAGAAGGGG + Intergenic
927477377 2:23423979-23424001 GGTGGACAGCTGGGCAGGAAGGG - Intronic
927485733 2:23487328-23487350 GCTGGAGAGAGGGGCAGGAGGGG + Intronic
927699502 2:25259002-25259024 TGGGGAGAGAAGGGGAGGTGAGG - Intronic
927843913 2:26461674-26461696 GGTGCAGAGCAGGGCAGGGATGG - Exonic
927873066 2:26635975-26635997 TTTGGAGAGCAGGGTTAGAGAGG - Intronic
927975465 2:27335210-27335232 TGTGGTGGTGAGGGCAGGAGAGG + Intronic
928082073 2:28320484-28320506 TGTGCACATCAGGGCAGGACGGG + Intronic
928133862 2:28673455-28673477 AGAGGAGGGCAGGGGAGGAGAGG + Intergenic
928383117 2:30838362-30838384 TGTGGAGAGGTGGGCTGGGGAGG + Intergenic
928400882 2:30977948-30977970 TGTGGAGAGGGTGGGAGGAGTGG - Intronic
928424032 2:31163377-31163399 TGTGGAGGGCTGGCCAGGGGAGG + Intergenic
929027002 2:37614567-37614589 TCTGGAGAGGAGGGAATGAGGGG - Intergenic
929034054 2:37673769-37673791 TGGGGAGGGGAGGGCAGGGGAGG - Intronic
929423443 2:41818940-41818962 GGAGGAGAGGAGGGGAGGAGGGG + Intergenic
929444587 2:41992174-41992196 AGGGGAGGGCAGGGGAGGAGAGG + Intergenic
929499559 2:42478678-42478700 TGTGGAAGGCAGTGCAGGTGGGG - Intronic
929553805 2:42911261-42911283 AGTGAAGAGCAGGGAAGGAAGGG + Intergenic
929714782 2:44298834-44298856 TTGGAAGAGTAGGGCAGGAGAGG + Intronic
930250033 2:49024690-49024712 TGTGAAGAGAAAGGCAGGGGAGG - Intronic
930321775 2:49863857-49863879 AGAAGAGAGTAGGGCAGGAGAGG + Intergenic
930698920 2:54439762-54439784 TGTGTAGTGCAGGGCTGGGGTGG + Intergenic
930936193 2:56955147-56955169 TGAGAACAGCAGGGAAGGAGGGG - Intergenic
931250793 2:60529127-60529149 AGAGAAGAGCAGGGCAGGTGGGG - Intronic
931587176 2:63841352-63841374 TGAGGAGCGCAGGGCAGGCGGGG + Intronic
932018767 2:68060679-68060701 AGGGCAGAGCAGGGCAGGAAAGG + Intronic
932029274 2:68166549-68166571 TGTGGAAGGCGAGGCAGGAGAGG + Intronic
932334471 2:70922278-70922300 AGTGGAGAGGAAGGGAGGAGGGG + Intronic
932453068 2:71828146-71828168 GGTGTAGAGCAGGGATGGAGGGG - Intergenic
932565152 2:72901507-72901529 TGTGGAAAGCACTGCAGGAGGGG - Intergenic
933791139 2:85884706-85884728 GGTGAAGAACAGGGCAGAAGAGG + Intronic
934615362 2:95767402-95767424 TCTGGAGAGTAGGAGAGGAGAGG - Intergenic
934915889 2:98300716-98300738 GTTGGAGCTCAGGGCAGGAGCGG - Intronic
935032655 2:99337422-99337444 TGTGGAGAGCCGGGTGCGAGCGG + Exonic
935230280 2:101090028-101090050 AGGGGAGAGGAGGGAAGGAGAGG + Intronic
935400070 2:102651133-102651155 GGTGGTGAGTAGGGCAGGAGGGG - Intronic
935820412 2:106887395-106887417 TGTGGAGGGGCGGGCAGGTGGGG - Intergenic
937311611 2:120906355-120906377 CCTGGAGTCCAGGGCAGGAGAGG - Intronic
937342299 2:121099031-121099053 TCTGGAGAGGAGGGCATGGGCGG + Intergenic
937468136 2:122152731-122152753 AGTGGGGAGCAAGGGAGGAGTGG + Intergenic
937470326 2:122168848-122168870 GGGAGAGAGGAGGGCAGGAGAGG + Intergenic
937952659 2:127400820-127400842 AATGGGGAGCAGGGCAGCAGAGG + Intergenic
937976942 2:127588249-127588271 GGTGGAGAGCATGGCCGTAGTGG + Intronic
938095250 2:128457225-128457247 TGTGAAGCACAGGTCAGGAGGGG - Intergenic
938210075 2:129459766-129459788 TGTGAGGAGCAGGCCAGGTGAGG + Intergenic
938308229 2:130268677-130268699 TGTGGAGGGAAAGGCTGGAGGGG + Intergenic
938315925 2:130327946-130327968 CGCGGAGTGCAGGGCAGCAGAGG - Intergenic
938447100 2:131388159-131388181 TGTGGAGGGAAAGGCTGGAGGGG - Intergenic
938531504 2:132192235-132192257 TGAAGAGTGCAGGGCAGGACAGG + Intronic
940240724 2:151560532-151560554 AGTGGAGAGCAGGGGAGGGGAGG + Intronic
940763828 2:157768199-157768221 ACTGGGGAGCAGGGAAGGAGTGG - Intronic
941109871 2:161407991-161408013 TTGGGAGAGGAGGGCAGTAGTGG + Intronic
942322496 2:174748060-174748082 AGAGCAGAGAAGGGCAGGAGAGG - Exonic
942731741 2:179067589-179067611 GGAGGAGAGCAAGGGAGGAGGGG - Intergenic
943170480 2:184391303-184391325 AGTGTAGTGCAGGGCAGGGGAGG + Intergenic
944143834 2:196485005-196485027 GTTGGAGAGCAGGGGAGAAGAGG + Intronic
944503694 2:200388195-200388217 GTTGGAGAGTAAGGCAGGAGAGG + Intronic
944595273 2:201255472-201255494 TGGGGGGAGCAGGGTAGGAGTGG - Intronic
946095508 2:217270823-217270845 TGTGGAAAGGAGGCCAGGAAAGG + Intergenic
946307600 2:218865091-218865113 TGATGAGAACAGGGCAGGAGGGG - Intronic
946919235 2:224560709-224560731 TGATGATAGCAGGCCAGGAGTGG - Intronic
947794874 2:232887951-232887973 TGTGGGGAGCAGGGCCGGAAAGG + Intronic
948064479 2:235066963-235066985 TCTGGAGAGGAGGGGAGGAGGGG + Intergenic
948480586 2:238247742-238247764 GCTGGAGAGGAGGGAAGGAGAGG + Intronic
948842172 2:240657168-240657190 TCTGGGGAGCTGGGGAGGAGGGG + Intergenic
948856222 2:240731884-240731906 TGAGGGGAGGAGGGGAGGAGGGG + Intronic
1168856500 20:1012892-1012914 GGAGGGAAGCAGGGCAGGAGTGG + Intergenic
1169375738 20:5065597-5065619 TGAGGAGTGAAGGGCAGTAGGGG - Intergenic
1169453978 20:5736059-5736081 AGGGGAGAGGAGGGGAGGAGAGG + Intergenic
1170044716 20:12072883-12072905 ACTGGGGAGCAGGGAAGGAGAGG - Intergenic
1170667356 20:18398399-18398421 TGTAGAAAGCAGAGCAGGAAAGG + Intronic
1170764143 20:19275633-19275655 TGTGGGGAGGAGGGCGGTAGGGG + Intronic
1171039101 20:21743133-21743155 TGTGGAGAGCTAGGGAGCAGAGG + Intergenic
1171173143 20:23033430-23033452 TGGGGAGAGGAGGGCAGAATCGG + Intergenic
1171223650 20:23422423-23422445 TGTAGAGGGCAAGGCAAGAGGGG + Intergenic
1171345646 20:24464274-24464296 GGTGGCCAGCAGGGCGGGAGGGG - Intergenic
1171973471 20:31578928-31578950 TGTGGAGAGAGAGGCAGGGGTGG - Intergenic
1172067733 20:32233588-32233610 TGTGGTGAGCAGACCAGGAGAGG + Intronic
1172160542 20:32865097-32865119 TGTGGGCAGCAAGGCATGAGGGG - Intronic
1172423944 20:34842312-34842334 AGGGGAGAGGAGGGGAGGAGAGG + Intergenic
1173002222 20:39112437-39112459 AGTGGGGAGAAGAGCAGGAGGGG + Intergenic
1173229856 20:41185561-41185583 TCTGGAGAGCCTGGAAGGAGAGG - Intronic
1173480936 20:43398834-43398856 TCTGGAGCGGAAGGCAGGAGTGG - Intergenic
1173845211 20:46183929-46183951 TGTGGTGAGCAGGACTGGGGTGG - Intronic
1174013916 20:47472627-47472649 TGTGGGGAGCAGGGGGGCAGGGG - Intergenic
1174479977 20:50824414-50824436 TCTGGAGACCAGGTCTGGAGAGG + Intronic
1175264267 20:57693068-57693090 TGTTGTGAGCAGGCCGGGAGTGG + Intronic
1175618620 20:60424387-60424409 TGTGGAGAGTGGGGTGGGAGAGG + Intergenic
1175631153 20:60537405-60537427 TGGTCTGAGCAGGGCAGGAGAGG - Intergenic
1175874307 20:62222156-62222178 TGTGGATGACAGGGGAGGAGGGG - Intergenic
1175891455 20:62317842-62317864 GGTGGACAGCAGGGCAGGGAAGG + Intronic
1175963024 20:62646564-62646586 TGAGGAGGCCAGGGCAGCAGTGG + Intronic
1176244735 20:64092023-64092045 GGTGCAGAGCAGGGTAGAAGAGG - Exonic
1176764954 21:13007195-13007217 TGAAGAGTGCAGGGCAGGACAGG - Intergenic
1178350951 21:31872995-31873017 TGTGGCGCGCGGGGAAGGAGGGG + Intergenic
1179084916 21:38207784-38207806 TGGGGAGAGGAGGGGAGGAGTGG - Intronic
1179084951 21:38207875-38207897 AGTAGAGAGGAGGGGAGGAGGGG - Intronic
1179165033 21:38928805-38928827 TGTGGGGTGCAGGGAAGGTGAGG - Intergenic
1179457009 21:41507247-41507269 TGTGCCGAGCCGGGCAGGACAGG + Intronic
1179472269 21:41619569-41619591 TCATGAGAACAGGGCAGGAGAGG - Intergenic
1179502346 21:41818105-41818127 TGTGGTGAGCCTGGCTGGAGGGG - Intronic
1179538912 21:42071470-42071492 TGTGGAGACCTGGGCAGGCAAGG + Intronic
1179797545 21:43794189-43794211 AGTGGAGACCAGGGCGGGAAAGG + Intronic
1179907996 21:44434116-44434138 TGGGGAGAGGAGGCCATGAGGGG + Intronic
1179958780 21:44756727-44756749 TGAGGGGAGCAGGGAAGCAGAGG - Intergenic
1180067765 21:45421125-45421147 TGAGGAGTGCAGGGCAGGACAGG - Intronic
1180094520 21:45549787-45549809 TGTGGGGAGGAGGACAGGTGGGG + Intergenic
1180512138 22:16101988-16102010 TGAAGAGTGCAGGGCAGGACAGG - Intergenic
1180635292 22:17258728-17258750 TGAGCAGAGGAGGCCAGGAGGGG + Intergenic
1181015143 22:20064273-20064295 CGGGGAGAGCAGGGCAGGGTGGG + Intronic
1181053434 22:20248357-20248379 TGTGGAGCTCAGGTTAGGAGCGG - Intronic
1181436514 22:22914322-22914344 TGGGGAGACCAGGGAAGGAGGGG - Intergenic
1181480700 22:23197588-23197610 TGTGGACAACAGGGAAGGTGAGG + Intronic
1181510351 22:23386182-23386204 GGTGGGGAGCAGGTGAGGAGCGG - Intergenic
1181534342 22:23533973-23533995 TGTGAAGGGCAGGGCTGGGGAGG + Intergenic
1182354971 22:29718851-29718873 TGGGAAGGGCAGGGCAGGACCGG + Intergenic
1182518036 22:30870080-30870102 TGTGGTGTGCAGGGAAGGATGGG - Intronic
1182570707 22:31235538-31235560 TCCGGAGAGGAGGGCAAGAGAGG + Intronic
1182695784 22:32198595-32198617 TCGGGAGAGCAGGGAAGGAGAGG - Intronic
1182963500 22:34499459-34499481 AGGGGCTAGCAGGGCAGGAGTGG + Intergenic
1183198674 22:36370862-36370884 GGTGGGAAGAAGGGCAGGAGGGG + Intronic
1183252190 22:36738034-36738056 AGGGCAGAGCAGGGCAGGTGTGG - Intergenic
1183379393 22:37483387-37483409 TGTCGAGGGCAGGGTAGGAAAGG - Intronic
1183463344 22:37966424-37966446 TGGGGAGGGCTGGGCAGGAAGGG + Intronic
1183623727 22:38989358-38989380 TATGGGGAGCAGGGAAGGAGTGG + Intronic
1183960722 22:41410407-41410429 TGTGGGAAGCAGGGCAGGTAGGG + Intergenic
1184065901 22:42120365-42120387 TGAGGAGGGCAAGGCAGGATTGG + Intergenic
1184357518 22:43992475-43992497 TGTGGAGAACAGGAGAGGCGTGG - Intronic
1184464226 22:44659528-44659550 TGTGGGGAAGAGGGCAGGAGAGG - Intergenic
1184745474 22:46453189-46453211 TGTGCACAGCAGGGCTGGAAGGG + Intronic
1184805273 22:46791342-46791364 TGTGGTGAGCAGCGCAGGGTTGG + Intronic
1184852790 22:47130312-47130334 TGGGGGGAGCCCGGCAGGAGGGG - Intronic
1184885449 22:47342292-47342314 ACTGGGGAGCAGGGCAGGTGGGG + Intergenic
1185086638 22:48744417-48744439 TGTGGCGAGCAGGGAAGGCCTGG + Intronic
1185172000 22:49299627-49299649 TGGGGAGGGGAGGGCAGGGGAGG - Intergenic
1185179054 22:49348903-49348925 GGTGGGGACCAGGGAAGGAGAGG - Intergenic
1185215077 22:49594144-49594166 TGTAGGGAGCAGGGCAGACGAGG - Intronic
1185218098 22:49615109-49615131 TGTGGAGCGCAGCGCCGGAGGGG - Intronic
1185219772 22:49623499-49623521 TGTGGGGAGAAGGCCAGGACGGG - Intronic
1185236795 22:49718578-49718600 TGTGGACAGCTGGGCAGGTGTGG + Intergenic
949536418 3:4999705-4999727 TGTGGACTGCAGGGGATGAGGGG - Intergenic
949711060 3:6871963-6871985 TGTGGAAAGGAGTGGAGGAGAGG - Intronic
950105543 3:10386144-10386166 TGGGGAGAGCAGGGCCTGAGGGG + Intronic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
950124706 3:10504363-10504385 TTCGGAGAGCAATGCAGGAGAGG + Intronic
950195507 3:11006538-11006560 TGTGGGGAGGAGGAGAGGAGAGG - Intronic
950360223 3:12444730-12444752 GATGCAGATCAGGGCAGGAGGGG - Intergenic
950450680 3:13063484-13063506 AGGGCAGAGGAGGGCAGGAGTGG + Intronic
950646995 3:14383228-14383250 AGTGGAGGGGAGGGGAGGAGGGG - Intergenic
951246153 3:20343908-20343930 TGTAGAGAGAAGGGCAGAAGTGG + Intergenic
951620233 3:24593606-24593628 TGGGGAGAGGTGGGGAGGAGGGG - Intergenic
952429661 3:33210667-33210689 AGTGGAGACCTGGGCAGGAAAGG + Intronic
953134523 3:40171202-40171224 TCTGGTTAGCAAGGCAGGAGGGG + Intronic
954331052 3:49890456-49890478 TGTGGACTGTAGGGCAGGTGGGG + Intronic
954390766 3:50267039-50267061 GAGGGAGAGGAGGGCAGGAGAGG - Intergenic
954443149 3:50532717-50532739 TGAGGAAAGCAGAGCTGGAGGGG + Intergenic
954630858 3:52047043-52047065 TGGGGAGAGCATGGCAGAAACGG + Intergenic
954695556 3:52423067-52423089 TGGTGAGAGAAAGGCAGGAGAGG - Intronic
954701101 3:52451308-52451330 TGTGGAAAGAGGGGCAGGTGTGG + Intronic
955322125 3:57981944-57981966 GGTGGAGAGCAGGGCTGTTGTGG - Intergenic
955757541 3:62240626-62240648 TGTGGAAAGCAAGGTTGGAGAGG - Intronic
956084661 3:65597176-65597198 TGTGGAGGGCAGGGGAAGGGAGG - Intronic
956368433 3:68531828-68531850 TGACATGAGCAGGGCAGGAGAGG - Intronic
956381895 3:68673035-68673057 TGTAGAGAAGAGGCCAGGAGAGG + Intergenic
956989953 3:74751634-74751656 AGCGGAGAGCAGGCCTGGAGTGG + Intergenic
957800073 3:85066646-85066668 AGTAGACAGCAGGGGAGGAGAGG - Intronic
958929888 3:100197693-100197715 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
959849515 3:111071269-111071291 TGGGGAGGGGAAGGCAGGAGGGG - Intronic
961009012 3:123423781-123423803 TGAGGAAAGAAGGGCAGGGGAGG + Intronic
961160680 3:124722164-124722186 TGTGCAGACCACGGCAGGTGGGG + Intronic
961197618 3:125016042-125016064 TGTGGAGAGCCAACCAGGAGAGG + Intronic
961376445 3:126469296-126469318 TGGGGAGAGCAGGCCAGGCAGGG - Intronic
961603493 3:128077347-128077369 TGGGGAGAGCAGGCCATAAGAGG - Intronic
961739751 3:129025826-129025848 TCTGGAGAGCAGGACAGATGAGG - Intronic
962847028 3:139281962-139281984 TCTGGCAACCAGGGCAGGAGAGG + Intronic
963361013 3:144271826-144271848 TTTGGGGAGCAGGGCTGTAGGGG + Intergenic
964892617 3:161555119-161555141 TGTGGTGGGCAGGACTGGAGTGG - Intergenic
965627073 3:170691869-170691891 TGTGGAGAGAAGGGAAGAAATGG + Intronic
966923468 3:184629547-184629569 TTAGCTGAGCAGGGCAGGAGAGG - Intronic
967031273 3:185609701-185609723 AATGGAGAGAGGGGCAGGAGTGG - Intronic
967766492 3:193285666-193285688 TGTATAGAGCATGGGAGGAGTGG - Intronic
967819176 3:193825574-193825596 TGTGGAGAGATAGGCAGAAGCGG + Intergenic
967838981 3:193988943-193988965 TGTGGAGGAGAGGGGAGGAGAGG + Intergenic
967873557 3:194251489-194251511 TGGGGAGAGCAGGGCAGAGAAGG + Intergenic
967963286 3:194941953-194941975 GGTGGAGAGGAGGCCTGGAGGGG - Intergenic
968882567 4:3309045-3309067 TGAGGAGAGCTGAGCAGGAGAGG + Intronic
968882689 4:3309523-3309545 TGAGGAGAGCTGAGCAGGAGAGG + Intronic
968882746 4:3309735-3309757 TGAGGAGAGCTGAGCAGGAGAGG + Intronic
968882849 4:3310105-3310127 TGAGGAGAGCTGAGCAGGAGAGG + Intronic
969113792 4:4859482-4859504 GGCGGAGGGCAGGGGAGGAGAGG - Intergenic
969124532 4:4936658-4936680 TGTGGGGAGCAAATCAGGAGAGG - Intergenic
969314131 4:6371387-6371409 TGTGGGGAGCAGGGGAGGCAGGG - Intronic
969315923 4:6381270-6381292 AGGGAAGAGGAGGGCAGGAGGGG - Intronic
969476474 4:7425092-7425114 TGGAGAGAGCAGGACAGGGGAGG - Intronic
969583435 4:8078580-8078602 TGGGGACAGCAGGTCAGCAGTGG + Intronic
969689379 4:8695874-8695896 TGGGGCGGGCAGGGCAGGCGGGG + Intergenic
970470818 4:16378040-16378062 AGACGTGAGCAGGGCAGGAGAGG + Intergenic
970542758 4:17096016-17096038 AGGGGAGAGGAGGGGAGGAGAGG - Intergenic
971383296 4:26119579-26119601 TGTGGATAGAAAGGAAGGAGGGG - Intergenic
971837782 4:31791244-31791266 GGTGGAGAGCAGGGCAGGGAGGG - Intergenic
972332763 4:38079072-38079094 TGAGGAGGCCAGGGCTGGAGGGG + Intronic
972709980 4:41586075-41586097 AGTGGAGGGGAGGGGAGGAGAGG - Intronic
973771780 4:54213463-54213485 TGTCCAGGGCAAGGCAGGAGAGG + Intronic
974038034 4:56834234-56834256 TGTAGAAAGCAGGGCAAGAACGG - Intergenic
974192394 4:58523045-58523067 AGTGGAGTGCAGGGGAGGGGAGG - Intergenic
975222901 4:71833733-71833755 AGACGTGAGCAGGGCAGGAGAGG - Intergenic
975756988 4:77580774-77580796 AGGGGAGAGGAGGGCAGGAGAGG - Intronic
976258623 4:83124823-83124845 AGAGGAGAGGAGGGCAGGGGAGG + Intronic
977294106 4:95192499-95192521 GGAGGTGAGCAGGGGAGGAGAGG - Intronic
978334041 4:107646889-107646911 TGTGGAGGACAGGGCAAGAAGGG - Intronic
978603332 4:110451035-110451057 AGTGGTGAGCAGGCCAGGCGTGG - Intronic
978739273 4:112119099-112119121 AGAGGAGAGGAGGGGAGGAGAGG + Intergenic
979793458 4:124815127-124815149 AGACAAGAGCAGGGCAGGAGAGG + Intergenic
980701149 4:136432602-136432624 TTTGGAGGGCAGGGGAAGAGTGG + Intergenic
981080456 4:140634732-140634754 TTTGGTGAGCAGGGAAGCAGGGG - Intronic
981532413 4:145765206-145765228 CGGGGAGAGGAGGGCAGGAGTGG + Intronic
982217339 4:153093979-153094001 TGAGGAGAGCAGGGGAGGGTGGG - Intergenic
982242356 4:153313138-153313160 AGTGGGGAGCAGGAAAGGAGTGG - Intronic
984261987 4:177453431-177453453 AGGGGAGAGCAGGGGAGGGGAGG - Intergenic
984261996 4:177453451-177453473 AGGGGAGAGCAGGGGAGGGGAGG - Intergenic
984375104 4:178920640-178920662 AGAGGAGAGGAGGGGAGGAGAGG - Intergenic
984602390 4:181743638-181743660 TGTGGGCACCAGGGCAAGAGTGG + Intergenic
984741889 4:183173042-183173064 TGAGGAGAGGAGGGGAGGAGAGG - Intronic
984918530 4:184744106-184744128 AGACGTGAGCAGGGCAGGAGAGG + Intergenic
985017331 4:185650357-185650379 TTCGGTGAGCAGGGCAAGAGGGG + Intronic
985070413 4:186162303-186162325 TGTGGAGAGGAGGAGAGGAGAGG + Intronic
985147001 4:186903621-186903643 TAGGGAGAGCAGGGCGGGAAGGG - Intergenic
985211880 4:187604113-187604135 AGAGGAGAGGAGGGGAGGAGAGG - Intergenic
985779735 5:1864109-1864131 TGGTGTGAGCAGGGCAGAAGAGG - Intergenic
985780267 5:1867235-1867257 TGTGGAGAGAAGGGCATGTGTGG + Intergenic
985888984 5:2701110-2701132 AGTGGCGAGCAGGGCAGGGTGGG - Intergenic
985898256 5:2763543-2763565 TCTGGAGAGGAGGCCAGGAGAGG - Intergenic
986454233 5:7899566-7899588 AGTGGAGGGCAGGGAATGAGGGG + Intronic
986640159 5:9864119-9864141 TGAGGAAAGCAGAGCAGGACAGG - Intergenic
986746198 5:10747348-10747370 GGTGTTGAGCAGGGGAGGAGGGG + Intronic
986753173 5:10809047-10809069 TTTGGAAAGCAGGACTGGAGGGG - Intergenic
987037179 5:14030493-14030515 AGGAGAGAGCAGGGTAGGAGTGG - Intergenic
987150478 5:15034540-15034562 TGAGGTCAGCAGGGCTGGAGGGG + Intergenic
987748541 5:22008879-22008901 TGTGTAGAGAAGGGAAAGAGAGG - Intronic
988498458 5:31764479-31764501 TGTGTACAGGAGGGCAGGAGGGG - Intronic
988629596 5:32914713-32914735 AGAGATGAGCAGGGCAGGAGAGG + Intergenic
990445090 5:55886835-55886857 GGTGGAGATTGGGGCAGGAGAGG - Intronic
990449020 5:55918221-55918243 TGGTGAGATCAGGGCAGGCGAGG + Intronic
991034328 5:62112915-62112937 TGTGAAGATCAGGGCAGAGGAGG - Intergenic
991048165 5:62244851-62244873 GGAGAAGGGCAGGGCAGGAGAGG + Intergenic
992757925 5:79926496-79926518 TGTGGTTAGCGGGGCAGGAAGGG - Intergenic
992828630 5:80572775-80572797 TGGGGAGAGGAGGGCAGGGAGGG - Intergenic
993293212 5:86101925-86101947 AGTGGAGAGGAGAGCTGGAGAGG - Intergenic
993430662 5:87828784-87828806 GGTGGAGGGTAGGGGAGGAGTGG - Intergenic
993977530 5:94500453-94500475 GGTGAGGAGCAGGGCAGAAGGGG + Intronic
994507068 5:100656757-100656779 TGTGGAGGGAGAGGCAGGAGCGG + Intergenic
995294031 5:110497714-110497736 TGTGTAAAGCAGGCCAGGTGGGG - Intronic
995376205 5:111477058-111477080 TGTGGAGAGCAGGGCAGGGCAGG + Intronic
996010124 5:118472971-118472993 GGTGGAAAGGAAGGCAGGAGAGG + Intergenic
997201391 5:132011883-132011905 GTTGGAGAGCGGGGCCGGAGAGG - Intronic
997262496 5:132475470-132475492 TGGGGAGCACAGGGCAGGAGGGG + Intronic
997270352 5:132531627-132531649 GGTGGAGAGCAGATCTGGAGAGG - Intergenic
997367490 5:133335303-133335325 AGGGGAGAGCAGGGCAGACGAGG - Intronic
997569581 5:134915891-134915913 TGTAGAGCTCAGGCCAGGAGAGG - Intronic
997732050 5:136188827-136188849 TTTGGAGAGCAGGGCATGGCAGG - Intergenic
998375699 5:141689191-141689213 TGTGTGAAGCAGGGCAGGACAGG - Intergenic
998530774 5:142882468-142882490 GGTGGAGAACAAGGCAGGCGTGG + Intronic
999006297 5:147983660-147983682 GGTGGAGAACAGGGGAGGCGAGG - Intergenic
999054375 5:148558095-148558117 TGTGCAGGGCTGGGCAGGAAGGG - Intronic
999100836 5:149024747-149024769 GGTGGAGAGGAGGTCAGGGGTGG - Intronic
999321744 5:150619529-150619551 TCTGCAGAGCAGGGCGGGACAGG + Intronic
999376690 5:151091646-151091668 TCTGGAGGGGAGTGCAGGAGTGG - Intronic
1000105513 5:158055312-158055334 TGGGAAGGGCAGGGCTGGAGTGG - Intergenic
1000357527 5:160414894-160414916 TCTGTAGAGCAGGCCAGGGGTGG + Intronic
1001287646 5:170435476-170435498 TCTGGAGAGCGGGGCTGGACAGG + Intronic
1001312999 5:170624677-170624699 TGTGGAGGGGAGGAGAGGAGAGG + Intronic
1001529823 5:172454155-172454177 AGGGGAGAGCAGGGGAGGAGGGG + Intronic
1001622184 5:173096492-173096514 AGGGGAGAGGAGGGCAGGGGAGG - Intronic
1001881135 5:175245087-175245109 TGTGGGGAGGAGGGCATGGGTGG + Intergenic
1002048482 5:176555514-176555536 TGGGGGCAGCAGGGCTGGAGGGG - Intronic
1002278319 5:178116933-178116955 TGAGGAAAGCCGGGCAGGCGGGG + Intronic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002295334 5:178227590-178227612 TAAGGAGGGCAGGGTAGGAGAGG + Intronic
1002697149 5:181098665-181098687 TGGGGAGGGGAGGGCAGGGGAGG + Intergenic
1002697567 5:181100904-181100926 TGGGGAGGGGAGGGCAGGGGAGG - Intergenic
1002697643 5:181101044-181101066 TGGGGAGGGGAGGGCAGGGGAGG - Intergenic
1002968535 6:1991358-1991380 TGTGGGGAGTAGGCCAGGTGCGG - Intronic
1003200616 6:3956861-3956883 AATGAAGAGTAGGGCAGGAGTGG - Intergenic
1003242835 6:4359315-4359337 TGGGAAGAGCAGGGAGGGAGAGG - Intergenic
1003406983 6:5833968-5833990 GGTGGAGAACAGAGGAGGAGGGG + Intergenic
1003969009 6:11280532-11280554 GGTGCAGAGCAGGGGAGAAGAGG - Intronic
1003995648 6:11537655-11537677 CGGGGAGCGCAGGGGAGGAGGGG + Intergenic
1004234225 6:13860128-13860150 TGTGGAGGGAAAGGCAGGGGCGG + Intergenic
1004424755 6:15499747-15499769 TGTGGAGAACAGGGGAGTTGGGG - Intronic
1004429119 6:15528202-15528224 TGTGCAGAGCAGGTCAGGAATGG + Intronic
1004542157 6:16561376-16561398 TGTGGAGAGGTGGGTGGGAGAGG - Intronic
1005009377 6:21321593-21321615 TCAGGGGAGGAGGGCAGGAGAGG - Intergenic
1005332916 6:24766302-24766324 TGTGGAGGGAGAGGCAGGAGCGG - Intergenic
1005838564 6:29725173-29725195 TGTGGAGACCAGGCCTGCAGGGG + Exonic
1005861996 6:29908746-29908768 GGTTGAGAGCAGAGTAGGAGTGG - Intergenic
1005905936 6:30261346-30261368 TGTGGAGACCAGGCCTGCAGGGG + Intergenic
1005980067 6:30829851-30829873 AGGGATGAGCAGGGCAGGAGAGG - Intergenic
1006299445 6:33185830-33185852 TGTGGGGTGAAGGGCGGGAGAGG + Intronic
1006342810 6:33455921-33455943 TTTGGGGGGCAGTGCAGGAGGGG - Exonic
1006375799 6:33671083-33671105 CGTGGAGGGCAGGCCAGGACTGG - Intronic
1006438468 6:34039279-34039301 TTTGAAGAGCAGAGCACGAGGGG + Intronic
1006789895 6:36693103-36693125 GGTGGGGAGCAGGGCCGGTGAGG + Intergenic
1007087388 6:39158497-39158519 TGTCAAGAGCAGGGAAGCAGAGG + Intergenic
1007231016 6:40347856-40347878 TGTGGGGAGGAGGGGAGGAGGGG - Intergenic
1007293136 6:40802036-40802058 TGGGGTGGGCAGGGCAGGAAGGG - Intergenic
1007345707 6:41228235-41228257 TCTGCAGACCAGGGGAGGAGGGG - Intergenic
1007400939 6:41601872-41601894 TTTGGGGAGCAGGGGAGGGGAGG + Exonic
1007410068 6:41656475-41656497 TGAGGAAGGCAGGGCAGGTGTGG - Intergenic
1007567994 6:42867703-42867725 TTGGGACAGCAGGGCAGGATAGG - Exonic
1007902677 6:45424506-45424528 TGTGGAGAGCAGGGCAAGCAAGG + Intronic
1008320651 6:50108758-50108780 TGAGGAGAGCAGGGAAGGGAGGG + Intergenic
1008906164 6:56679897-56679919 TGTGGGTAGCAGGACAGAAGGGG - Intronic
1010198081 6:73259680-73259702 TGTGGAGAAGGGGCCAGGAGAGG - Intronic
1010218703 6:73428589-73428611 TCTGGGGGGCAGGGCAGGATTGG - Intronic
1010358798 6:74967983-74968005 GCTTGAGAGCAGGGCAGTAGAGG + Intergenic
1011047584 6:83102655-83102677 TGTGGAGAACAGGGTAGAAGAGG - Intronic
1011171784 6:84512903-84512925 TGTCAAGAGAGGGGCAGGAGTGG + Intergenic
1011632285 6:89339447-89339469 AGAGGAGAGGAGGGGAGGAGAGG + Intronic
1012516047 6:100060728-100060750 TGTGGAGTGCAGGACAGGTAGGG + Intergenic
1012530483 6:100229416-100229438 TGGGGAAAGCAGGGTTGGAGAGG + Intergenic
1013035282 6:106376487-106376509 TTTGGAGGAGAGGGCAGGAGTGG + Intergenic
1013345288 6:109254218-109254240 TGTGGAGACCAGAGGAAGAGGGG + Intergenic
1013428778 6:110037712-110037734 TCTGGGGAGGAGGGAAGGAGGGG + Intergenic
1014855503 6:126396278-126396300 TGTGGAAAGCAGGGTGGCAGGGG - Intergenic
1014887307 6:126797434-126797456 TGAGGAGAGCAAGGGAAGAGAGG + Intergenic
1015150269 6:130029811-130029833 AGAGGAGGGCAGGGCAGGGGAGG - Intronic
1015386852 6:132634615-132634637 TGTGGTGAGAAGGGCAGGCTTGG - Intergenic
1015922703 6:138281468-138281490 TGGGGACTGCAAGGCAGGAGAGG - Intronic
1016027270 6:139300096-139300118 TGTGATCAGCAGGGGAGGAGGGG - Intergenic
1016150142 6:140730413-140730435 TGTGGGGAGTAAGGCAGGATGGG + Intergenic
1016297432 6:142588518-142588540 TGTCAAGAGCAGGGCTGGGGGGG - Intergenic
1017813552 6:158001128-158001150 GGTGCAGAGGAGGGCGGGAGAGG - Intronic
1018380460 6:163254020-163254042 TGTAGAGCACAGGGCAGAAGCGG + Intronic
1018754792 6:166839666-166839688 GGTGGAAATCAGAGCAGGAGAGG + Intronic
1018992856 6:168687207-168687229 GGAGGAGAGCACAGCAGGAGAGG - Intergenic
1019309194 7:352052-352074 TGGGGAGAGCCGGGCAGGAGGGG - Intergenic
1019323317 7:425288-425310 TGGGGAGGGCAGGGCCGGAGCGG + Intergenic
1019496264 7:1341849-1341871 TGTGGAGGGCAGTGGAGGTGGGG + Intergenic
1019518413 7:1449803-1449825 TGGGGTGAGCAGGGCAGGACTGG + Intronic
1019577209 7:1743322-1743344 GGTGGGGAGGATGGCAGGAGAGG + Intronic
1019666067 7:2252833-2252855 TGAGGAGAGCAGGAGAGTAGGGG - Exonic
1019733169 7:2638427-2638449 TGTGGGGAGACGGGCAGGAGCGG + Intronic
1019919190 7:4152079-4152101 TGTGAAAGGCAGGGCTGGAGCGG + Intronic
1020139404 7:5604325-5604347 AGGGGAGAGCCGGGAAGGAGAGG + Intronic
1020261430 7:6532581-6532603 TGGGGAGGGCACGGCATGAGTGG - Intronic
1020447679 7:8286384-8286406 AGGGGAGAGGAGGGGAGGAGAGG - Intergenic
1020788210 7:12594366-12594388 TTTGGAAAGTAGAGCAGGAGTGG + Intronic
1021777438 7:24067555-24067577 TGTGGGAAGCAGGGCACCAGCGG - Intergenic
1022294630 7:29038622-29038644 TGAGGATACCAGGGCAGGGGTGG - Intronic
1022736373 7:33079953-33079975 AGACAAGAGCAGGGCAGGAGAGG - Intergenic
1022837596 7:34132318-34132340 TGGGGAGAGCAGGGCAGAACTGG - Intronic
1022837611 7:34132369-34132391 TGGGGAGAGCAGGGCAGAACTGG - Intronic
1022837626 7:34132420-34132442 TAGGGAGAGCAGGGCAGAACTGG - Intronic
1022906266 7:34860832-34860854 TGGGGAGAGTGGGGAAGGAGGGG - Intronic
1023113627 7:36838998-36839020 TCTGGAGAGGATGACAGGAGTGG + Intergenic
1023289403 7:38654448-38654470 TGGAGAGAGCTGGGGAGGAGTGG - Intergenic
1023754068 7:43399559-43399581 CATGGTGAGCAGGGCAGGACTGG + Intronic
1023910032 7:44547264-44547286 TGGGGAGGGGAGGGGAGGAGAGG + Intergenic
1024062301 7:45708297-45708319 TGGGGAGTGCAAGGCAAGAGGGG - Intronic
1024467263 7:49724681-49724703 TGGGGAAAGCAGGGATGGAGGGG - Intergenic
1024516770 7:50266094-50266116 GCTGGAGCACAGGGCAGGAGGGG + Intergenic
1024585369 7:50837209-50837231 AGTGGAGACCAGGGCAGGAAGGG - Intergenic
1024667985 7:51564923-51564945 TGTGGAGGGCAGATCCGGAGGGG - Intergenic
1024987498 7:55208252-55208274 TGTGATGGGCAGGTCAGGAGAGG + Exonic
1026245056 7:68612286-68612308 AGTGGAGGGGAGGGTAGGAGAGG - Intergenic
1026248558 7:68646027-68646049 TGTGGAGAACAGTGCATGATGGG - Intergenic
1026382955 7:69817682-69817704 CGTGGAGAGCTGGGCAGAGGTGG + Intronic
1026529418 7:71184402-71184424 TCAGGAGAGCAGAGCTGGAGAGG - Intronic
1026807649 7:73437968-73437990 TGGGAAGAGCAAGGCAGGCGGGG + Intergenic
1027198571 7:76048150-76048172 GGCGGAGAGCATGGCTGGAGCGG - Exonic
1027199876 7:76057203-76057225 TGGGGAAAGCAGGGTAGAAGGGG + Intronic
1027204903 7:76090112-76090134 TGTAGGGAGTTGGGCAGGAGCGG - Intergenic
1027261512 7:76468066-76468088 TGGAGAGAGGAGGGGAGGAGGGG + Intronic
1027312893 7:76966175-76966197 TGGAGAGAGGAGGGGAGGAGGGG + Intergenic
1027698538 7:81439370-81439392 GGAGGAGAGCAGGGCTGGGGTGG + Intergenic
1028620817 7:92826462-92826484 GGTGGAGAGTGGTGCAGGAGAGG + Intronic
1028959770 7:96735593-96735615 AGTGAAGAGGAGGGCAGGACAGG - Intergenic
1029550509 7:101234837-101234859 AGTGGGGAGCAGGGTGGGAGGGG - Intronic
1029572470 7:101379322-101379344 TGTGTCTACCAGGGCAGGAGTGG + Intronic
1029594272 7:101528516-101528538 AGGGGAGAGGAGGGGAGGAGAGG - Intronic
1030075116 7:105730095-105730117 TGGAAAAAGCAGGGCAGGAGAGG + Intronic
1030128146 7:106174482-106174504 TGTGGAAAGCTGGGCAAGAGAGG - Intergenic
1031476438 7:122228267-122228289 TGAAGAGAGCAAGACAGGAGAGG + Intergenic
1031638291 7:124129338-124129360 TGTGGGGAGGAGGGGAGGGGGGG - Intergenic
1031930090 7:127676260-127676282 GGAGGAGAGCAGGGAAGGAAGGG + Intronic
1031964130 7:128015184-128015206 TTGGGAAAGCAGGGCAGGAGAGG - Intronic
1031980622 7:128122118-128122140 TGTGCAGGGCAGGGCAGGTTAGG - Intergenic
1032069212 7:128793342-128793364 TGTGGTCAGCAGAGTAGGAGGGG + Intronic
1032076376 7:128838083-128838105 TGTGAAGAGCAGCGCAGGCAGGG - Intronic
1032128309 7:129210566-129210588 TGAGGCGGGCAGGGCAGGAGGGG - Intronic
1032286634 7:130542511-130542533 AGTGGGGGGCAGGGCAGGAAGGG + Intronic
1032468994 7:132164570-132164592 AGCAGAGAGGAGGGCAGGAGGGG - Intronic
1032477512 7:132222461-132222483 TGGGGGGAGGGGGGCAGGAGGGG - Intronic
1032479342 7:132234060-132234082 GGTGTGGAGCAGAGCAGGAGTGG + Intronic
1033028665 7:137803147-137803169 TTTGGAGAGAAGGGATGGAGGGG + Intronic
1033051520 7:138008690-138008712 CGGGGCTAGCAGGGCAGGAGAGG + Intronic
1033219083 7:139516133-139516155 TTTGGAGACCAAGGCAGGCGGGG + Intergenic
1033220674 7:139524574-139524596 TGGGGAGGGCAGGGCAGGGCAGG + Intronic
1033256855 7:139808705-139808727 TGGGGAGAGCAGTGATGGAGTGG - Intronic
1033285931 7:140040398-140040420 AGAGGGGAGCAGGGGAGGAGAGG + Intronic
1033586705 7:142779688-142779710 TCTGGAGGGCAGAGGAGGAGAGG - Intergenic
1033649298 7:143328746-143328768 TGTGAAGAGCAGGGCAGAAGGGG + Intronic
1034051042 7:147984776-147984798 TTTTGGGAGCAGGGGAGGAGAGG + Intronic
1034268793 7:149793481-149793503 TGTGGTGGGCAGAGCTGGAGGGG + Intergenic
1034417748 7:150974187-150974209 GCTGAAGCGCAGGGCAGGAGGGG + Intronic
1034467029 7:151235848-151235870 TGTGGAGGGCAGGGGGGCAGGGG - Intronic
1034564166 7:151900059-151900081 TCTGGAGTGGAGGGAAGGAGGGG - Intergenic
1034676569 7:152896468-152896490 AGTGGGGAGCACGTCAGGAGAGG - Intergenic
1034867001 7:154650342-154650364 AGTGGAGAGGAGGGCAGAGGAGG + Intronic
1034970760 7:155417908-155417930 AGTGGGGAGCAGGGCTGGGGAGG - Intergenic
1035050176 7:155994211-155994233 TGTGTACAGCAGAGGAGGAGGGG - Intergenic
1035716640 8:1760346-1760368 TGTGGGTGGCAGGGCGGGAGGGG + Intronic
1035828552 8:2669797-2669819 AGTGGAGATCAGGGCAGAAAGGG + Intergenic
1036659537 8:10699161-10699183 TGGGAAGTGCAGGGCAGTAGGGG - Intronic
1036684059 8:10897217-10897239 AGTGGGGAGAAGGTCAGGAGAGG + Exonic
1036793089 8:11736366-11736388 TGTGGAGACCAGACCAAGAGAGG + Intronic
1036961016 8:13244587-13244609 TGTGGAAAGGAGGCCAAGAGTGG - Intronic
1037223496 8:16554561-16554583 AGTGGAGGGGAGGGAAGGAGAGG + Intronic
1037438172 8:18886766-18886788 TGTGCAGTGCAGGGCAAAAGGGG - Intronic
1037485601 8:19343882-19343904 TGTGGAAGGCAGGGATGGAGTGG + Intronic
1037654302 8:20869869-20869891 TGTGGTCAGCAGGGTAGGCGAGG - Intergenic
1037815658 8:22110271-22110293 CGTGGAGAGCAGGGTGGGGGTGG + Intergenic
1038419490 8:27423327-27423349 GGTAGAGAGAAGGGAAGGAGAGG - Intronic
1038618248 8:29115772-29115794 TGGGGAGGGCAGGGCAGGACGGG - Intronic
1039404273 8:37299245-37299267 TGTGCAGAATAGGGCTGGAGGGG - Intergenic
1039440565 8:37592423-37592445 TTGGGAGATCAAGGCAGGAGGGG - Intergenic
1039465642 8:37783410-37783432 TGAGGGAAGCAGGGCAGGAGAGG + Intergenic
1039481654 8:37878242-37878264 TGTAAAGATCAGGGCAGGTGCGG + Intronic
1039504495 8:38042159-38042181 TGGGTAGGGCAGGGCAGGTGTGG - Intronic
1039822357 8:41145355-41145377 GGTGGGGAGATGGGCAGGAGAGG + Intergenic
1039856206 8:41416551-41416573 TATGGTCAGCAAGGCAGGAGTGG + Intergenic
1039963786 8:42269585-42269607 AGTGGAGGGGAGGGGAGGAGAGG + Intergenic
1039969453 8:42308838-42308860 TGGGGGGACCACGGCAGGAGGGG - Intronic
1039972417 8:42331435-42331457 TTTGGAGAGCAGGAGAGGACAGG - Exonic
1041091293 8:54303375-54303397 TCTGGAGAGCAGGAAAGGATTGG + Intergenic
1041218594 8:55626476-55626498 AGTGGAAAGCAGGGAAGGAGGGG + Intergenic
1041436502 8:57847909-57847931 TGTGGAGAGCAGAGCGGGGATGG + Intergenic
1041685282 8:60638994-60639016 AGTGGTGACCAGGGCAAGAGGGG + Intergenic
1042551592 8:69998985-69999007 TGTGTTCATCAGGGCAGGAGGGG - Intergenic
1043053895 8:75413282-75413304 AGAGGAGAGGAGGACAGGAGAGG + Intronic
1044997449 8:97850444-97850466 TGTGTAGAGCTGGAGAGGAGGGG + Intronic
1045326804 8:101123252-101123274 GGTGGAGGGGAGGACAGGAGAGG + Intergenic
1045362823 8:101448914-101448936 TGTGCAGATCTGGGTAGGAGAGG + Intergenic
1045528430 8:102961510-102961532 TGGGGAGAGCAGGGGAGGGGAGG - Intronic
1046028701 8:108756766-108756788 AGGGGAGGGGAGGGCAGGAGGGG + Intronic
1046856415 8:119037058-119037080 TGTGAAGAGCAGAGCTGAAGGGG + Intronic
1046929623 8:119829136-119829158 GGTAGAGAGCAGATCAGGAGGGG - Intronic
1047742105 8:127814846-127814868 TGTGGATACCAGGGGATGAGGGG - Intergenic
1047749004 8:127866102-127866124 TTTAAACAGCAGGGCAGGAGAGG - Intergenic
1047972486 8:130097310-130097332 CCTGGAGAACAGGGCAGGTGAGG - Intronic
1048366532 8:133743434-133743456 TGTGCAAAGCAGGGCAGGAGAGG + Intergenic
1048485544 8:134844257-134844279 TGTGTGGAGAAGTGCAGGAGGGG + Intergenic
1048529668 8:135235921-135235943 TCTGGAAAGCAGGGCGTGAGAGG - Intergenic
1048736715 8:137510229-137510251 AGTGGGAGGCAGGGCAGGAGAGG + Intergenic
1048831409 8:138481102-138481124 TGTTGAGAGCAAGGCAGGCATGG - Intronic
1048858046 8:138700578-138700600 TGGGGAGAGTAGGAGAGGAGGGG + Intronic
1048916971 8:139194489-139194511 AGTGTAGAGAAGGGCAGGAGAGG - Intergenic
1049040631 8:140110088-140110110 AGTGGAGAGTAGGGCCGCAGTGG + Intronic
1049207882 8:141371838-141371860 TGTGGAGATGAAGGCCGGAGAGG + Intergenic
1049241328 8:141538875-141538897 CGGGTAGGGCAGGGCAGGAGAGG - Intergenic
1049286301 8:141777096-141777118 AGTGGAGGGCAGAGCAGCAGAGG - Intergenic
1049312414 8:141940120-141940142 AGTGGAGAGGAGGGCAGCAGAGG + Intergenic
1049414517 8:142489135-142489157 TGGGCAGTGCAGGGCAGGTGGGG + Intronic
1049435817 8:142585755-142585777 TGTGGAGACGGGTGCAGGAGGGG - Intergenic
1049440426 8:142607150-142607172 AGTGGAGGGGAGGGGAGGAGAGG + Intergenic
1049450789 8:142660361-142660383 TGTGGAGATCAGGGTCGGGGAGG - Intronic
1049642117 8:143720499-143720521 CGTGGAGAGGAGGGCACCAGGGG + Intronic
1049698309 8:143994374-143994396 GGTGGAGGGCGGGGCAGGCGAGG - Intronic
1049742800 8:144249085-144249107 TGGGACGGGCAGGGCAGGAGTGG + Intronic
1049982525 9:917613-917635 AGTGGAAATCAGGGCAGTAGAGG + Intronic
1050423080 9:5487233-5487255 AGTGGAGAGCAGAGCAGGGAGGG + Intergenic
1050965248 9:11792851-11792873 TGTGGAGCTCAGGGCAAGTGGGG + Intergenic
1051840872 9:21396431-21396453 GGAGGAGAGCAGAGCAGGTGAGG - Intergenic
1052803654 9:32993093-32993115 TTTTGAGAGCAGGGCAAGAGAGG + Intronic
1053008492 9:34620271-34620293 TGCGGAGAACAGGACTGGAGCGG + Intronic
1053180279 9:35962416-35962438 TGGGGAGAGCTGGGCTGGGGCGG - Intergenic
1053434019 9:38063401-38063423 TGGGGGCAGCAGGGCAGGTGTGG - Intronic
1053710115 9:40798731-40798753 TGAAGAGTGCAGGGCAGGACAGG + Intergenic
1054420019 9:64919526-64919548 TGAAGAGTGCAGGGCAGGACAGG + Intergenic
1054577371 9:66874714-66874736 TTTGGAGAACAGGGTATGAGAGG - Intronic
1054768997 9:69067226-69067248 TGTGGGCAGCAGGCCGGGAGTGG - Intronic
1054958970 9:70945848-70945870 TGGGGAGAGAAGGGGAGAAGGGG + Intronic
1055057482 9:72037199-72037221 AGTGGAGACCAGGGCAAGAAAGG + Intergenic
1056554809 9:87679419-87679441 GTTAGGGAGCAGGGCAGGAGTGG + Intronic
1056682191 9:88729487-88729509 TGTGGAAAGCAAGGAAGGAATGG + Intergenic
1056771438 9:89480785-89480807 TGTGGAGGGAGAGGCAGGAGCGG - Intronic
1056905928 9:90647852-90647874 TCTGGGGAGGAGGGAAGGAGAGG - Intergenic
1056926633 9:90840030-90840052 TGAGGAGTGAAGGGCAGCAGTGG + Intronic
1057617449 9:96604666-96604688 TGCGGGGGGCGGGGCAGGAGGGG + Intronic
1057907678 9:98995002-98995024 TGAGGCGGGCAGGGCAGGTGAGG - Intronic
1057961073 9:99457781-99457803 AGGGGAGGGCAGGGCAGGGGAGG + Intergenic
1058101163 9:100919053-100919075 GGTTGAGAGGAGGGCTGGAGTGG - Intergenic
1058643219 9:107107169-107107191 TGGGGAGAGGAGGAGAGGAGTGG - Intergenic
1058803189 9:108564945-108564967 TGGGGAGATGAGGGCAGGAATGG + Intergenic
1058803941 9:108571880-108571902 AATGGAGAGGAGGCCAGGAGCGG + Intergenic
1058919559 9:109600130-109600152 GATGGAGAGCGAGGCAGGAGGGG - Intergenic
1059101614 9:111477400-111477422 TGTGGCAATCAGGGCTGGAGCGG - Intronic
1059958508 9:119542806-119542828 TGGGGAGGGAAGGGCAAGAGAGG + Intergenic
1060256550 9:122035881-122035903 TCAGGTGAGCAGGGCAGGGGAGG - Intronic
1060657367 9:125381123-125381145 TCTGGAGAGCAGGCCAGCTGGGG + Intergenic
1060827824 9:126696522-126696544 TGCGGAGAGCAGGGCGGGGGTGG - Exonic
1060871738 9:127048143-127048165 TGTGGTGAGGAGGGGAGGACTGG - Intronic
1060937144 9:127522263-127522285 TCTGGAGAGGCGAGCAGGAGGGG + Intronic
1060946771 9:127574358-127574380 TGTGGTGGGCAGGGGAGGGGCGG - Intronic
1061246087 9:129401854-129401876 TGTGAAGGGCAGGGCTGGGGAGG - Intergenic
1061258380 9:129465972-129465994 TGTGGAGGGCAGAGAAGGAGGGG - Intergenic
1061307430 9:129740157-129740179 GGGGGAGAGTATGGCAGGAGTGG - Intronic
1061371648 9:130200855-130200877 TGGGGAGGGGAGGGCTGGAGGGG + Intronic
1061450242 9:130663746-130663768 CGGGGAGTGCAGGGCCGGAGAGG + Intergenic
1061507535 9:131039811-131039833 TGTGGGGAGCGGGGTGGGAGAGG + Intronic
1061557095 9:131377601-131377623 TGTGGAGCCCAGGGCTGGGGTGG - Intergenic
1061947153 9:133914753-133914775 AGAGGAGAGGAGGGGAGGAGGGG + Intronic
1062051702 9:134450625-134450647 TTTGGACAGCATGGCAGGTGGGG + Intergenic
1062283931 9:135764789-135764811 TGTGGGGACCAAGGGAGGAGGGG - Intronic
1062324949 9:136008324-136008346 AGAGGAAGGCAGGGCAGGAGAGG + Exonic
1203345487 Un_KI270442v1:31112-31134 AGTGGAGAGGTGGGGAGGAGTGG + Intergenic
1185511421 X:667788-667810 TGGGGAGGGCAGGGGAGGGGAGG - Intergenic
1185511444 X:667832-667854 TGGGGAGGGCAGGGGAGGGGAGG - Intergenic
1185511589 X:668144-668166 GGAGGAGAGTAGGGGAGGAGGGG - Intergenic
1185573816 X:1154552-1154574 AGGGGAGAGGAGGGGAGGAGAGG - Intergenic
1185645261 X:1611057-1611079 TGTGGACAGAAGGGGAGGGGAGG - Intergenic
1185647970 X:1628582-1628604 AGGGGAGAGCAGGGGAGGAGAGG - Intronic
1186667115 X:11728604-11728626 TTTGGAGACGAGGGTAGGAGAGG - Intergenic
1186776241 X:12867518-12867540 TGAAGAGAGCAGAGCATGAGAGG - Exonic
1187232409 X:17435377-17435399 GGTGGGGAGCAGGGCAAAAGGGG + Intronic
1187509981 X:19908960-19908982 TGGTATGAGCAGGGCAGGAGAGG - Intergenic
1188005851 X:25015429-25015451 TTTGGAGAGGAAGGAAGGAGAGG - Intronic
1188989737 X:36803046-36803068 AGAGATGAGCAGGGCAGGAGAGG + Intergenic
1189725939 X:43968473-43968495 TGTGTGCAGCAGGGCAGGGGAGG - Intronic
1189743100 X:44141989-44142011 TAGAGAGAGGAGGGCAGGAGAGG + Intergenic
1189848549 X:45157854-45157876 TGCGAAGGGCAGCGCAGGAGCGG + Exonic
1190247935 X:48702772-48702794 TGTGGAGAGCAGGAAGGGTGAGG - Intronic
1190342291 X:49307198-49307220 TGTGGGAAGCAGGGTAAGAGAGG - Intronic
1190365710 X:49692422-49692444 TGTGGGCAGCAGGGTAAGAGAGG + Intronic
1190598166 X:52066700-52066722 AGAGGAGAGGAGGGGAGGAGAGG + Intronic
1190610658 X:52187373-52187395 AGAGGAGAGGAGGGGAGGAGAGG - Intronic
1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG + Intergenic
1191618678 X:63192937-63192959 TGTGGAGTGAGAGGCAGGAGCGG - Intergenic
1191619512 X:63201261-63201283 TCTGGAGAGCAGGCCTTGAGTGG - Intergenic
1192317699 X:70065711-70065733 GGTGGAGAGAAGGGCAGGAAAGG + Intergenic
1194756825 X:97747617-97747639 TGAGCGGGGCAGGGCAGGAGAGG - Intergenic
1195112245 X:101659645-101659667 TCTGGAAAGCCGGCCAGGAGTGG + Intronic
1195993209 X:110703956-110703978 TGTAGAGAGAAAGGGAGGAGAGG + Intronic
1196129719 X:112142258-112142280 TGAGGAGAGCAGAGAAGGATAGG + Intergenic
1197835188 X:130686637-130686659 TGGGAAGAGCAGGGTAGGAAAGG - Intronic
1197991936 X:132328230-132328252 TTTGGGGGGAAGGGCAGGAGTGG - Intergenic
1198170980 X:134104927-134104949 TTGGGAGAGGAGGGCAGCAGAGG + Intergenic
1198641517 X:138761112-138761134 TGCTGAGATCAGGGCCGGAGAGG - Intronic
1198963768 X:142207450-142207472 GGTGGAGAGGAGGGTAGGAAAGG - Intergenic
1199018682 X:142848973-142848995 GGTGGAGAACAGGGGAGGGGTGG + Intergenic
1199018691 X:142848991-142849013 GGTGGGGAGCAGGGGAGGGGTGG + Intergenic
1199426164 X:147703276-147703298 TGTGGAAAAAAGGGCATGAGAGG - Intergenic
1199492073 X:148411236-148411258 TGTGGAGAATAGGGCAGTTGGGG - Intergenic
1199493151 X:148423274-148423296 AGGGGAGAGGAGGGGAGGAGAGG + Intergenic
1199675023 X:150181538-150181560 TGTGGAGAGTGGGCCTGGAGAGG - Intergenic
1199943748 X:152649375-152649397 TGTGGTGATCAGGGAAGCAGAGG + Intronic
1200144665 X:153920517-153920539 GGTGCAGGGGAGGGCAGGAGTGG - Intronic
1200164279 X:154025420-154025442 CGAGGCGAGCAGAGCAGGAGTGG + Intronic
1200179125 X:154139778-154139800 TGTGGAGAGCCCGGCAGCTGGGG + Intergenic
1200214975 X:154364220-154364242 TGTTGGGGGCAGGGCAGGTGTGG - Intronic
1200251578 X:154556956-154556978 GGTGGAGAGAAGTGCTGGAGAGG + Intronic
1200266189 X:154647460-154647482 GGTGGAGAGAAGTGCTGGAGAGG - Intergenic
1201941553 Y:19466018-19466040 TGTGGAGAGCAGGCAGGAAGTGG - Intergenic
1202090476 Y:21183414-21183436 TGTGGAGGGAAAGGCATGAGTGG + Intergenic
1202099807 Y:21295356-21295378 TGAGCACAGCAGGGCAGGAGGGG - Intergenic