ID: 1163549806

View in Genome Browser
Species Human (GRCh38)
Location 19:17959758-17959780
Sequence CCCGAGTGAAAGAGTTCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163549799_1163549806 10 Left 1163549799 19:17959725-17959747 CCCTCTAGGTGGGGGGCTCTGGG 0: 1
1: 0
2: 2
3: 19
4: 224
Right 1163549806 19:17959758-17959780 CCCGAGTGAAAGAGTTCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 87
1163549801_1163549806 9 Left 1163549801 19:17959726-17959748 CCTCTAGGTGGGGGGCTCTGGGG 0: 1
1: 0
2: 2
3: 18
4: 241
Right 1163549806 19:17959758-17959780 CCCGAGTGAAAGAGTTCAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163549806 Original CRISPR CCCGAGTGAAAGAGTTCAAG AGG Intronic
901672487 1:10864089-10864111 CCCGACTGAAAGAGATAAAGCGG - Intergenic
902684270 1:18065738-18065760 CCTGAGTCAAAGAATACAAGTGG + Intergenic
917312632 1:173692806-173692828 CCTGAGAGAAAGAGCTCAGGTGG - Intergenic
917462606 1:175245298-175245320 CCCAAGTGGAAGAGTTGAACTGG - Intergenic
919673634 1:200360442-200360464 CACCAGTGAAGGAGTTCAAGTGG - Intergenic
921270405 1:213463757-213463779 CCAGAGTGATTGAATTCAAGTGG - Intergenic
1063116135 10:3073318-3073340 CCACAGTGAAAGTGTTCAGGAGG + Intronic
1063449393 10:6141214-6141236 CCCGATTGCAAGGGTTCATGAGG - Intergenic
1068878699 10:62026071-62026093 CCCGACTGAAAGAGTGAAAGAGG - Intronic
1069540804 10:69292546-69292568 CCAGAGTGACAGAGCACAAGGGG - Intronic
1071026215 10:81117055-81117077 CCTGAGATAAAGAGTTCAGGAGG + Intergenic
1076071928 10:127497131-127497153 CCCAAGTGCAAGAATGCAAGTGG + Intergenic
1079400275 11:20101291-20101313 GCCAAGTGAAAGAGGTCCAGAGG + Intronic
1083583619 11:63840344-63840366 CCCGAGGGGAAGAGAACAAGAGG - Intronic
1093072042 12:14715760-14715782 CCCGCCTGAAAGAGTTTAAAAGG - Intergenic
1093148626 12:15596254-15596276 CCGAAGTGAAAGAGTCCAAAAGG - Exonic
1094708574 12:32938764-32938786 CCTGAGTTAAAGAATTCAGGTGG + Intergenic
1100796046 12:98182850-98182872 GCCCAGTAAAAGAGTTTAAGAGG - Intergenic
1100878944 12:98995006-98995028 TCTGAGTGAATGAGTTAAAGAGG + Intronic
1108921219 13:55676678-55676700 GCTGAGTGTGAGAGTTCAAGAGG + Intergenic
1113160478 13:107374788-107374810 AGAGAGTGAGAGAGTTCAAGAGG - Intronic
1117907083 14:60601401-60601423 CCATAGTGATAGAGTCCAAGGGG + Intergenic
1120269889 14:82297959-82297981 CCAGAGTGAAAGAGTTGCAAAGG + Intergenic
1124384420 15:29194803-29194825 CATGAGTGAAGGCGTTCAAGGGG + Intronic
1125613029 15:40985362-40985384 ACCGAGTGAAAGAGCGCAAGCGG - Exonic
1131675444 15:94666357-94666379 CCAGAGTGAAAGACCTCAAAAGG + Intergenic
1136021605 16:27444012-27444034 CCCCAGTGGAAGACTTCCAGAGG + Intronic
1136478059 16:30525539-30525561 CCTGAGTGAAGGAGTCCAGGGGG + Exonic
1139064986 16:63301624-63301646 CAAGAGTGAAAGATTCCAAGTGG - Intergenic
1139233061 16:65305694-65305716 CCCAAGGGAAAGACTTAAAGTGG + Intergenic
1143778079 17:9212592-9212614 CCAGGGTGAAAGAGTTTAAGGGG - Intronic
1148382590 17:47210450-47210472 CCAGAGTGGAAAAGGTCAAGTGG + Intronic
1154962085 18:21319309-21319331 ACCGAAAGAAAGAGTTAAAGTGG - Intronic
1157309270 18:46539824-46539846 ACCCAGAGAAACAGTTCAAGTGG + Intronic
1157651119 18:49332401-49332423 CTGGAGTTCAAGAGTTCAAGTGG - Intronic
1158788229 18:60741122-60741144 CCCCAGTGCAATAGTTTAAGAGG - Intergenic
1160237359 18:77096961-77096983 CCAAAGTGAAAGAATTCAAATGG + Intronic
1160291977 18:77603183-77603205 CCCTAGTGAAGGGATTCAAGAGG + Intergenic
1162452882 19:10765364-10765386 GCCGAGTGAACGAGCTCAAAGGG + Intronic
1163549806 19:17959758-17959780 CCCGAGTGAAAGAGTTCAAGAGG + Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1167768573 19:51500085-51500107 CCCAAGTGGAAAAGTGCAAGAGG - Exonic
927890397 2:26744456-26744478 CCGGAGTGAAAGTGACCAAGTGG - Intergenic
932513911 2:72325431-72325453 CCAGAATGAATGAGTTAAAGAGG - Intronic
933771690 2:85748693-85748715 TCCGAGCAAAAGAATTCAAGCGG + Intergenic
935506306 2:103908389-103908411 ACCGAGTGAAAGAAGTCAATTGG - Intergenic
940354931 2:152730251-152730273 CTCAAGTGAAAAAGTTCAACAGG + Intronic
948123820 2:235550306-235550328 CCCCAGAGAAAGAGTGCCAGAGG - Intronic
948505048 2:238422776-238422798 CCCGAGTGACAGAGACCAACTGG + Intergenic
1174529712 20:51201275-51201297 CCCGATAGAAAGAGCCCAAGTGG - Intergenic
1174711989 20:52716379-52716401 TCAGAGAGAAAGAGATCAAGAGG - Intergenic
1176546333 21:8202383-8202405 CCCGAGCGGAAGAGTCCACGCGG - Intergenic
1176554240 21:8246775-8246797 CCCGAGCGGAAGAGTCCACGCGG - Intergenic
1176565284 21:8385430-8385452 CCCGAGCGGAAGAGTCCACGCGG - Intergenic
1176573162 21:8429799-8429821 CCCGAGCGGAAGAGTCCACGCGG - Intergenic
1177685611 21:24433990-24434012 TCTGATTGAAAGTGTTCAAGAGG - Intergenic
1181036127 22:20170502-20170524 CCCCAGTGAGTGAGTGCAAGAGG + Intergenic
1181795854 22:25309907-25309929 CCTGAGGGAAAGAGTTAAAGAGG + Intergenic
1181836384 22:25613436-25613458 CCTGAGGGAAAGAGTTAAAGAGG + Intronic
1203251205 22_KI270733v1_random:118621-118643 CCCGAGCGGAAGAGTCCACGCGG - Intergenic
1203259246 22_KI270733v1_random:163815-163837 CCCGAGCGGAAGAGTCCACGCGG - Intergenic
950610057 3:14120791-14120813 CCCAAGTGTAAGAATTAAAGAGG + Intronic
951208134 3:19946400-19946422 CTCGAGTGTAAGAATTCAATGGG + Intronic
954225120 3:49176273-49176295 CCGGAGCGCAGGAGTTCAAGTGG + Exonic
957783681 3:84851452-84851474 CCCAAGTGAAACAGTTCTTGGGG - Intergenic
963849975 3:150201410-150201432 CCAGAGAGAAAGAGTTCCAAAGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
975026105 4:69550494-69550516 CCTAGGTGAAAGAGTTCATGAGG + Intergenic
977769958 4:100846518-100846540 CCAGGGTGACAGAGTGCAAGTGG - Intronic
980462859 4:133139411-133139433 CCAGAATGCAAGAGTTTAAGTGG - Intergenic
990120285 5:52442858-52442880 CCTGAGAGAAAGAATTCAGGGGG + Intergenic
991121031 5:63014077-63014099 CCAGCATGAAAGAGTACAAGCGG - Intergenic
992746312 5:79824617-79824639 TCCAAGTGAGAGAGTTCAGGAGG + Intergenic
996615334 5:125434787-125434809 ACCGTGTGAATGATTTCAAGAGG + Intergenic
998790424 5:145760620-145760642 CCGTAGTGATAGAATTCAAGTGG - Intronic
1006959138 6:37909494-37909516 CCTGAGGTAAGGAGTTCAAGAGG - Intronic
1014613117 6:123568561-123568583 GCAGAGTGCAAGAGTTAAAGAGG - Intronic
1017778074 6:157695193-157695215 CCCCAGTGAAAGAGAACAGGAGG + Intergenic
1020000319 7:4751895-4751917 CCCCAGAGAATGATTTCAAGTGG - Intronic
1023196830 7:37649982-37650004 CCTGAGTCCAGGAGTTCAAGAGG - Intergenic
1028986702 7:97015226-97015248 CCAGAGTCAAAGAGCTCTAGGGG + Intergenic
1033286912 7:140049344-140049366 CCTGCTTGAGAGAGTTCAAGAGG - Intronic
1033959508 7:146896324-146896346 CCCAAGTAAAAGAGTTGAAGAGG - Intronic
1037965346 8:23129690-23129712 CCAGAGTCACAGAGTTGAAGAGG - Intergenic
1041233173 8:55773351-55773373 CCCGTGTGAAAGAAGCCAAGCGG + Exonic
1046773980 8:118144388-118144410 CCCCACTGAGAGAGTTCATGGGG + Intergenic
1047096499 8:121631797-121631819 CAAGAGTGAAAAATTTCAAGGGG + Intronic
1050946684 9:11530045-11530067 ACCCAGTGAAAGAGTTTGAGGGG - Intergenic
1058445083 9:105047978-105048000 CAGAAGTGAACGAGTTCAAGGGG - Intergenic
1203467610 Un_GL000220v1:101888-101910 CCCGAGCGGAAGAGTCCACGCGG - Intergenic
1203475435 Un_GL000220v1:145858-145880 CCCGAGCGGAAGAGTCCACGCGG - Intergenic
1187225588 X:17373346-17373368 CAGGAGAGAAAGGGTTCAAGGGG - Intergenic
1188902490 X:35751046-35751068 CCAGAGTGGCAGAGATCAAGTGG - Intergenic
1190721899 X:53155701-53155723 CCCCAATGTAAGAGTTAAAGAGG + Intergenic
1192254067 X:69440296-69440318 CACAACTGAAAGAATTCAAGAGG - Intergenic
1201981393 Y:19913863-19913885 CCCGTCTTAAAGAGTTCAAAAGG - Intergenic