ID: 1163550645

View in Genome Browser
Species Human (GRCh38)
Location 19:17964799-17964821
Sequence GGGCAGTCCCCGATCCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163550636_1163550645 21 Left 1163550636 19:17964755-17964777 CCGTTGATCACCAGATTGATTGT No data
Right 1163550645 19:17964799-17964821 GGGCAGTCCCCGATCCCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1163550640_1163550645 -2 Left 1163550640 19:17964778-17964800 CCAAGTTCCACTTCTTGATGGGG No data
Right 1163550645 19:17964799-17964821 GGGCAGTCCCCGATCCCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1163550637_1163550645 11 Left 1163550637 19:17964765-17964787 CCAGATTGATTGTCCAAGTTCCA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1163550645 19:17964799-17964821 GGGCAGTCCCCGATCCCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1163550643_1163550645 -9 Left 1163550643 19:17964785-17964807 CCACTTCTTGATGGGGGCAGTCC 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1163550645 19:17964799-17964821 GGGCAGTCCCCGATCCCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163550645 Original CRISPR GGGCAGTCCCCGATCCCTCA GGG Intronic
901720071 1:11189971-11189993 AGGCACTCCACGCTCCCTCAGGG - Intronic
902782206 1:18712023-18712045 AGGCAGCCCCCAATCCCCCAGGG + Intronic
903968830 1:27106124-27106146 GGGCTGTCCCCAGTCCCTCCTGG + Intronic
904112067 1:28133862-28133884 GGCCACTCCCAGATCCCTCTTGG + Intergenic
904813712 1:33180782-33180804 GGTCTGTCTCAGATCCCTCAGGG + Intronic
907430893 1:54410620-54410642 TGGAGGCCCCCGATCCCTCAGGG - Intronic
915468985 1:156114616-156114638 GGGCAGTCCCAGATCCATTGGGG - Intronic
915807689 1:158871611-158871633 GGGGAGCCCCCAATCCCCCAGGG - Intergenic
916139181 1:161678801-161678823 GGGCACTCACCAAACCCTCAAGG - Intergenic
916742919 1:167662008-167662030 GGGCACTCCTCACTCCCTCAGGG - Intronic
917475545 1:175366112-175366134 TGACAGTCCCCGAGACCTCATGG - Exonic
920790621 1:209086706-209086728 GGGCAGCCTCCCATCTCTCAAGG - Intergenic
1064899209 10:20275481-20275503 GTGCGCTCCCCGAGCCCTCATGG - Intronic
1070322902 10:75367829-75367851 TGGCAGTCCCCGAACCCTGTAGG - Intergenic
1073131355 10:101191049-101191071 CTGCACTCCCCGATCCCTCCAGG + Intergenic
1073577726 10:104640109-104640131 GGCAAGTCCCCGATCCCACCGGG + Intergenic
1075515571 10:123105422-123105444 GAGCAGTACCCGCTACCTCATGG - Intergenic
1081336843 11:41876819-41876841 AGACAGTCCTCCATCCCTCAGGG - Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1090230571 11:125100191-125100213 GGGCAGTCCCAGAGAGCTCATGG - Intronic
1090259174 11:125306333-125306355 GGGCAGCCCCCCACCCCCCAGGG + Intronic
1090832897 11:130431349-130431371 CCGCAGTCCCCGCTCCCTCCTGG + Intergenic
1091974147 12:4811156-4811178 GAGCAGCCCCAGCTCCCTCATGG - Exonic
1092002836 12:5045436-5045458 GAGCAGCCCCAGCTCCCTCATGG - Exonic
1093545110 12:20336811-20336833 GGGGAGTGCACCATCCCTCATGG + Intergenic
1096155035 12:49336942-49336964 GAGCAGTCCCCTCTCCATCAGGG - Exonic
1096522325 12:52191413-52191435 GGGAAGTCCCTGATCCATCCTGG - Intronic
1103676683 12:122661352-122661374 GGGCAGTCCCAGCAACCTCAGGG - Intergenic
1113905399 13:113817235-113817257 GGGCTGTCCCCCCTCCCTCCAGG + Intergenic
1121052946 14:90831210-90831232 GGGCTGTCGCCGTTCCCCCATGG + Intergenic
1128576006 15:68775641-68775663 GGGCTGGCCCCCATCCCTCTGGG - Intergenic
1132201755 15:99959791-99959813 GGGCAGCCCCCGAGTCCCCAGGG + Intergenic
1132630323 16:914209-914231 GGGCAGTCCCTGACCCCTCCTGG + Intronic
1132872829 16:2123316-2123338 GTGCAGTCCCCCAGCCCCCAGGG + Intronic
1134551917 16:15142495-15142517 GTGCAGTCCCCCAGCCCCCAGGG + Intergenic
1138419969 16:56892718-56892740 GGGCAGTCCCAGAGCCCTCTGGG - Intronic
1142364001 16:89640226-89640248 GGGCAGTCCCCTCACCCCCAGGG - Intergenic
1142468488 17:148871-148893 GGGGAGTCCTCGGTTCCTCATGG - Intronic
1146134783 17:30309792-30309814 GGCCAGTCCTAGTTCCCTCATGG - Intergenic
1146536524 17:33657389-33657411 GGCCAGTCCCAGCTGCCTCATGG - Intronic
1149557435 17:57584183-57584205 GAGCAGTCTCCGCTCCCTCCTGG + Intronic
1152759091 17:82098901-82098923 GGGCGGTCCCGGATGCCTCGCGG + Intergenic
1161981407 19:7632298-7632320 GGGCAGGCCCTGTTCCCTCCTGG + Intronic
1163550645 19:17964799-17964821 GGGCAGTCCCCGATCCCTCAGGG + Intronic
1166720756 19:44994549-44994571 TGGCAGTCTCCCATCCCTCAGGG + Intergenic
1167251144 19:48398945-48398967 GGACAGTCCCCGCCCCCTCTAGG - Intronic
928607116 2:32953282-32953304 AGGCTGTCCCCCATCCCTCTTGG + Intronic
936467202 2:112764345-112764367 GCGCAGGCCCAGATACCTCACGG - Intronic
936865482 2:117072071-117072093 TGGCAGTCCTCGCTCCCTCTGGG - Intergenic
937477737 2:122229922-122229944 AGGCTGACCCCCATCCCTCAAGG - Intergenic
938956889 2:136307238-136307260 GGGCACTCCCCAATTCCCCAAGG - Intergenic
945212428 2:207397594-207397616 GGGCAGTCCAGGTTCTCTCAAGG - Intergenic
948149500 2:235733667-235733689 GGGCAGGCCACGGTCTCTCATGG - Intronic
948891769 2:240910233-240910255 GGGCACACCCCCACCCCTCAAGG - Intergenic
1174408246 20:50316993-50317015 GGACAGACCCAAATCCCTCATGG - Intergenic
1176227746 20:64011643-64011665 GGGCATGCCCAGGTCCCTCAGGG - Intronic
1176421612 21:6520503-6520525 GGGCAGTTTCTGATGCCTCATGG - Intergenic
1178914807 21:36700178-36700200 AGGCAGTCCCCCAGCCCGCACGG + Intronic
1179697102 21:43128819-43128841 GGGCAGTTTCTGATGCCTCATGG - Intergenic
1179952021 21:44713487-44713509 GGGGAGTCCCCATCCCCTCAGGG - Intergenic
1180073150 21:45448780-45448802 GGGCAGTCCCAGAGCCGTCAGGG + Intronic
1180948449 22:19709484-19709506 GCGCCGTCCCAGATCCTTCAGGG + Intergenic
1182524791 22:30908287-30908309 GGCCAGCCCCAGATCCCACAGGG - Intergenic
1184550801 22:45203275-45203297 GGGCAGCCCCCGCTCCTTGAGGG - Intronic
1185319919 22:50195960-50195982 GGGCAGTCCCCGGTCCAGCCAGG + Intronic
950483231 3:13257539-13257561 GTGCAGTCCACGAAGCCTCAGGG + Intergenic
955222843 3:57037467-57037489 AGGCAGGCCCTGATCCCTCATGG - Intronic
958732278 3:97972314-97972336 GGGTAGTGCCCGATCCCGCGGGG - Exonic
961305933 3:125959153-125959175 GGGCACTCCCAGGTCCCTCCTGG + Intergenic
997303389 5:132822691-132822713 GGGTCCTCCCCAATCCCTCAAGG + Exonic
998483750 5:142484407-142484429 GGGCAGTTCCCTACTCCTCAGGG + Intergenic
1000411043 5:160935251-160935273 GGGCATTCCCCCATTCCTGATGG - Intergenic
1002807759 6:593773-593795 GGCCAGACCTCAATCCCTCAGGG + Intronic
1006255476 6:32829222-32829244 GGGCAGCCCCAGTTCCCTCCTGG - Intronic
1007249970 6:40488808-40488830 GTGCATTTCCCTATCCCTCAGGG + Intronic
1017085853 6:150712142-150712164 ATGTTGTCCCCGATCCCTCAGGG - Intronic
1017984419 6:159430780-159430802 GGGCAGTGCCTGCTTCCTCATGG - Intergenic
1018886182 6:167940123-167940145 GCCCAGTCCCAGATGCCTCATGG - Intronic
1019102382 6:169641620-169641642 GGGCAGTCCCCGCTCCGAGAAGG + Intronic
1019431186 7:1000613-1000635 GAGGCGTCCCCGATCTCTCAGGG - Intronic
1019738413 7:2661432-2661454 GGGCAGCCCCCGAACTCTCCAGG - Intronic
1029250457 7:99232703-99232725 GGGCACTCCTGGGTCCCTCAGGG - Intergenic
1035644098 8:1205285-1205307 GGGCTATCCCCGACCCCTCCTGG - Intergenic
1040890125 8:52308739-52308761 GGGCAACCCCCCATCCCACAGGG + Intronic
1045489120 8:102655848-102655870 GGGCAGTCGCCGATCACGCGTGG - Exonic
1049673036 8:143878138-143878160 GCGCCGGCCCCGAGCCCTCACGG - Intronic
1049786559 8:144453771-144453793 GGGCAGTCGCTGGTCCCTAAGGG - Intronic
1053217978 9:36288647-36288669 AGGCAGTCCTCGCTTCCTCAGGG - Intronic
1061517986 9:131100671-131100693 TGGCATTCCCCGAGCCCTGATGG + Intronic
1062343339 9:136103537-136103559 GGGCTGCCCCCCAGCCCTCAGGG - Intergenic
1062657458 9:137611702-137611724 GCCCAGTCCCCCATCCCTGAGGG - Intronic
1187987412 X:24829273-24829295 GAGCAGTTGCAGATCCCTCAAGG - Intronic
1190626752 X:52344422-52344444 GGGCATTGTCCGATCCCTCGAGG + Intergenic
1190701255 X:52991407-52991429 GGGCATTGTCCGATCCCTCGAGG - Intronic
1191714042 X:64181880-64181902 TGGGAGTCCCCACTCCCTCAAGG - Intergenic
1194766971 X:97852892-97852914 GGGAAATGCCCGGTCCCTCAGGG - Intergenic
1195700454 X:107701582-107701604 GGACACTCCCCCAACCCTCAGGG + Intergenic