ID: 1163551890

View in Genome Browser
Species Human (GRCh38)
Location 19:17969912-17969934
Sequence CCAGCGGATGTTCAGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163551880_1163551890 -5 Left 1163551880 19:17969894-17969916 CCCAGCCCCACCTGGTAGCCAGC 0: 1
1: 0
2: 2
3: 26
4: 262
Right 1163551890 19:17969912-17969934 CCAGCGGATGTTCAGGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1163551883_1163551890 -10 Left 1163551883 19:17969899-17969921 CCCCACCTGGTAGCCAGCGGATG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1163551890 19:17969912-17969934 CCAGCGGATGTTCAGGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1163551877_1163551890 9 Left 1163551877 19:17969880-17969902 CCCTAGTGCAAGCTCCCAGCCCC 0: 1
1: 0
2: 0
3: 18
4: 207
Right 1163551890 19:17969912-17969934 CCAGCGGATGTTCAGGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1163551878_1163551890 8 Left 1163551878 19:17969881-17969903 CCTAGTGCAAGCTCCCAGCCCCA 0: 1
1: 0
2: 2
3: 33
4: 294
Right 1163551890 19:17969912-17969934 CCAGCGGATGTTCAGGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1163551881_1163551890 -6 Left 1163551881 19:17969895-17969917 CCAGCCCCACCTGGTAGCCAGCG 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1163551890 19:17969912-17969934 CCAGCGGATGTTCAGGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1163551876_1163551890 19 Left 1163551876 19:17969870-17969892 CCTGTGTGCACCCTAGTGCAAGC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1163551890 19:17969912-17969934 CCAGCGGATGTTCAGGCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163551890 Original CRISPR CCAGCGGATGTTCAGGCAGT GGG Intronic
900738672 1:4316995-4317017 CCAGCATATGTTTAGGCAGATGG + Intergenic
901682248 1:10920038-10920060 CCAGGGGATGATGAGGCAGTGGG + Intergenic
906247737 1:44289027-44289049 CCAGATGATGTTTGGGCAGTTGG - Intronic
907400630 1:54222900-54222922 CCAGGGGTTGTTCTGGCACTAGG - Intronic
908752867 1:67441508-67441530 CCATCTGATTTTCAGGCTGTTGG - Intergenic
912633282 1:111267707-111267729 CCAGGGGCTCTTCAGTCAGTGGG + Intergenic
918298059 1:183176377-183176399 CCAGTGGATGTTTTGGGAGTGGG - Intergenic
919009768 1:191945158-191945180 CCAGTGGAGGTTCAGGCAAGGGG + Intergenic
920505300 1:206511452-206511474 CCAGGGGATGGTCTGGCACTTGG + Intronic
1070877122 10:79825532-79825554 CCAGCGGAGGTTAAGGAAGGAGG + Intergenic
1071482724 10:86077394-86077416 GCAGGGTGTGTTCAGGCAGTGGG - Intronic
1071643617 10:87341576-87341598 CCAGCGGAGGTTAAGGAAGGAGG + Intergenic
1074039694 10:109776122-109776144 CCAGTGGATGGTGAGGCATTAGG + Intergenic
1081796789 11:45826059-45826081 TCAGAGGATTTTCAGGCAGGTGG + Intergenic
1082835291 11:57646840-57646862 CCTGCGGGGATTCAGGCAGTGGG - Intronic
1083777089 11:64899377-64899399 CCAGCGGGTGTGCAGGAAGAGGG - Intronic
1087072084 11:94090964-94090986 CCAGGGGAAGTTTATGCAGTGGG + Intronic
1093108837 12:15123898-15123920 GCAGGGGTTGTTCAGGCAATGGG - Intronic
1095915653 12:47475284-47475306 CCAGCAGATCTCCAGGCATTTGG + Intergenic
1104807004 12:131596044-131596066 ACAGGGGAAGTTCAGGCAGGAGG - Intergenic
1108529231 13:51313525-51313547 TCAGCAGATGTTCTAGCAGTTGG - Intergenic
1112194097 13:97207859-97207881 ACAGTGGAGGTACAGGCAGTGGG + Intergenic
1113152022 13:107274451-107274473 CCATGGGAAGTTCAGGCAGGCGG + Intronic
1116542332 14:46113329-46113351 CCAGTGGGTGTACAGGCATTGGG - Intergenic
1129499646 15:76023812-76023834 CCACTGGAAGTGCAGGCAGTGGG - Intronic
1129659665 15:77545996-77546018 CCAGGGAGTGTTCAGGCTGTTGG + Intergenic
1137054323 16:35736073-35736095 GCAGCGGGGGTTCAGGCAGGCGG - Intergenic
1140540784 16:75754778-75754800 TCAAGGAATGTTCAGGCAGTTGG + Intronic
1144579674 17:16451273-16451295 CCAGCACAAGTTCAGGGAGTGGG + Intronic
1145273228 17:21415560-21415582 CCAGCGGATGTCCACACAGGTGG - Exonic
1145311421 17:21703004-21703026 CCAGCGGATGTCCACACAGGTGG - Exonic
1145346704 17:22046492-22046514 CCAGTGGATCTTCAGGCCCTAGG + Intergenic
1147958269 17:44149975-44149997 TCTGTGGATGTTCTGGCAGTGGG + Intronic
1157973037 18:52292959-52292981 TCAGGTGATGGTCAGGCAGTTGG - Intergenic
1158152470 18:54387982-54388004 AAAGTGGATTTTCAGGCAGTTGG - Intergenic
1158737813 18:60103849-60103871 CCATCGGGTGGTTAGGCAGTGGG + Intergenic
1161203189 19:3027574-3027596 CCAGCAGAGATGCAGGCAGTGGG - Intronic
1162144556 19:8605681-8605703 CCAGCGGAGGATCTGGCAGGCGG + Exonic
1162739545 19:12766188-12766210 CAAGCGGCTGTGCAGGCAGGAGG - Exonic
1163551890 19:17969912-17969934 CCAGCGGATGTTCAGGCAGTGGG + Intronic
1163665717 19:18603384-18603406 ACAGAGCATGTCCAGGCAGTGGG + Intronic
1165354638 19:35295990-35296012 CCAGCGGTTGTGCAGGCACCGGG + Intronic
1165462595 19:35953013-35953035 CCAGGGGATGTCCAGGAAGAGGG - Intergenic
1168147640 19:54428952-54428974 CCAGAGGCTGATCAGGCTGTGGG + Intronic
924961956 2:43752-43774 CCATAGCATGTGCAGGCAGTAGG - Intronic
925720160 2:6819909-6819931 GCACTGGATGTTCAGGCAGAGGG + Intergenic
926635676 2:15176325-15176347 CCAGGGGTTGTTCAGGAGGTGGG + Intronic
928983720 2:37160124-37160146 GCAGCTGATGTTCAGAGAGTTGG + Intergenic
931410196 2:62022485-62022507 CCAGTGTATGTTGAGGCACTTGG + Intronic
931638755 2:64363149-64363171 CCAGTGGAAGTTCTGACAGTGGG - Intergenic
938018131 2:127885144-127885166 CCAGCGGAGGTTAAGGAAGGAGG + Intronic
941833063 2:169983593-169983615 CCAGCTGATATTCAAGGAGTGGG + Intronic
944045399 2:195405284-195405306 ACAGCAGAAGTTCAGGCAATTGG - Intergenic
946992927 2:225355895-225355917 CCAGGTGATGTTCTGGCAGAAGG + Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1171294131 20:24002507-24002529 CCTGAGGATGTGCAGGGAGTGGG - Intergenic
1173709137 20:45139166-45139188 CCAGCGGCTTTTGAGGCAATAGG + Intergenic
1173718301 20:45230663-45230685 CCAGCAGATTTTGAGGCAATAGG - Intergenic
1173758921 20:45542707-45542729 CTTGCAGGTGTTCAGGCAGTTGG + Exonic
1174107797 20:48175359-48175381 CCAGCAGAAGGGCAGGCAGTGGG - Intergenic
1181100203 22:20533794-20533816 CCAGGGGATGTACTGGCAGACGG - Intronic
1181663123 22:24368303-24368325 CCAGGCAATGTGCAGGCAGTAGG - Intronic
1185309673 22:50147135-50147157 GGAGCTGATGTTCAGGTAGTGGG + Intronic
959585631 3:108022660-108022682 CCAGGTGATGGTCAGGCAGTTGG - Intergenic
959659941 3:108856295-108856317 GCAGAGTATGTTCAGGTAGTAGG + Intergenic
967469079 3:189842058-189842080 CCCGCGGTTTTGCAGGCAGTTGG + Intronic
979481185 4:121219250-121219272 TCAGAGGATGCTCAGCCAGTTGG - Intronic
984512195 4:180692879-180692901 GCAGTGGAGGTTCAGGCATTGGG + Intergenic
984769179 4:183422701-183422723 CCAGCGGTTTTCCAGGCAGGTGG + Intergenic
985663147 5:1167318-1167340 CCAGAAGGTGTTCAGGCAGAGGG + Intergenic
993211904 5:84962222-84962244 CCAGAGGGAGTTCAGGCAGCAGG + Intergenic
993358888 5:86948505-86948527 CCAGGAGATGTCCAGACAGTTGG - Intergenic
996956478 5:129188486-129188508 CCAAGGGATCTTCAGTCAGTAGG - Intergenic
1001080210 5:168662100-168662122 ACAGTGGATGTCCAGGCAGATGG - Intronic
1001667120 5:173442583-173442605 CCAGAGGATGCCCAGGAAGTAGG - Intergenic
1002175500 5:177399130-177399152 CCAGAGGAAGTTCAGCCAGGTGG - Intergenic
1003918435 6:10809207-10809229 CCAGTGGGTGTTCAGGCACTGGG + Intronic
1005349022 6:24916160-24916182 GCAGAGAATTTTCAGGCAGTAGG - Intronic
1005494573 6:26377126-26377148 CCAGGGAATGATCAGGCACTAGG - Exonic
1005503771 6:26452231-26452253 CCAGGGAATGATCAGGCACTAGG - Exonic
1007838872 6:44699247-44699269 CCAGAGGGTGCTCAGGCAGGTGG + Intergenic
1008451036 6:51651113-51651135 TTAGCGGGTGTTCAGGCAGTTGG - Intronic
1008574302 6:52845205-52845227 CCAGTGAATGTCCAAGCAGTGGG + Intronic
1014545758 6:122733460-122733482 GCAACGGATGTTTAGGCGGTTGG + Intergenic
1015073385 6:129124861-129124883 CAAGCAGATTTTCAGGGAGTGGG - Intronic
1023724286 7:43125971-43125993 CCATGGCATGTTAAGGCAGTTGG - Intronic
1030623164 7:111814596-111814618 CCAGCGGATGCTAATGCTGTTGG + Intronic
1036797784 8:11768694-11768716 CCAGCAGGTGTTCAGGAAATAGG - Intergenic
1042383810 8:68150389-68150411 CCAGCAGAGGTTCAGACAGAGGG - Intronic
1047208221 8:122820222-122820244 CCAGAGGAAGTCCAGGCTGTGGG + Intronic
1047422459 8:124718404-124718426 CCAGCGGAGGCTCAGACAGAGGG + Intronic
1048378112 8:133840146-133840168 TGAGTAGATGTTCAGGCAGTAGG - Intergenic
1057330435 9:94109476-94109498 CCAGTGGATGTTAATGGAGTGGG + Exonic
1059193396 9:112348227-112348249 CCATCAGATGGTCAGGCAGTTGG + Intergenic
1062561954 9:137145639-137145661 CCGGCGGGTGTTCCGGCAGTGGG + Intronic
1191774039 X:64793145-64793167 CCAGCAGATGTCCAGGTATTTGG + Intergenic
1193551085 X:82893467-82893489 CCAGCAGATCTCCAGGCATTTGG + Intergenic
1197055460 X:122113619-122113641 ACAGGGGAGGATCAGGCAGTGGG + Intergenic
1197951271 X:131900011-131900033 CCAGGTGATGCTAAGGCAGTTGG + Intergenic