ID: 1163554174

View in Genome Browser
Species Human (GRCh38)
Location 19:17983208-17983230
Sequence GAGGCAGGAGGGGCTCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 0, 2: 8, 3: 116, 4: 531}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163554166_1163554174 4 Left 1163554166 19:17983181-17983203 CCGGAGCCTTGAGTCCTGGCAGT 0: 1
1: 1
2: 0
3: 16
4: 163
Right 1163554174 19:17983208-17983230 GAGGCAGGAGGGGCTCCGCCAGG 0: 1
1: 0
2: 8
3: 116
4: 531
1163554165_1163554174 5 Left 1163554165 19:17983180-17983202 CCCGGAGCCTTGAGTCCTGGCAG 0: 1
1: 0
2: 4
3: 35
4: 257
Right 1163554174 19:17983208-17983230 GAGGCAGGAGGGGCTCCGCCAGG 0: 1
1: 0
2: 8
3: 116
4: 531
1163554167_1163554174 -2 Left 1163554167 19:17983187-17983209 CCTTGAGTCCTGGCAGTCTCAGA 0: 1
1: 0
2: 1
3: 10
4: 213
Right 1163554174 19:17983208-17983230 GAGGCAGGAGGGGCTCCGCCAGG 0: 1
1: 0
2: 8
3: 116
4: 531
1163554170_1163554174 -10 Left 1163554170 19:17983195-17983217 CCTGGCAGTCTCAGAGGCAGGAG 0: 1
1: 0
2: 1
3: 56
4: 391
Right 1163554174 19:17983208-17983230 GAGGCAGGAGGGGCTCCGCCAGG 0: 1
1: 0
2: 8
3: 116
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163554174 Original CRISPR GAGGCAGGAGGGGCTCCGCC AGG Intronic
900013647 1:135340-135362 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900014411 1:138306-138328 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900043717 1:491323-491345 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900044276 1:493508-493530 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900065155 1:726326-726348 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900065684 1:728414-728436 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
900140188 1:1136606-1136628 GAGGCAGGAGGGGGTCAGGTGGG + Intergenic
900210708 1:1454538-1454560 GGGGCAGAAGGGACTCAGCCAGG - Intronic
900216582 1:1485208-1485230 GGGGCAGAAGGGACTCAGCCAGG - Intronic
900223662 1:1522936-1522958 GGGGCAGAAGGGACTCAGCCAGG - Intronic
900236776 1:1596858-1596880 GAGGGAGGGGAGGCTCCTCCAGG + Intergenic
900344350 1:2204015-2204037 CAGGCTGGAGGGGCTGCCCCAGG - Intronic
900361031 1:2289234-2289256 GAGGCAGGAGGGCCACCTCCGGG - Intronic
900430910 1:2602858-2602880 GGGGCAGGATGAGCTCAGCCAGG - Intronic
900559046 1:3294620-3294642 GAGGCAGCACGGGATCCGTCGGG - Intronic
900625018 1:3604034-3604056 GGGACAGCAGGGGCTCCACCAGG + Intronic
900662014 1:3789498-3789520 GAGGCGGGCGGGGCCCCACCGGG + Intronic
900824430 1:4914566-4914588 GAGGCAAGAGAGACTCAGCCGGG + Intergenic
900951407 1:5860042-5860064 GAGGCAGGAGGGTCTGGGGCTGG - Intergenic
901058334 1:6460017-6460039 GAAGCAGGAGGAGCTGCGGCGGG + Exonic
901139686 1:7020640-7020662 GAGGCAGGAGAGCCTCCTACAGG - Intronic
901196946 1:7445534-7445556 GACGGGGGAGGGGCTCAGCCTGG + Intronic
901450527 1:9333896-9333918 GAGGCAGGTGGGGCCTGGCCAGG + Intronic
901781964 1:11600037-11600059 GGGGCAGGAGGGGCTGCCGCCGG + Intergenic
902567257 1:17320238-17320260 GAGGCAGGAGGGTCTGAGTCAGG - Intronic
902770216 1:18641402-18641424 GAGCCAAGAGGGGCTCCCCAGGG + Intronic
903044276 1:20553831-20553853 GCGGCCGGAGGTGCTCAGCCTGG + Exonic
903331163 1:22597888-22597910 CAGGCAGGAGGGGCACTGCAGGG - Intronic
903431367 1:23303234-23303256 GAGGCAGGAGGGGCTCTGTGTGG - Intergenic
903549849 1:24150311-24150333 GAGGGAGGACGGGCACCGACGGG + Intergenic
903646775 1:24900862-24900884 GAGGCAGCTGGGGGTCCGCGGGG + Exonic
903732379 1:25505955-25505977 GAGGCAGGAGCTGCTCAGCAGGG + Intergenic
904285038 1:29448624-29448646 GAGGCAGCAGGGGGTCAGCAAGG + Intergenic
904592480 1:31622704-31622726 GTGGCAGGAGAGGCTTCTCCAGG + Intronic
904841154 1:33372779-33372801 GAGACAGAAGGGTCTCCACCAGG + Intronic
905871064 1:41404859-41404881 GAGGGAGGAGGGGCTCTTCGCGG + Intergenic
906145447 1:43557809-43557831 GAAGCAGGAGGGGCTCACTCAGG - Intronic
906147858 1:43570545-43570567 CAGGCAGAAGGGGCTCTGGCCGG - Intronic
907405597 1:54251733-54251755 GAGGGAGGAGGAGCCCCTCCTGG + Intronic
908267966 1:62397109-62397131 GAGGGAGGCGGGCCTCTGCCTGG + Intergenic
908280822 1:62533091-62533113 GAGGGAGGGGGGGCTCCGAACGG - Intronic
908531340 1:65037370-65037392 GAGGCAGGAGGAGTTGAGCCAGG - Intergenic
908556949 1:65265760-65265782 TAGGAAGGAAGGGCTCCCCCTGG - Intronic
910868076 1:91805936-91805958 GAGGCAGGTGGTGCTCTGCCAGG - Intronic
912682514 1:111738522-111738544 GCTGGAGGAGGGGCTCTGCCTGG - Intronic
912793230 1:112674239-112674261 GAGGGACAAGGGGCTCTGCCAGG - Intronic
912971994 1:114292364-114292386 GAGCCAGGAGGGGCGCTGGCTGG - Intergenic
913090051 1:115470461-115470483 GAGGAAGGAGGGGCCGAGCCAGG - Intergenic
913251437 1:116914792-116914814 TAGGCAGGAGTGGCTGTGCCTGG - Intronic
914702873 1:150150130-150150152 GAGGGAGGAGCGGCGGCGCCGGG + Exonic
915300198 1:154947387-154947409 CAGGCAGGAGGGGCTGGGCTAGG - Intronic
915300688 1:154949904-154949926 CAGGCAGGAGGGGCTGGGCTAGG - Intronic
916792601 1:168136970-168136992 GGGGCCGGAGGGGCCCGGCCGGG - Intronic
917964246 1:180168384-180168406 GAGGCAGGAAAGGCTTTGCCGGG - Intronic
918218654 1:182415661-182415683 GAGGGAGGAGGGGCTCAGAGTGG + Intergenic
918282724 1:183022866-183022888 GCGGCAAGAGGGTCCCCGCCCGG - Intergenic
918407569 1:184225957-184225979 GAGGCAGGAGGAGCGGGGCCTGG - Intergenic
919761693 1:201102170-201102192 GGGGGAGGAGGGGGTCCTCCTGG + Intronic
919795238 1:201317703-201317725 GAGGCAGAATGGGATCCGCGAGG + Exonic
920152476 1:203919931-203919953 AAGTGAGGAGGGTCTCCGCCCGG - Intergenic
921039534 1:211416659-211416681 GAGGCAGCAGCGGCGGCGCCGGG + Intergenic
922100060 1:222472335-222472357 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922100265 1:222473163-222473185 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922100466 1:222473963-222473985 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922262084 1:223951801-223951823 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
922561502 1:226572906-226572928 GAGGCAAGAGGGACTCTCCCAGG + Intronic
922660857 1:227429259-227429281 GATGCTGGAGGGGGTCCCCCTGG + Intergenic
922734184 1:227970777-227970799 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
922734980 1:227973913-227973935 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
922794980 1:228335414-228335436 GAGGAAGGAGGGGGTCCCACAGG - Intronic
924038299 1:239957859-239957881 GGAGCAGGAGGGGCTCAGCAGGG - Intergenic
924343258 1:243054000-243054022 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
924343729 1:243055880-243055902 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
924386031 1:243498469-243498491 AATGCAGGTGGGGCTCCGGCAGG - Intronic
924624061 1:245685702-245685724 GAGGCAGGAGAGGCTGCAGCCGG + Exonic
1065337956 10:24674161-24674183 GAGGCAGGAGGATCTCAGCCAGG + Intronic
1065589817 10:27252708-27252730 GGGGCAGGTGGGCCGCCGCCAGG - Intergenic
1066107354 10:32167551-32167573 GGGGCAGGAGGGTCTCAGCTGGG - Intergenic
1066302641 10:34110405-34110427 GAGACAGGAGTGGCTCCTGCCGG - Exonic
1066733234 10:38451592-38451614 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1067052346 10:43029146-43029168 GACCCAGCAGGGCCTCCGCCCGG + Intergenic
1067144749 10:43686966-43686988 GAGGCAGGAAAGACTCCACCTGG + Intergenic
1067441444 10:46311108-46311130 GAGGCAGGAGGCCCTGGGCCTGG + Intronic
1067596976 10:47565821-47565843 GAGGCAGCAAGGGCTGAGCCCGG + Intergenic
1069233577 10:66042620-66042642 GAGGCATGAGCTGCTGCGCCTGG - Intronic
1069625907 10:69867533-69867555 GAGGCAGAAGGGCCACCGGCAGG + Intronic
1069719485 10:70540603-70540625 GCGCCAGGAGGGGCTCAGGCAGG - Intronic
1070247945 10:74749426-74749448 GAGGCAGGAGGGCTTCAGGCAGG + Intergenic
1072082467 10:92045707-92045729 GAGCCAGGAGCGACTCCCCCAGG + Intergenic
1072252662 10:93593853-93593875 GCGGCAGGAGGAGCTGTGCCTGG - Exonic
1073481288 10:103787621-103787643 AAGGCAGGCTGGCCTCCGCCAGG + Intronic
1074499740 10:114012712-114012734 GAGGCAAAGGGGGCTCCTCCTGG + Intergenic
1074537712 10:114340618-114340640 AAAGCCGGAGGAGCTCCGCCAGG + Exonic
1075257769 10:120939171-120939193 GAGGCAGGAGGGCCTCCCTGAGG - Intergenic
1075403855 10:122180850-122180872 GAGGCAGGAGAGGCTGAGGCAGG - Intronic
1076208502 10:128622527-128622549 GAGCCAGGAGGATCTCAGCCAGG - Intergenic
1076739907 10:132478008-132478030 GAGGCTGAGGGGGCTCCGACGGG - Intergenic
1076757123 10:132578493-132578515 GGGGCTGGAGGGGCTCTGTCAGG + Intronic
1076757145 10:132578585-132578607 GGGGCTGGAGGGGCTCTGTCAGG + Intronic
1076826233 10:132971035-132971057 GAGGAGGGAGGAGCTCTGCCCGG + Intergenic
1076969991 11:127554-127576 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1076970608 11:129983-130005 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1077013562 11:390507-390529 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077013592 11:390592-390614 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077013622 11:390677-390699 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077013652 11:390762-390784 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077013682 11:390847-390869 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077013712 11:390932-390954 GAGGCAGGCGGGGCATCTCCCGG - Intergenic
1077102826 11:829745-829767 CAGGGAGGAGGGGCAGCGCCGGG + Intronic
1077289317 11:1781634-1781656 GTGGAAGGACGGGCTCAGCCAGG - Intergenic
1081615314 11:44587357-44587379 GTGGCCGGCGGGGCCCCGCCAGG - Intronic
1082260225 11:50072480-50072502 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1082260624 11:50074207-50074229 GAGGCAGGAGGAGCTGGGTCTGG + Intergenic
1082794413 11:57369327-57369349 GAGGCAGGGCGGGCTCCGAGGGG - Intronic
1082803415 11:57431088-57431110 GAGGCAGCAGAGGATCAGCCTGG + Intergenic
1083233762 11:61339187-61339209 CATGCAGGAGGGGCTGCGGCAGG + Intronic
1084087480 11:66861223-66861245 GAGGCTGCAGGGGCTGGGCCAGG - Intronic
1084172162 11:67405900-67405922 CAGGCAGCAGGGGCTCCTGCAGG + Exonic
1084432871 11:69121471-69121493 GAGGCAGGAGGTGTCCTGCCTGG + Intergenic
1084535546 11:69754208-69754230 GTGGCAGGACTGGCTCCTCCGGG - Intergenic
1084978848 11:72817822-72817844 GGAGGAGGAGGGGCTCCGGCTGG + Exonic
1085264645 11:75230007-75230029 CAGGCAGGAGAGGCTGAGCCAGG - Intergenic
1085524125 11:77154598-77154620 GAGGCTGGAGGGGAGCAGCCAGG - Intronic
1086863005 11:91947415-91947437 GAGTCAGGAGGGGCCACCCCTGG + Intergenic
1088469262 11:110176396-110176418 GAGCCAGGAGGGGTACTGCCTGG - Intronic
1088599538 11:111462508-111462530 AGGGCAGGAGGGGCTCCCCACGG - Intergenic
1088810335 11:113387723-113387745 GGGGCAGGAGCGGCTCCTCTTGG + Intergenic
1088859876 11:113789733-113789755 GAAGCTGGAGGGCCGCCGCCTGG + Intergenic
1089069621 11:115689312-115689334 CAGGCAGGAGTGGCTCGGCAGGG + Intergenic
1090037843 11:123264212-123264234 GAGGCAGGAGACGCACCGTCCGG - Intergenic
1090203997 11:124875023-124875045 GTGGGAGGAGGGGCTGGGCCTGG + Intronic
1091568274 12:1663004-1663026 GAGGCAGCCGGGGGTCCGCTGGG + Intergenic
1092818448 12:12331387-12331409 GAAGCCGGAGGGGCTCAGCAGGG + Intronic
1092881527 12:12891185-12891207 GAGGCGGGTGTGGCTCCCCCGGG + Exonic
1096121678 12:49092778-49092800 GGCTCAGGAGGGGCTCCGGCAGG - Intronic
1096224998 12:49861090-49861112 AAGGGAGGAGCGTCTCCGCCCGG + Intergenic
1097062024 12:56292299-56292321 GAGGCAGGAGAAGCTCCGGGAGG + Intronic
1097191965 12:57223794-57223816 GAGGCAGGAGCGGCCGGGCCAGG - Intronic
1100606764 12:96158230-96158252 GAGTGAGGAGCGTCTCCGCCCGG + Intergenic
1102043785 12:109817197-109817219 GAGGCAGGAGGGGCATCTGCAGG + Intronic
1103454275 12:121052731-121052753 GAGGCAGGAGAGGCTAGGCGTGG + Intergenic
1103556708 12:121770983-121771005 GAGGCTGGAGGGGCCCAGCGAGG - Intronic
1103615106 12:122146891-122146913 AAGGCAGGGAGGGCTCAGCCCGG + Exonic
1103944656 12:124519326-124519348 GAGGCAGAGGAGGCTCCACCAGG + Intronic
1104371643 12:128228761-128228783 GAGGCAGGAGGGCCTTTGGCAGG - Intergenic
1104401732 12:128481828-128481850 GAGGAAATAGGGGCTCCACCAGG - Intronic
1104462872 12:128969625-128969647 GAGGCACTCGGGGCTCCTCCTGG + Intronic
1104902028 12:132194630-132194652 CAGGGAGGAGGGGCTGGGCCAGG + Intergenic
1104982708 12:132581435-132581457 GAGGCAGGATGGGCGGCACCTGG - Exonic
1105240912 13:18609294-18609316 GAGGCTGGAGGCGCTGCGGCCGG + Intergenic
1105681895 13:22736629-22736651 GAGGCAGGCGGCGCTCTCCCTGG + Intergenic
1106248669 13:27968326-27968348 GCGCCAGGAGGGGCACGGCCCGG - Intronic
1106560221 13:30839860-30839882 AAGTGAGGAGGGTCTCCGCCCGG - Intergenic
1113292181 13:108919245-108919267 GGGGCAGGAAGGGCCCAGCCAGG - Intronic
1113961354 13:114128019-114128041 GAAACAGCAGGGGCTCCGGCAGG - Intronic
1114064880 14:19052724-19052746 CAGGCTGGAGAGGCTCCCCCAGG - Intergenic
1114097381 14:19347278-19347300 CAGGCTGGAGAGGCTCCCCCAGG + Intergenic
1114209141 14:20600914-20600936 CAGGCAGGGGGGGCTCCCCTGGG - Intronic
1114437910 14:22723528-22723550 GAGGCAGGAGGGGTTCCTGGGGG + Intergenic
1115752512 14:36506124-36506146 GAAGCGGGATGGGCTCCGCTCGG + Intronic
1118030364 14:61812670-61812692 GCGGCAGGAGGGGCTGTGCGCGG + Intergenic
1118288954 14:64503605-64503627 GCGGCAGGAGGGACTGAGCCCGG + Intronic
1118765466 14:68906681-68906703 GAGGGCTGAGGGGCTCCGACTGG - Intronic
1118851503 14:69587219-69587241 GGGGCTGGAGGGGCTGAGCCAGG - Intergenic
1119698618 14:76734690-76734712 AAGGGAGGAGCGTCTCCGCCCGG - Intergenic
1119730341 14:76947291-76947313 GTGGCAGGCGAGGCCCCGCCGGG + Intergenic
1120908078 14:89638446-89638468 CAGGCATGAGGCGCTGCGCCTGG - Intronic
1121670826 14:95709647-95709669 CAGGCAGGAGGGGCTTCTGCTGG + Intergenic
1121671468 14:95713898-95713920 GAGGCAGCAGGGGCAGCCCCTGG - Intronic
1121781245 14:96623870-96623892 GCGCCAGGAGGGGCTTCGCCAGG - Intergenic
1121931935 14:97980040-97980062 GAGGCAAGTGGGACTCAGCCTGG - Intergenic
1122024106 14:98862360-98862382 GAGGCAGGGTGGTCTACGCCTGG + Intergenic
1122123711 14:99568097-99568119 GAGGCAGGAGGGGCTCAGGCTGG + Intronic
1122261789 14:100527728-100527750 GAGGGAGCAGGTGCTCAGCCTGG + Intronic
1122267931 14:100555300-100555322 GGCACAGGAGAGGCTCCGCCAGG - Intronic
1122784081 14:104155906-104155928 GAGGCTGGAGGGGCTGCAGCAGG - Intronic
1123039912 14:105486272-105486294 GAGGCGGGACAGACTCCGCCTGG + Intergenic
1123120626 14:105914763-105914785 GAGGCTGCAGGGGCTCATCCAGG - Intergenic
1123123449 14:105928693-105928715 GAGGGAGGAGGGCATCCACCAGG - Intronic
1124662096 15:31558096-31558118 CAGGCAGGCGGGGCTCCCACTGG + Intronic
1125677310 15:41509340-41509362 GGGACAGGAGGGGCTCAGGCAGG - Intronic
1126113397 15:45188014-45188036 GAGGGGGGCGGGGCTCCGCCGGG + Intronic
1126684373 15:51234682-51234704 GGGGCAGGAGGGCCTCTCCCCGG - Intronic
1128248497 15:66149059-66149081 GAGGCTGGAGGTGCTCCTGCCGG - Intronic
1128406111 15:67340929-67340951 GAGGCATGAGCCGCTGCGCCTGG - Intronic
1128944988 15:71813854-71813876 GAGCCACCAGGGGCTCCGGCTGG - Intronic
1129385964 15:75196197-75196219 CAGGCAGGTGGAGCTCGGCCAGG + Intronic
1129661393 15:77554858-77554880 GAGGGAGGAGGGGCTGCTGCTGG + Intergenic
1131127187 15:89867873-89867895 AAGTGAGGAGCGGCTCCGCCCGG + Intronic
1132473298 16:118970-118992 TGGGCAGGTGGGGCTCCCCCTGG - Intronic
1132588278 16:715515-715537 GAGGGAGCGGGGGCTGCGCCGGG + Intronic
1132626899 16:895479-895501 CAGGCAGGACGGGAGCCGCCGGG + Intronic
1132648785 16:1011100-1011122 CAGGCAGGAGCAGCCCCGCCCGG + Intergenic
1132713418 16:1279104-1279126 GGAGCAGGAGGGGCTCAGCAGGG + Intergenic
1132737607 16:1394694-1394716 GGAGCAGGAGGGGCTGGGCCAGG - Intronic
1132754366 16:1475341-1475363 CCGGCTGGAGGGGCTCCCCCAGG + Exonic
1132937374 16:2488008-2488030 GGGGCAGGAGGGGCCCCAGCGGG - Intronic
1133041928 16:3065424-3065446 GAGGGAGCAGGGGCCCAGCCAGG + Exonic
1133270798 16:4610024-4610046 GAGGCAGTGGGGGCCCCTCCAGG - Intronic
1134450015 16:14357668-14357690 GAGGCAGGACTGGGTCAGCCTGG - Intergenic
1135698249 16:24609688-24609710 GAGTCAGGTGGGGCCCCGACTGG - Intergenic
1135821261 16:25688572-25688594 GAGGCAGGAGGAGATTTGCCAGG - Intergenic
1136008774 16:27348819-27348841 AAGGCAGGAGTGGCTTCCCCAGG + Intronic
1136011185 16:27364217-27364239 GAGGCAGGTGGGCCTCCACGTGG - Exonic
1136082814 16:27863786-27863808 TAGGTAGGAGGAGCTCAGCCAGG - Intronic
1136276699 16:29183008-29183030 GGGTCAGGAGGGGCTGGGCCTGG + Intergenic
1136498586 16:30658734-30658756 GAGGCTGGAGGAGCTGGGCCCGG + Exonic
1136749128 16:32617035-32617057 GAGGGAGGAGGGGCTCCCTAGGG - Intergenic
1136929976 16:34410016-34410038 GAGGCAGGAGGGACTGAGCTGGG - Intergenic
1136974598 16:35001789-35001811 GAGGCAGGAGGGACTGAGCTGGG + Intergenic
1140124002 16:72105455-72105477 GAGACAGGAAAGGCTCCGCGAGG - Intronic
1141132939 16:81447335-81447357 GAGGGAGAAGGGGCTCCTCCTGG - Intronic
1141665557 16:85463508-85463530 CAGGCACGAGGGGCCCTGCCAGG - Intergenic
1141683647 16:85557790-85557812 AAGGCAGGAGAGACTCCTCCTGG + Intergenic
1141696855 16:85624276-85624298 GAGGGAGGAAGGGCTCCCACAGG + Intronic
1141731873 16:85828372-85828394 GAGGCCGGAGGGGCTGTGGCGGG + Intergenic
1141828149 16:86495114-86495136 CCAGCAGGAGGGGCTCCGCGGGG + Intergenic
1141904530 16:87015386-87015408 GTGGCAGGAGTGTCTCAGCCAGG + Intergenic
1142003474 16:87677792-87677814 GAGACAGGAGCGGGTCTGCCTGG - Intronic
1142027932 16:87824386-87824408 GAGGCAACAGTGGCTCTGCCTGG - Intergenic
1142081081 16:88149069-88149091 GGGTCAGGAGGGGCTGGGCCTGG + Intergenic
1142213065 16:88817552-88817574 GAGGCAGGAACGGCACTGCCCGG - Intronic
1142449640 16:90167499-90167521 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1142450688 16:90171578-90171600 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1203051261 16_KI270728v1_random:876249-876271 GAGGGAGGAGGGGCTCCCTAGGG - Intergenic
1142456877 17:62113-62135 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1142457447 17:64346-64368 GAGGCCGGAGGAGCTGGGCCTGG + Intergenic
1142625232 17:1187499-1187521 GAGTCAGGAGGAGCTCCGTCTGG + Intronic
1142762282 17:2049796-2049818 GTGGCAGGAGGTGCTGCGCAGGG - Intergenic
1143165176 17:4893957-4893979 GAGGAAGGTGGGGCCCCTCCAGG - Intronic
1143205914 17:5139179-5139201 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1143340642 17:6208144-6208166 GAGGCAGTTGGAGCTCCTCCTGG - Intergenic
1143471796 17:7179864-7179886 AAGGCAGGAGAGCCTCCGCTGGG + Intergenic
1143568641 17:7740608-7740630 GAGGCAGGAGGGCCTCCGGAAGG - Intronic
1143761862 17:9110561-9110583 GAGGCAGGAGGGGCTGGGTGCGG - Intronic
1146257254 17:31398786-31398808 GAGGGAGGAGAGGCTGGGCCAGG + Intronic
1146343343 17:32040901-32040923 GAAGCTGGAGGGCCGCCGCCTGG + Intronic
1146793173 17:35764376-35764398 CAGGGAGGAGGGGCTGCCCCAGG + Intronic
1146842696 17:36166617-36166639 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146847818 17:36195600-36195622 GAGTCAGGAAGGGCTGCCCCAGG - Intronic
1146855009 17:36254576-36254598 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146865611 17:36333800-36333822 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1146870909 17:36378468-36378490 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146878267 17:36429550-36429572 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146882216 17:36450696-36450718 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1146914560 17:36670177-36670199 GAGGCAGGAGAGGCTGGGGCAGG - Intergenic
1147057410 17:37844932-37844954 CAGGCAGGATGGGCACCACCCGG - Intergenic
1147068480 17:37934412-37934434 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1147073793 17:37979092-37979114 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1147080003 17:38013949-38013971 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1147085314 17:38058630-38058652 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1147095952 17:38137909-38137931 CAGGCAGGTGGGGCCCAGCCCGG + Intergenic
1147101261 17:38182596-38182618 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1147123716 17:38351969-38351991 GCGGCGGGCGGGGCTCCGGCGGG + Intergenic
1147323483 17:39659424-39659446 GAGGCAGGGAGGGGTCAGCCTGG - Intronic
1148562250 17:48612891-48612913 GGGGCATGGGGGGCTCAGCCGGG + Exonic
1148685152 17:49496720-49496742 GAGCCAGGAGAGGCTCAGACCGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148807854 17:50273272-50273294 GAGCCGGGAGGGGCGCGGCCGGG - Intronic
1149389492 17:56174757-56174779 GTGGGAGGAGGGACTCCGCTAGG - Intronic
1149845858 17:60009102-60009124 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1150084209 17:62265682-62265704 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1150108714 17:62479425-62479447 GAGGCGGGAGGGGCTCCCTGAGG + Intronic
1150782602 17:68135109-68135131 GAAGCTGGAGGGCCGCCGCCTGG - Intergenic
1151306087 17:73263423-73263445 GAGGCATGAGGGGCCCAGCAGGG + Intergenic
1151404233 17:73876381-73876403 GAGGCCAGAGGGGCTGAGCCAGG - Intergenic
1151537303 17:74746132-74746154 GGGGGGGGAGGGGCTCCCCCAGG - Exonic
1151745198 17:76008185-76008207 GAGCCGGGAGGAGCTCAGCCAGG - Exonic
1151983657 17:77528684-77528706 GAGGCAGGAGGGGGATCGCGAGG - Intergenic
1152275405 17:79353792-79353814 GAGGCACGAGGGGCCCCCACTGG + Intronic
1152293613 17:79454369-79454391 GGGGCAGGAGGGGCTGGGCAGGG - Intronic
1152495350 17:80667240-80667262 GAGGCTGGAGGGGGACAGCCGGG + Intronic
1152577970 17:81151268-81151290 GAGACAGGTGGGGCTGGGCCTGG - Intronic
1152813007 17:82391077-82391099 GAGGCAGGAGGGGCTGAGGGAGG + Intronic
1152908473 17:82983637-82983659 GTGACAGGATGGGCGCCGCCAGG + Intronic
1153322410 18:3786068-3786090 GAGGCAGGAGGGTCTGGGTCAGG - Intronic
1154250169 18:12737688-12737710 AAGGCTGGAAGGGCTCAGCCCGG - Intergenic
1154448058 18:14450614-14450636 GAGGCTGGAGGCGCTGCGGCCGG - Intergenic
1155300749 18:24426786-24426808 GAGGCAGGTGAGGCCCCGGCGGG + Exonic
1156364687 18:36414866-36414888 GCAGCAGGAGGGGCTCCTGCAGG + Intronic
1157109849 18:44810270-44810292 CAGGAAGGAGGGCCTGCGCCAGG - Intronic
1157489591 18:48113503-48113525 GGGGCAGGAGGTGCCCCGGCTGG + Intronic
1157614069 18:48976434-48976456 GAGGCCGGAGGGCGGCCGCCGGG - Intergenic
1158532744 18:58278348-58278370 GAGGCAGGAGGGGCAGGGCCTGG - Intronic
1158976830 18:62716880-62716902 GAAGCGGGAGGGGCTGCGCGGGG - Exonic
1160163180 18:76491202-76491224 GGGGCAGGCGGGGGTCCGCGCGG - Intronic
1160227113 18:77019937-77019959 GAGGCAGGAGGGCCTGTGCAGGG + Intronic
1160371325 18:78374034-78374056 GAGGCAGCAGGGGCTGCACTTGG + Intergenic
1160646789 19:197472-197494 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1160662702 19:308492-308514 CAGGCAGGAGAGGCTCCACCGGG + Intronic
1161026284 19:2038814-2038836 GAGACAGCAGGAGCCCCGCCTGG - Exonic
1161069559 19:2253347-2253369 GAGGCAGGAGGGGTTGCACAAGG + Intronic
1161103045 19:2430738-2430760 GAGGCTGGAGGAGACCCGCCAGG + Exonic
1161203289 19:3028022-3028044 GAGGAAGCGGGGGCTCTGCCTGG + Intronic
1161455853 19:4369473-4369495 CTGGCAGGAGTGGCTCCGTCAGG + Intronic
1161628569 19:5340193-5340215 GAGGCAGGGGGCGCTGTGCCGGG - Intronic
1161666174 19:5578345-5578367 GCGGCAGGAGGGGCCCAACCGGG + Intergenic
1161775603 19:6260522-6260544 GAGGCAGGTGGGGCAGGGCCTGG - Intronic
1161935869 19:7371941-7371963 GAGGAAGGAGGAGCTACGCAGGG - Intronic
1162030255 19:7914237-7914259 GAGGCAGGAGAGACTCCCCCAGG - Exonic
1162070393 19:8149232-8149254 CCGGCGGGAGGGGCTCGGCCGGG - Intronic
1162124945 19:8494377-8494399 GAAGCAGAAGGGGCCCCACCAGG + Intronic
1162500618 19:11051352-11051374 AAGGCACGAGCGGCTCCCCCAGG - Intronic
1162520109 19:11174650-11174672 GCTGCAGGAGTGGCTGCGCCTGG - Exonic
1162602084 19:11676935-11676957 AAGTGAGGAGGGTCTCCGCCCGG - Intergenic
1162912257 19:13854536-13854558 GAGGCAGGAGCCACTACGCCCGG + Intergenic
1162937157 19:13986955-13986977 GGGGCAGCAGGGGCCCCTCCAGG - Intronic
1163000562 19:14363983-14364005 GAGGCAGGAGGGGCCACGAGCGG - Intergenic
1163268938 19:16237933-16237955 GAGGCAGGATTGGCTGAGCCTGG - Intronic
1163321331 19:16576725-16576747 GGGACAGGAGGGGCTCGGCTGGG + Exonic
1163325885 19:16603040-16603062 TAGGCAGCAGGGGCTCTGCCAGG - Intronic
1163554174 19:17983208-17983230 GAGGCAGGAGGGGCTCCGCCAGG + Intronic
1163567136 19:18058522-18058544 GAGGCAGGGCGGGCCCGGCCGGG + Intergenic
1164035332 19:21449247-21449269 GAGTTAGGAGGGGCTGGGCCAGG + Intronic
1164061393 19:21678315-21678337 GAGTGAGGAGGGGCTGGGCCGGG + Intergenic
1164222072 19:23203914-23203936 GAGTGAGGAGGGGCTGGGCCGGG - Intergenic
1164810247 19:31149501-31149523 GAGGCGGGAGGGGCACAGCCAGG + Intergenic
1164879102 19:31715688-31715710 CAGCCAGGAGGAGCCCCGCCAGG + Intergenic
1165316485 19:35059589-35059611 AGGCCAGGAGGGGCTCCGGCTGG + Intronic
1165431562 19:35776043-35776065 GAGGAGGAGGGGGCTCCGCCGGG - Intronic
1165767416 19:38360013-38360035 GAGGCTGGAGGGGATCCCCCAGG + Intronic
1165833885 19:38743291-38743313 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1165833910 19:38743363-38743385 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1165833936 19:38743435-38743457 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1165833975 19:38743544-38743566 GAGGGAGGAGGGGCTGGACCTGG - Intronic
1165834037 19:38743727-38743749 GAGGGAGGAAGGGCTGGGCCTGG - Intronic
1165834049 19:38743762-38743784 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1165898390 19:39156602-39156624 GAGGGAGGCGGGGCTGGGCCTGG - Intronic
1165939157 19:39406750-39406772 GGGGCAGGAGGGGCGCTTCCCGG - Intergenic
1166297125 19:41894842-41894864 GAGGGAGGAAGGGCTGGGCCTGG + Intronic
1166297139 19:41894877-41894899 GAGGGAGGAGGGACTGGGCCTGG + Intronic
1166315675 19:41988224-41988246 GAGGGAGGAGGGGCTGTGGCTGG - Intronic
1166316288 19:41991860-41991882 GAGGGAGGAGGGGCTGGGGCTGG + Intronic
1166316301 19:41991895-41991917 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1166382674 19:42362912-42362934 GAGGGAGGAGGGGCTGGGGCTGG + Intronic
1166568689 19:43780306-43780328 GAGGGAGGAGGGGCTTTGGCTGG - Intronic
1166646279 19:44533997-44534019 GAGGCAGGAGGATCACTGCCTGG + Intergenic
1166662167 19:44654218-44654240 GAGAGAGGAGGGGCTGGGCCTGG + Intronic
1166700549 19:44879309-44879331 GGGACAGCAGGGGCTCAGCCAGG + Intronic
1166733713 19:45072327-45072349 AGGACAGGTGGGGCTCCGCCGGG + Exonic
1166759002 19:45212989-45213011 GAGTCAGGAGGGGCGCCGTACGG + Exonic
1167152566 19:47718669-47718691 GAGGGAGGAGGGACTGGGCCCGG + Intronic
1167248744 19:48390069-48390091 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1167248756 19:48390104-48390126 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1167314706 19:48756646-48756668 GAGGGAGGAGGGGCTGGGTCTGG + Intronic
1167342035 19:48921985-48922007 GAGGTTGGAGGGGCTGGGCCTGG + Intronic
1167426894 19:49434178-49434200 GAGCGAGGAGGGGCTAGGCCTGG - Intronic
1167432216 19:49461417-49461439 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167432268 19:49461562-49461584 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167432601 19:49462897-49462919 GAAGGAGGAGGGGCTGGGCCTGG + Intronic
1167432640 19:49463004-49463026 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167432735 19:49463259-49463281 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167432830 19:49463514-49463536 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167435506 19:49476343-49476365 GAGGGAGGAGGGGCTGGGCCGGG - Intronic
1167539338 19:50075282-50075304 GAGGGAGGAGGGGCTGGGCCTGG + Intergenic
1167630371 19:50622576-50622598 GAGGGAGGAGGGGCTGCGCCTGG - Intronic
1167635038 19:50649389-50649411 GTGGCAAGAGAGGCTCTGCCTGG - Intronic
1167676495 19:50889667-50889689 GAGGTAGGAGGGGCCCCAGCTGG - Intergenic
1167689349 19:50975512-50975534 GAGGGAGGAGGGGCTGGGGCTGG + Intergenic
1167705138 19:51077586-51077608 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167705166 19:51077659-51077681 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1167705596 19:51079333-51079355 GAGGGAGGAGGGGCTGGGCCTGG - Intronic
1167738498 19:51311167-51311189 GAGAGAGGAGGGGCTGGGCCTGG + Intergenic
1167743649 19:51339043-51339065 GAGGCAGCAGGGGCCCCGCCGGG + Exonic
1167799412 19:51730472-51730494 GAGGAAGGAGGGGCTGGACCTGG + Intergenic
1168056642 19:53868270-53868292 GAGGGAGGAGGAGCTGGGCCTGG + Intronic
1168069592 19:53942300-53942322 GAGGCAGGGGGAGCTCCGAGGGG - Exonic
1168077697 19:53990419-53990441 GAGGGAGGAGGGGCTGGGCCTGG - Intergenic
1168077935 19:53991041-53991063 GAGGGAGGAGGGGCTGGGCCTGG - Intergenic
1168238772 19:55078943-55078965 GATGGAGGAGGGGCTGGGCCTGG + Intronic
1168266204 19:55225146-55225168 GAGGGAGGAGGGGCTGGGCCTGG - Intergenic
1168266215 19:55225181-55225203 GAGGGAGGAGGGGCTGGGCCTGG - Intergenic
1168277570 19:55285954-55285976 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1168280351 19:55302345-55302367 GAGGCAGGAGGGGCTAAGCTAGG + Intronic
1168294861 19:55373488-55373510 GAGGGAGGAGGGGCTGGGCCTGG - Intergenic
1168294875 19:55373523-55373545 GAAGGAGGAGGGGCTGGGCCTGG - Intergenic
1168295918 19:55377304-55377326 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1168295944 19:55377373-55377395 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1168310105 19:55455880-55455902 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1168310118 19:55455915-55455937 GAGGGAGGAGGGGCTGGGCCTGG + Intronic
1168310143 19:55455987-55456009 GAGGGAGGAGGGGCTATGCCTGG + Intronic
1168310152 19:55456022-55456044 GAGGGAGGAGGAGCTGGGCCTGG + Intronic
1168723345 19:58567183-58567205 CAGGCATGAGCGGCTGCGCCTGG + Intronic
925187435 2:1858865-1858887 GAGGCAGCAGAGACTCCACCCGG - Intronic
926027192 2:9555681-9555703 GGGGGAGGACGGGATCCGCCCGG + Exonic
926111230 2:10185293-10185315 GAGGCAGGAGAGGCTGAGCGTGG + Intronic
927809939 2:26175251-26175273 GAGGCAGAAGGGGCTGTGTCCGG - Intronic
927855888 2:26527796-26527818 GGGGCAGGAGGGGCTGGGCCTGG - Intronic
927872715 2:26633785-26633807 GAGGCAGGAGGGGCTGCCTGCGG + Intronic
928511835 2:32010304-32010326 GCGGCAGGAGCGGCTCCGCGAGG + Exonic
931241984 2:60461828-60461850 GAGGGAGGGGGGGCGTCGCCAGG + Exonic
931997829 2:67856124-67856146 GAGGCTAGAGGGCCTCTGCCTGG - Intergenic
934502978 2:94873681-94873703 GAGCCAGCAGGGGCTGCCCCAGG + Intronic
934529222 2:95074850-95074872 GGGGCAGGGAGGGCTCCGCAGGG - Intergenic
934887388 2:98036841-98036863 CAGGCAGGACAGGCTCCTCCTGG - Intergenic
935283940 2:101546824-101546846 CAGGCAGGAGGTGCTGTGCCTGG - Intergenic
935681171 2:105638463-105638485 GTGGCTGGAGGGGCCCCTCCAGG + Intergenic
937215957 2:120313820-120313842 GGGGCGGGCGTGGCTCCGCCTGG - Intergenic
937241507 2:120465288-120465310 GAGGCAGTGGGGGCAGCGCCTGG - Intergenic
937916384 2:127101127-127101149 GAGGCAGGAGGGGCTGCTAAAGG - Intronic
938058228 2:128232991-128233013 GAGGCCCAAGGGGCTGCGCCCGG + Intergenic
938289492 2:130141858-130141880 CAGGCAGGAGGGGCCTCCCCGGG - Intronic
938467038 2:131531080-131531102 CAGGCAGGAGGGGCCTCCCCGGG + Intronic
938663572 2:133511311-133511333 GAGGCAGGGGAGGCTGGGCCAGG - Intronic
938969643 2:136420502-136420524 GAAGCTGGAGGGGCTCCACGAGG - Intergenic
940423912 2:153509368-153509390 GCAGCAGGGGAGGCTCCGCCAGG - Intergenic
941450803 2:165657945-165657967 GGAGCAGGAGAGGCTCCACCGGG + Exonic
946149369 2:217753784-217753806 GGGGCAGGAGGGTCTCTGCCTGG + Intronic
946164333 2:217854754-217854776 GAGGCAGGAGAGGCTATGGCTGG + Intronic
946185869 2:217980038-217980060 GAGGCAGAAGGGGCTGGGCATGG + Intronic
946334753 2:219029354-219029376 GAGGGAGGAGGGGCTCCCCTGGG - Intronic
946402722 2:219477013-219477035 GAGGGAGGAGGGGCTCCCTGGGG + Intronic
946453273 2:219799456-219799478 GAGGCTGGAGGGGCTCCCCCTGG + Intergenic
947163193 2:227235075-227235097 GAGGCAGCAGGGCCTCCGAAAGG - Intronic
947542855 2:230990690-230990712 GAGGCGCCAGGGGCTCCTCCTGG + Intergenic
947742346 2:232490466-232490488 GAGGCTGGCGGGGCTCGTCCTGG - Intergenic
947952729 2:234161931-234161953 GAGGGAGGAGGGGGTCCCCAGGG - Intergenic
948465697 2:238150640-238150662 GAGGCTGGAGGGGCTGCGGTGGG + Intronic
948612137 2:239176485-239176507 GAAGCTGGAGAGGCACCGCCAGG - Exonic
948684732 2:239663433-239663455 GAGGGTGGAGGGGCTCTCCCAGG + Intergenic
949032345 2:241803038-241803060 GAGGGAGGAGGAGCTCCCACTGG - Intronic
1169224362 20:3846976-3846998 GCGGCAGGACGGAGTCCGCCGGG + Intronic
1170765887 20:19289864-19289886 GAGACATGAGGGGCACCTCCAGG + Intronic
1170970803 20:21114769-21114791 GACACAGGAGGCGCTACGCCAGG + Intergenic
1172267097 20:33625810-33625832 GAGGCAGGAGGGGCTGGGCGTGG + Intronic
1172918559 20:38461715-38461737 AAGGGAGGAGCGTCTCCGCCCGG - Intergenic
1173540610 20:43848225-43848247 GAGGCAGGATGGGGTCCTCCAGG + Intergenic
1173683994 20:44910056-44910078 CAGGAAGGAGGGCTTCCGCCCGG + Exonic
1173808963 20:45944812-45944834 GAGGCCAGAGGGGCTCAGCTGGG - Intronic
1174602258 20:51734271-51734293 GAGGCAGGAGGGGCTGAGTGGGG - Intronic
1175405267 20:58722016-58722038 GAGCAAGGAGGGGCTCCTACAGG + Intergenic
1175821135 20:61909536-61909558 GAGGCAGGAAGGGTTCTCCCTGG - Intronic
1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG + Intergenic
1175994302 20:62805323-62805345 GAGGCGGGAGGGGTTCCATCAGG - Intronic
1176120772 20:63453590-63453612 GAGGCAGGAGGGGCGCCGCGGGG + Intronic
1176120921 20:63454271-63454293 GTGGCAGGAGGGGCAGCGGCGGG - Intronic
1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG + Intronic
1176190268 20:63805576-63805598 GAGGCAGGAAGGACCCTGCCTGG + Intronic
1176222371 20:63975746-63975768 GAGGCAGGAGGTGCTGCAGCAGG - Exonic
1176278713 20:64288754-64288776 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1176927372 21:14766437-14766459 AAGGCAGGAGCAGCACCGCCAGG + Intergenic
1178241852 21:30911970-30911992 CAGGCAGGATGGGCACCACCTGG - Intergenic
1178839993 21:36130410-36130432 GCGGCAGGAGCGGCTCCGCGAGG - Intergenic
1179178249 21:39023908-39023930 GAGGCAAGGGGGGCTCTGTCTGG - Intergenic
1179251087 21:39672168-39672190 CTGGCAGGAGGGTCTGCGCCTGG - Exonic
1179708029 21:43193813-43193835 GAACCAGGAGGGGCCTCGCCAGG - Intergenic
1179821290 21:43938889-43938911 GGGGAAGGAGGGGCTCCCCCAGG + Intronic
1180043589 21:45292776-45292798 GGGACAGGAGAGGCTCCGACAGG - Intergenic
1180929500 22:19579287-19579309 GAGGCAAGAGGGCCTCCAGCTGG + Intergenic
1180937807 22:19637605-19637627 GGGGCAGGAGGGAGTCAGCCTGG - Intergenic
1180971093 22:19816100-19816122 GAGGCAGCCGGGGCCCCGCGAGG - Intronic
1181050769 22:20237328-20237350 GGGGGAGGTGGGGCTCTGCCAGG - Intergenic
1181147547 22:20859245-20859267 GCGGCAGGAGGTCCTCCGCAGGG + Exonic
1181488677 22:23247659-23247681 CAGGCAGGAGAGGCTCTCCCAGG - Intronic
1182012724 22:27014172-27014194 GAGTCAGGAGGGGCTGTGACTGG + Intergenic
1182794788 22:32984048-32984070 GAGGCAGGAGAGGCTGAGGCAGG + Intronic
1183279762 22:36925722-36925744 GAGGGAGGAAGGGCTGGGCCAGG - Intronic
1183539088 22:38419304-38419326 GAGGCAGGAGGGGCTCAGACAGG + Intergenic
1183616890 22:38950978-38951000 GAGGCAAGAGGGGCTCACCCTGG - Intergenic
1183920778 22:41165879-41165901 GAGGCAGGAGAGGCTGAGGCAGG - Intronic
1184645494 22:45892591-45892613 GAGGCAGGAGGGGACCTGCCAGG - Intergenic
1184788488 22:46684180-46684202 GAGGCAGGAAGGGATGCGCTTGG + Intergenic
1184878200 22:47288790-47288812 GAGGCTGGTGGGGCTGGGCCAGG + Intergenic
1184981166 22:48096953-48096975 CAGGGAGGAGGGGCTCCTGCAGG - Intergenic
1185065140 22:48628331-48628353 GAAGCAGGAGGGGCTGGGACTGG - Intronic
1185177051 22:49333880-49333902 TGGGCAGGAGGGACCCCGCCTGG + Intergenic
1185184880 22:49393072-49393094 GAGGCAGGAGTGTCTTCCCCTGG + Intergenic
1185255337 22:49828167-49828189 GAGGCAGGTGGGGAGCAGCCGGG + Intergenic
1185330919 22:50251670-50251692 GAGGCAGGTGGCGCTGCGGCCGG + Intronic
1185335738 22:50270205-50270227 GCGGCTGCAGGGGCTGCGCCCGG - Exonic
949982197 3:9508838-9508860 GAGGCAGGAGCGCACCCGCCTGG - Intronic
950170649 3:10837071-10837093 GTGGCAGGAGGGGCTGGCCCTGG + Intronic
950421026 3:12899583-12899605 AAGGCAGCGGGGGCTCCGCCGGG + Intronic
950968963 3:17167611-17167633 GATGCAGAAGGGGCTCTGTCTGG + Intronic
953249909 3:41235717-41235739 TTGGCAGGAGGGGGTCCGCATGG + Exonic
954399622 3:50312203-50312225 AAGTGAGGAGGGTCTCCGCCCGG - Intronic
954695587 3:52423247-52423269 GTGGCAGGAGGAGCTACTCCTGG + Exonic
954743222 3:52771046-52771068 GAGGCCAGAGCGACTCCGCCAGG + Intergenic
954762927 3:52890100-52890122 GGGGAATGAGGGGTTCCGCCTGG - Intronic
956557616 3:70540353-70540375 GAGGAAGGCGGAGCTCCTCCTGG - Intergenic
958768150 3:98395552-98395574 GAGGGTGGAGGGGCACAGCCAGG - Intergenic
959500428 3:107100354-107100376 GAGGGAGGAGGGGCTATGGCAGG + Intergenic
961373591 3:126448016-126448038 GAGGCAGGAAGAGTTCAGCCAGG - Intronic
961558798 3:127714744-127714766 GAGGCAGGAGGGGACCCGGGTGG + Intronic
963776403 3:149445072-149445094 AAGTCAGGAGTGTCTCCGCCCGG - Intergenic
964751666 3:160059351-160059373 GAGGCATGAGGGGCCAGGCCAGG + Intergenic
966711881 3:182980332-182980354 CAGGCAGGAGAGCCCCCGCCTGG + Intronic
966862979 3:184241035-184241057 GAGGCAGGAGGGGTTCCTGGGGG - Exonic
968088364 3:195884908-195884930 GAGGCAGGTGAGGCTCTGCAGGG + Exonic
968222643 3:196949714-196949736 AGGGCAGGAGGGGCTTCCCCGGG + Intronic
968370892 3:198222050-198222072 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
968473561 4:792510-792532 GCGGCAGGAGGCGCTGCGCCAGG - Exonic
968756108 4:2417437-2417459 GAGGCACGGGGCGCGCCGCCCGG + Intronic
968870348 4:3238918-3238940 GAAGCAGGAGAGGCTCCACGTGG - Exonic
968879653 4:3292612-3292634 CAGGCAGGGGCGGCTCCTCCCGG + Intergenic
968941372 4:3640466-3640488 GAGGGAAGAGGGGCTCAGGCGGG + Intergenic
969388351 4:6871999-6872021 GAGGCAGGAGGGTCGCCGCCAGG + Intronic
969458284 4:7313533-7313555 GAGGAAGGAGGGGCTGAGCCCGG + Intronic
969599558 4:8167959-8167981 GAGGAAGGAGGGGCTGCCCTGGG - Intergenic
969621323 4:8280308-8280330 GAGGGAGGAGGGCCTGGGCCTGG + Intronic
970571419 4:17387047-17387069 GAGGGAGGAGGGGCTGGGCATGG + Intergenic
975321952 4:73018800-73018822 GAGGCAGGTGGGGCTCCTGCTGG - Intergenic
975678421 4:76850985-76851007 GAGACAGGAGGGGCGCAGACAGG + Intergenic
976068400 4:81215263-81215285 GAGGAGGGAGGGGGTCAGCCGGG + Intergenic
979259346 4:118633677-118633699 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
979259574 4:118634538-118634560 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
979328800 4:119406086-119406108 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
979329004 4:119406886-119406908 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
981470775 4:145132102-145132124 GAGGCAGGAGAGGCTGAGGCAGG - Intronic
982198527 4:152937766-152937788 GACGCAGCTGGGGCTCCGCGCGG + Intronic
984888828 4:184473758-184473780 GTGGCTGGAGGCGCTCCTCCCGG + Intronic
985232671 4:187838137-187838159 CAGGCATGAGGGACTGCGCCCGG - Intergenic
985259013 4:188097699-188097721 CAGGCAGGTGTGGCTCTGCCTGG - Intronic
985440480 4:189980090-189980112 GAGGCAGCAGGGGCTCGGACTGG - Intergenic
987958209 5:24767902-24767924 TAGGCAGGATGGTCTCTGCCTGG - Intergenic
989071834 5:37519466-37519488 GATGTAGGAGCGCCTCCGCCCGG - Intronic
990581841 5:57173604-57173626 GCGGGAGGAGGGGCTCCTCAGGG + Intergenic
997976772 5:138445647-138445669 GAGGAAGATGGGGCTCAGCCTGG - Intronic
998415360 5:141942145-141942167 GAGGAAGGAGAGGCTTGGCCTGG - Intergenic
999232436 5:150069698-150069720 CAGGCAGGAGGGGCTTGGACTGG + Intronic
999382040 5:151128112-151128134 GAGCCAGGAGAGTCCCCGCCTGG + Intronic
1001053754 5:168432844-168432866 GAGGCAGGAGAGGCTCGGAGAGG - Intronic
1001103587 5:168834184-168834206 GAGACAGGAAGGGCTCAGGCAGG + Intronic
1002021136 5:176365307-176365329 GAGGAAGGAGAGGCTGTGCCTGG - Intergenic
1002297129 5:178237978-178238000 GAGGATGGAGGGGCCCAGCCTGG - Exonic
1002428172 5:179187898-179187920 GAGGAAGGAGCGGCTCTGCATGG + Intronic
1002441606 5:179267208-179267230 GGGTCAGGAGGGGCTCTTCCTGG + Intronic
1002729567 5:181325421-181325443 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1002730126 5:181327606-181327628 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1002754406 6:146493-146515 GAGGCAGGAGGAGCTGGGCCCGG + Intergenic
1002884985 6:1285633-1285655 GAGGCAGAAGGGGCTTCAGCTGG - Intergenic
1003116907 6:3289300-3289322 GAGGCAGGTGGGCCTGAGCCAGG - Intronic
1004745374 6:18503656-18503678 GAAGCATGAGGTGCTCAGCCTGG - Intergenic
1006074930 6:31526125-31526147 GAGGCAGGAGTGGCTCAGAAGGG - Intergenic
1007040266 6:38715324-38715346 GAGGCCGGAGCAGCTCCCCCGGG + Exonic
1007662833 6:43496909-43496931 GAGGCCGGAGGGGCTCTCACAGG + Intronic
1010177298 6:73044006-73044028 CAGGCAGGAGTGACTGCGCCAGG - Intronic
1011698260 6:89932601-89932623 GAGCCAGGCGCGGCTCCCCCCGG - Exonic
1013314398 6:108927209-108927231 GAGGAAGGAGTGGCTGCCCCTGG + Intronic
1015864111 6:137710614-137710636 GAGGAAGGAAGGGCAGCGCCAGG + Intergenic
1016834841 6:148466783-148466805 GAGGCAGGAGGAGAGCAGCCTGG - Intronic
1016886512 6:148964542-148964564 GAGGCAGGAGGAGCGCTACCTGG + Exonic
1017007838 6:150040815-150040837 GAGGCAGGAGCAGCTACACCTGG - Intergenic
1017576539 6:155811252-155811274 TAGGCTGGAGGAGCTCCACCAGG - Intergenic
1018492427 6:164307705-164307727 GAGAGAGGAGGGGCTCCCCATGG + Intergenic
1018853988 6:167662683-167662705 GGTAAAGGAGGGGCTCCGCCAGG - Intergenic
1019319977 7:411126-411148 GGGGCAGGAGAGGCTGCCCCGGG - Intergenic
1019320097 7:411486-411508 GGGGCTGGAGAGGCTGCGCCGGG - Intergenic
1019320134 7:411594-411616 GGGGCAGGAGAGGCTGCGCCGGG - Intergenic
1019320148 7:411630-411652 GGGGCAGGAGAGGCTGCCCCGGG - Intergenic
1019320160 7:411666-411688 GGGGCAGGAGAGGCTGCGCCGGG - Intergenic
1019320217 7:411815-411837 GGGGCAGGAGAGGCTGCCCCGGG - Intergenic
1019320231 7:411851-411873 GGGGCAGGAGAGGCTGCCCCAGG - Intergenic
1019355215 7:575111-575133 GGGGTTGGAGGGGCTCAGCCGGG + Intronic
1019487061 7:1294271-1294293 CAGGTGGGAGGGGCTCCGGCGGG - Intergenic
1019494770 7:1332579-1332601 GAGGCAGGAGGGGGGCTGCGGGG - Intergenic
1019564787 7:1673929-1673951 GAGGCAGGAGGGGGTCCAGCAGG + Intergenic
1019634686 7:2069286-2069308 GCTGCAGGAGGAGCTCCGGCAGG - Exonic
1020235587 7:6352993-6353015 GAGGCAGGAGAGGCTGGGCGCGG - Intergenic
1020273901 7:6613725-6613747 GAGGAGGGAGGGGCTCCTCAGGG + Intergenic
1021231063 7:18086763-18086785 GTGGGAGGAGAGGCTCGGCCGGG - Intergenic
1022514036 7:30964199-30964221 AGGGCAGTAGGGTCTCCGCCAGG - Intronic
1022533996 7:31084612-31084634 GAGGAAGGAGGAGCTAGGCCTGG + Intronic
1022959678 7:35414644-35414666 CAGGCAGGATGGACTCTGCCTGG - Intergenic
1022975173 7:35549949-35549971 GGGGGAGGTGGGGCTCGGCCCGG - Intergenic
1023400791 7:39792208-39792230 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1023401299 7:39794164-39794186 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1024074256 7:45810723-45810745 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1024075285 7:45814806-45814828 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1024648314 7:51386517-51386539 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1024648845 7:51388590-51388612 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1024649078 7:51389475-51389497 GAGGCAGGAGGAGGTGGGCCTGG + Intergenic
1025052164 7:55740986-55741008 GAGGCAGGAGAAGCTGGGCCTGG + Intergenic
1025053156 7:55744805-55744827 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic
1025129123 7:56366669-56366691 GAGGCAGGAGAGGCTGGGCCTGG + Intergenic
1025177510 7:56809558-56809580 GAGGCAGGAGGAGCTGGACCTGG + Intergenic
1025177935 7:56811305-56811327 GAGACAGGAGGAGCTGAGCCTGG + Intergenic
1025181930 7:56827728-56827750 GAGACAGGAGGAGCTGGGCCTGG + Intergenic
1025694254 7:63766695-63766717 GAGGCAGGAGGAGCTGGACCTGG - Intergenic
1026000399 7:66556438-66556460 GATGCTGGAGGGCCTGCGCCAGG + Intergenic
1026898052 7:74021935-74021957 GAGGCAGGCGAGGCTGGGCCAGG - Intergenic
1026947581 7:74326321-74326343 GAGGCAGCAGGCGCTCAGTCTGG - Intronic
1029473454 7:100768744-100768766 CAGGCAGGAGGGGCTGGGCCTGG + Intronic
1031088118 7:117323307-117323329 GAGGGAGGGGGTGCTGCGCCTGG + Intergenic
1032037730 7:128531935-128531957 GAGGCGGGAGGGGCTCCCTGAGG + Intergenic
1032051288 7:128652542-128652564 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1032051799 7:128654529-128654551 GAGGCAGGAAGAGCTGGGCCTGG - Intergenic
1034188347 7:149195887-149195909 GAGGCGGGCGGGGCACGGCCGGG + Intronic
1034951031 7:155297467-155297489 GAGCCGGGAGGGGCGGCGCCGGG + Intergenic
1035287577 7:157816175-157816197 GAGGCAGGAGGCGAGCCGGCAGG - Intronic
1035556287 8:569508-569530 GTGGCAGGAGGGGGTCTGACTGG - Intergenic
1035560880 8:602619-602641 GAGGCTGGAGGGGCACCCGCAGG + Intergenic
1035777997 8:2204045-2204067 GAGACAGGAGTGGCTCCGAGAGG + Intergenic
1036686295 8:10913877-10913899 GAGGCAGGAGGACCTGCGACGGG + Intronic
1036737125 8:11329746-11329768 AAGGGAGGAGCGTCTCCGCCTGG + Intergenic
1036823449 8:11957708-11957730 GTGGCAGGAGGGTCTCCCCTGGG + Intergenic
1037716960 8:21408826-21408848 GAGCCCAGAGGGGCTCTGCCTGG - Intergenic
1037803589 8:22048060-22048082 GCGGCAGGGGCGGCCCCGCCAGG + Exonic
1038309092 8:26431702-26431724 GAGGAAGGAGGGGAGCTGCCTGG - Intronic
1039455473 8:37703122-37703144 GAGGCAGGAGGCTCTCTGGCAGG - Intergenic
1039484854 8:37902426-37902448 GAAGTAGGAGGGGCTCAGCTGGG + Intergenic
1039795254 8:40907418-40907440 GAGGTATGAGGGGCTGGGCCTGG + Intergenic
1039893729 8:41701736-41701758 GACGGAGGAGGCGCTCAGCCTGG + Intronic
1040052825 8:43033110-43033132 AAGTCAGGAGCGTCTCCGCCTGG - Intronic
1040072719 8:43201418-43201440 GAGGCAGGAGAAGCCCCGCTGGG - Exonic
1042865935 8:73356763-73356785 GAGGAGGCCGGGGCTCCGCCTGG - Intergenic
1048573968 8:135676630-135676652 CAGGAAGGAGGGGCTCTCCCTGG - Intergenic
1049199549 8:141333317-141333339 GAGGCTGGAGGGGCTGGGCCTGG + Intergenic
1049235045 8:141508159-141508181 GCGGCAGGAGGGCCGCGGCCTGG + Intergenic
1049365713 8:142235925-142235947 CACGCAGGAGGGGCTTCACCTGG + Intronic
1049559170 8:143299515-143299537 GAGGCAGGAGGATCTCGGCTTGG + Intergenic
1049774851 8:144399508-144399530 GAGGCAGGAGGGGCACTGAGTGG + Intronic
1050009723 9:1173126-1173148 GGGGCAGCAGGGGCCCAGCCCGG - Intergenic
1050498398 9:6268212-6268234 GTGGCAGGAGGGGCCCGGCCAGG + Intergenic
1052853894 9:33395036-33395058 GAAGTGGGTGGGGCTCCGCCAGG - Intronic
1053288469 9:36864788-36864810 CAGCCAGGAGGGGCTCCGAGGGG - Intronic
1053477200 9:38391086-38391108 GAGGCAGGAGGGCCTTGGCAAGG + Intergenic
1056166825 9:83948334-83948356 AAGTGAGGAGGGTCTCCGCCCGG + Intronic
1057182131 9:93035902-93035924 GAGGCAGCATGGGCACTGCCAGG + Exonic
1059118120 9:111617510-111617532 AAGCCAGGAGCGTCTCCGCCCGG - Intergenic
1060475134 9:123981096-123981118 GAGGCAGGAGCTGCTCCACTAGG + Intergenic
1061132433 9:128715425-128715447 GAAGCAGGAGGTGCTCAGCCGGG + Exonic
1061407923 9:130402957-130402979 GAGGCAGGTGGGGCTCAGGATGG + Intronic
1061489336 9:130936563-130936585 GAGGAAGGCGGGGCCCGGCCTGG + Intronic
1061662068 9:132136814-132136836 GAGGAAGGAGGGGCTCAGCTGGG - Intergenic
1062158137 9:135065481-135065503 GAGGCTGGAGGGGTTCCCCAAGG - Intergenic
1062167237 9:135113933-135113955 GAGGCAGGAGGGTCCTCCCCTGG - Intronic
1062205882 9:135336835-135336857 GAGGCTGGAGGGGCTTCCACAGG - Intergenic
1062287817 9:135780915-135780937 GAGGCCGGAGGAGCCGCGCCAGG - Intronic
1062291764 9:135798501-135798523 GAGGCAGGAGGGTGTCCTCAGGG - Intergenic
1062415881 9:136449567-136449589 CAGGCAGGAGCTGCTGCGCCCGG + Intronic
1062461606 9:136664731-136664753 GGGGCAGGAGCTGCTCCTCCGGG - Exonic
1062754541 9:138280120-138280142 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1203577538 Un_KI270745v1:20690-20712 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1203578443 Un_KI270745v1:24280-24302 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1186611025 X:11138833-11138855 GGGGCAGGGGGGGCTCGGCTGGG + Exonic
1189165313 X:38855397-38855419 GAGCCAAGAGGGACTCAGCCAGG + Intergenic
1190233266 X:48598277-48598299 GAGGGAGGTGGGGCTCAGGCAGG + Intronic
1190259736 X:48790356-48790378 GAGGCAGGAGGATCACTGCCGGG + Intronic
1190328219 X:49219586-49219608 GAGGCAGGAGGGGCTAGGGCAGG - Intronic
1190449945 X:50568937-50568959 GAGGCAGAAGGTGCTTCCCCAGG - Intergenic
1190681389 X:52829952-52829974 GAGGAAGGAGGGCCTCGGCATGG - Intergenic
1190738032 X:53268560-53268582 GAGGAAGCAGGGGCCTCGCCTGG - Intronic
1191843745 X:65531260-65531282 TAGGCAGGAGGGTCTCCACCTGG - Intronic
1192947734 X:75984148-75984170 GATGCAGGAGGGTCTCTGCAAGG - Intergenic
1195065398 X:101234529-101234551 GAGGCAGGAGGGGCTGAGCCAGG - Intronic
1197445927 X:126552408-126552430 TAGGCGGGTGGGGCCCCGCCAGG - Exonic
1199215949 X:145260513-145260535 GAGGCAAGAGGGGTTCTGCAGGG + Intergenic
1199586372 X:149420636-149420658 AAGTGAGGAGGGTCTCCGCCCGG + Intergenic
1200210802 X:154345850-154345872 CTGGCAGGAGGTGCCCCGCCAGG - Intergenic
1200220050 X:154386242-154386264 CTGGCAGGAGGTGCCCCGCCAGG + Intergenic
1202239291 Y:22750107-22750129 GAGGCAGGAGGATCACCTCCAGG + Intergenic
1202381081 Y:24276906-24276928 GAGGCAGGAGGAGCTGGGCCTGG - Intergenic
1202392278 Y:24383869-24383891 GAGGCAGGAGGATCACCTCCAGG + Intergenic
1202478506 Y:25286248-25286270 GAGGCAGGAGGATCACCTCCAGG - Intergenic
1202489704 Y:25393220-25393242 GAGGCAGGAGGAGCTGGGCCTGG + Intergenic