ID: 1163554596

View in Genome Browser
Species Human (GRCh38)
Location 19:17984863-17984885
Sequence ACCTGGGGCTCGAGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163554596_1163554608 24 Left 1163554596 19:17984863-17984885 CCTTCTTCACTCGAGCCCCAGGT 0: 1
1: 0
2: 1
3: 7
4: 175
Right 1163554608 19:17984910-17984932 CTCCAGTCCTCCTCCCTCCTTGG 0: 1
1: 0
2: 21
3: 694
4: 8848
1163554596_1163554609 25 Left 1163554596 19:17984863-17984885 CCTTCTTCACTCGAGCCCCAGGT 0: 1
1: 0
2: 1
3: 7
4: 175
Right 1163554609 19:17984911-17984933 TCCAGTCCTCCTCCCTCCTTGGG 0: 1
1: 0
2: 2
3: 48
4: 504
1163554596_1163554611 26 Left 1163554596 19:17984863-17984885 CCTTCTTCACTCGAGCCCCAGGT 0: 1
1: 0
2: 1
3: 7
4: 175
Right 1163554611 19:17984912-17984934 CCAGTCCTCCTCCCTCCTTGGGG 0: 1
1: 1
2: 2
3: 41
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163554596 Original CRISPR ACCTGGGGCTCGAGTGAAGA AGG (reversed) Intronic
900504738 1:3023929-3023951 GCATGGGGCTGGTGTGAAGACGG + Intergenic
900540371 1:3199732-3199754 CCTTGGGGCTCGAGTGCAGCTGG - Intronic
903015988 1:20362142-20362164 ACCTGGGGCTGGAAAGGAGAAGG + Intergenic
905104730 1:35557613-35557635 GGCTGGGGCTCGAGCGAAGGAGG - Intronic
905264409 1:36741067-36741089 GCCAGGGGCTAGAGGGAAGAGGG - Intergenic
906609618 1:47192451-47192473 ACCTGGGACTTGAGTGCTGAGGG - Intergenic
911329177 1:96507249-96507271 ACCTTGTGCTAGAGTGCAGATGG + Intergenic
912203842 1:107488876-107488898 TCCTGGGGCCAGTGTGAAGATGG - Intergenic
912414994 1:109502089-109502111 TCCTGGGGCTTGAGAGAGGAAGG - Intronic
915280112 1:154816655-154816677 AGCTGGGGCAGGAGTGAGGAAGG - Intronic
915331109 1:155112883-155112905 CCCTGGGGCTGGACTGAGGATGG - Intergenic
916317564 1:163467216-163467238 TGCTGGGCCTCTAGTGAAGAAGG + Intergenic
917732665 1:177891740-177891762 GCCTGGGGGTGGAGTGGAGAGGG - Intergenic
921604356 1:217137483-217137505 GCCTGGGGCTCGAGAGCTGACGG + Intronic
922207011 1:223456676-223456698 ACCAAGGGCTCCAGTGGAGAAGG - Intergenic
923763805 1:236873264-236873286 ACCAGGGGATGGAGTGGAGAGGG + Intronic
1062950097 10:1492661-1492683 ACCTGGGACTCGACTAAGGAGGG + Intronic
1067925624 10:50505504-50505526 ACCTGAGGCTGGAGAGGAGAAGG - Intronic
1068000480 10:51328134-51328156 ACCAGGGGCTGGAGTGGGGAGGG - Intronic
1069576767 10:69536186-69536208 ATCTGGGGCTGGAGTCAGGAAGG - Intergenic
1070259578 10:74841642-74841664 AACTGAGGCTCGGGAGAAGATGG - Intronic
1070464276 10:76703859-76703881 CCTTGGGCCTCGAGTGAACATGG + Intergenic
1070798982 10:79233902-79233924 AGCAGGGGCTCTAGTGAAGTTGG + Intronic
1073309841 10:102532513-102532535 ATCTGGGGCTCCAGTGGGGAAGG + Intronic
1075445199 10:122508191-122508213 ACTTGGGGATGGAGTGGAGATGG + Intronic
1081778473 11:45693517-45693539 ACCTTGGACTTGTGTGAAGATGG - Intergenic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1088971006 11:114774746-114774768 AGCTCGGGCTTGAGTCAAGAAGG - Intergenic
1089680969 11:120118712-120118734 GCCTGGGGCAGGAGAGAAGATGG - Intronic
1089800706 11:121024462-121024484 CCCTGGGGCTAGAGGGAGGATGG + Intronic
1093809254 12:23472523-23472545 GCCTGGGGCTGGAGTGAAGTGGG - Intergenic
1095400962 12:41814281-41814303 GCCTGGGGGTAGAGTGAAGGGGG + Intergenic
1096512095 12:52136362-52136384 CCCCAGGGCTCGAGTGAAGGTGG + Intergenic
1096974387 12:55691295-55691317 ACCTAGGGCTGGAGTGGAGGCGG + Intronic
1098030895 12:66252610-66252632 AGCTGGGGCTACAGTGCAGATGG + Exonic
1099226008 12:79970014-79970036 TCCTGGAGCTGAAGTGAAGATGG + Intergenic
1099330603 12:81280454-81280476 ATCAGTGGCTGGAGTGAAGATGG - Intronic
1099585194 12:84505887-84505909 AACTGGGGCTGGAAGGAAGAGGG - Intergenic
1100003054 12:89860519-89860541 GCCTGGGGATGGAGTGAGGAAGG + Intergenic
1100276889 12:93079737-93079759 ACCAGGGGCTGGGGGGAAGAGGG + Intergenic
1102257677 12:111425532-111425554 GCCTGGGGTTCGAGGGAACAGGG + Intronic
1102696594 12:114804487-114804509 GCCTAGGGCTGGAGGGAAGAGGG - Intergenic
1103520716 12:121535913-121535935 ACCTGGGGCTCTAGTGGGAAGGG - Intronic
1106719659 13:32425442-32425464 TCCTGGCTCTGGAGTGAAGAAGG - Intronic
1107131683 13:36903080-36903102 ACCTTGGGCTCTAGTGCCGAGGG + Intronic
1107158543 13:37198196-37198218 GCCTGGGGGTGGAGTGGAGAGGG + Intergenic
1107596905 13:41972875-41972897 ACCAGGGGCTAGGGTGAAGTTGG - Intergenic
1109400593 13:61822866-61822888 AACTGTGGCTCAAGGGAAGATGG + Intergenic
1111041607 13:82756761-82756783 GCCTGGGGCTAGAGTAGAGAGGG - Intergenic
1112684963 13:101814220-101814242 ACCTGGGGATCTAGTTAAAATGG - Intronic
1112800756 13:103107419-103107441 ACCTGGGGCTGCAGTAATGAAGG - Intergenic
1115192528 14:30760981-30761003 ACCTGGAGCTGGAGAGATGACGG - Intergenic
1115788198 14:36849956-36849978 CCCTGGGGATCAAGTGAAGGAGG + Intronic
1118397470 14:65349637-65349659 GCCTTGGGCACGAGTGCAGATGG - Intergenic
1118809245 14:69261309-69261331 ACCTGGGGCTCGGACGGAGACGG - Intronic
1119656945 14:76423967-76423989 GCCAGGGGCTCCAGTGAAGCAGG - Intronic
1122897782 14:104768976-104768998 ACCTGGGGCTGGGGGGCAGATGG + Intergenic
1123476899 15:20597015-20597037 ACATGGGGCTGTGGTGAAGAAGG + Intergenic
1123641112 15:22403349-22403371 ACATGGGGCTGTGGTGAAGAAGG - Intergenic
1127283546 15:57512905-57512927 ACCTGGGGCTGGAGTAGGGATGG - Intronic
1129156162 15:73719493-73719515 ACATGGTGCTGGAGGGAAGAGGG - Intergenic
1131541001 15:93275351-93275373 ACCTGGGGATCCAGTCAACACGG - Intergenic
1133180308 16:4049257-4049279 ACCTGGGACCAGAGAGAAGAGGG + Intronic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1142183780 16:88684963-88684985 AGCTGGGGCTACAGTGAGGAGGG + Intronic
1143477545 17:7211412-7211434 AACTGGGGCTCTGGTGAGGAGGG - Intronic
1144156438 17:12508631-12508653 ATCTGGGGCTGGAAAGAAGAGGG - Intergenic
1144166875 17:12620860-12620882 TCCTGGGGTTAGGGTGAAGAAGG - Intergenic
1145739143 17:27257678-27257700 GCCTGTGGCTGGAGTGGAGATGG - Intergenic
1146847822 17:36195630-36195652 ACTTGGGGCTGGAGTGAGGTGGG - Intronic
1147312468 17:39603696-39603718 AGCTGGGGCTGGGGTGATGAAGG - Intronic
1147421171 17:40322834-40322856 ACCTGGAGCTGGAGGGAAGGGGG - Intronic
1148734195 17:49855578-49855600 ACCTGGGGCTTGGGAGAAGAGGG + Intergenic
1149075633 17:52594348-52594370 CCCTGGGCCTTGAGTGAACATGG - Intergenic
1149114234 17:53072507-53072529 ATCTGGGGATAGAGTGGAGAGGG + Intergenic
1151850696 17:76688015-76688037 AGCTGGGGTTCGAGTGCCGAGGG - Intronic
1153583540 18:6598976-6598998 ACCTGGGGCTGGATTGAGGTTGG + Intergenic
1153903397 18:9638636-9638658 ACCTGGGGCTTGGGCGCAGAGGG - Intergenic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1157087499 18:44596560-44596582 AGCTGAGGCTAGAGTTAAGAAGG - Intergenic
1158406354 18:57163216-57163238 AACTGGGGCTGGAATGAAGTGGG - Intergenic
1160782545 19:884290-884312 TCCTGGGGCTGGAGCGAAGCAGG - Intronic
1161591491 19:5131204-5131226 ACCGGGGGCTCCAGTGGGGATGG - Exonic
1163554596 19:17984863-17984885 ACCTGGGGCTCGAGTGAAGAAGG - Intronic
1166215287 19:41330922-41330944 ACCTGGGGCCCCATTAAAGATGG - Exonic
1166393867 19:42424839-42424861 TCCTGGGGCTCCTGTGAAGCAGG + Intronic
1167449826 19:49560549-49560571 ACCTGGGGCACGAGGGGAGAGGG + Intronic
925256276 2:2491293-2491315 TCCTGGGGCACTAGTGAAGGGGG + Intergenic
928210934 2:29323100-29323122 ACCTGAGGCTCTAAGGAAGAAGG - Intronic
928251539 2:29685605-29685627 ACCTGGGGCACGATTCTAGAAGG - Intronic
931489429 2:62727483-62727505 ACCTGGGGGTTGAGTGGGGAGGG - Intronic
931818720 2:65930325-65930347 TCCTGGGGCTGGAGCCAAGATGG - Intergenic
932581599 2:72995761-72995783 ACCTGGGGTTCCAGAGAACAAGG + Intronic
932854633 2:75220376-75220398 ACCAGGGGCTAGGGGGAAGAGGG - Intergenic
932872398 2:75415170-75415192 ACCAAGGGCTAGAGTGAAAAAGG - Intergenic
935186633 2:100740134-100740156 ATCTGAGGCTGGAGTGGAGAAGG - Intergenic
936718869 2:115224508-115224530 ACCTGGAGCTGGAGGGAAGGTGG + Intronic
939140352 2:138346717-138346739 ACCTGGGGAGAGAGTGTAGAGGG - Intergenic
939318748 2:140587557-140587579 ACCAAAGGCTGGAGTGAAGATGG + Intronic
940223753 2:151381131-151381153 ACTTGGGGCAAGAGGGAAGATGG - Intergenic
942057482 2:172198152-172198174 GCCTGGGGCTGGGGTGAGGATGG + Intergenic
944536655 2:200717099-200717121 GACTGGGGCATGAGTGAAGATGG - Intergenic
944942683 2:204646554-204646576 ACCTGGGGCTATTGTGAACAGGG + Intronic
945974656 2:216260793-216260815 ACCTGTGGCACCTGTGAAGAGGG + Intronic
946450027 2:219771838-219771860 ACCTGGGGATAGACTGAAGAAGG - Intergenic
947579604 2:231306909-231306931 ACCTGTGGCTCTGGTCAAGAAGG - Intronic
1169123632 20:3111889-3111911 GCCTGGTGCCCGAGTGTAGATGG - Intronic
1169909771 20:10637779-10637801 ACCTGGGGCTGCTGTGAAGCTGG - Exonic
1171413058 20:24959290-24959312 TCCTGGGGTGCGAGTGGAGAGGG + Intronic
1173002795 20:39116934-39116956 ACCAGGGGCTGGAGAGAGGAGGG - Intergenic
1175694402 20:61090653-61090675 ACCTGGGGCTGCAGTTTAGATGG - Intergenic
1175748214 20:61476540-61476562 ACCTGGGGCTGGAGAGTTGAAGG + Intronic
1181413539 22:22743503-22743525 ACCTGTGGCTTGAGTGAGGTGGG - Intronic
1181515003 22:23405237-23405259 ACCTGGGGCTCGGCTGAGCAGGG + Intergenic
1183598371 22:38825788-38825810 ACCTGGGGATGGAGGGAGGAAGG - Intronic
949170649 3:992309-992331 ACCTGGGGCTAGAGTTTAGTTGG - Intergenic
951193956 3:19803702-19803724 GCCTGGGGGTGGAGTGGAGAGGG - Intergenic
955182935 3:56688794-56688816 ACCAGGGGCTAGAGAGAAGGGGG + Intergenic
957219922 3:77369143-77369165 TCCTGGGACTAGAGTGAAGCAGG + Intronic
958433644 3:94071885-94071907 ACCTGGGGCTGGAGGGAAAGTGG - Intronic
968748055 4:2371107-2371129 ACTTGGAGCTGGAGAGAAGATGG + Intronic
969207112 4:5655376-5655398 TCATGGGGCTGGAGTGAGGAGGG + Intronic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
976307021 4:83570199-83570221 GCCTGGGGCCAGAGAGAAGAAGG - Intronic
978635604 4:110801894-110801916 GCCAGGGGCTAGAGTGAGGAGGG + Intergenic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
980781187 4:137494491-137494513 AGCTGAGGCTCAAGTGAGGAAGG + Intergenic
981739286 4:147985343-147985365 GCCTGGGGGTGGAGTGTAGAAGG + Intronic
983918338 4:173316193-173316215 ACATGGGGCTGGAGTGGAGTGGG - Intronic
984563710 4:181301915-181301937 ACCTGGCGTTGGGGTGAAGAGGG - Intergenic
985145886 4:186894098-186894120 ACCTGGCACTCTGGTGAAGATGG - Intergenic
987259434 5:16188550-16188572 AGCTGGGTCTTGGGTGAAGAGGG + Intergenic
987564327 5:19564889-19564911 CCATGGGCCTTGAGTGAAGATGG + Intronic
987626465 5:20407081-20407103 ACCTGGGGGTCTAGTGTATATGG - Intronic
988481948 5:31638916-31638938 ACCTGGGGATCGTGGGAGGAAGG - Intergenic
991268911 5:64756320-64756342 ACTAGGGGCTAGAGGGAAGAGGG - Intronic
995167380 5:109060144-109060166 TCCTGGGGCTGGGGTGTAGATGG + Intronic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
1003495978 6:6663541-6663563 AGCTGGGGCTTGAGTACAGATGG + Intergenic
1003613290 6:7632299-7632321 ACCTGGAGCCCGGATGAAGATGG - Intergenic
1003844818 6:10162099-10162121 ACCTGGTGCTCAAGGGAATACGG - Intronic
1005493367 6:26367824-26367846 ACCAGGGAATCCAGTGAAGAGGG + Intronic
1005502603 6:26443216-26443238 ACCAGGGAATCCAGTGAAGAGGG + Intronic
1006174236 6:32112322-32112344 AACTGGGGGTCGGGTGAGGATGG + Intronic
1006770240 6:36547149-36547171 ACCCCGGGATGGAGTGAAGACGG + Intronic
1008631728 6:53368340-53368362 ACCAGGGGCTGGAGGGAGGAGGG + Intergenic
1010554790 6:77265772-77265794 ACATAGGGCTCTAGTAAAGAGGG - Intergenic
1012972761 6:105749205-105749227 AACTGAGGCTGGAGTGAACATGG - Intergenic
1014697613 6:124643217-124643239 AACTGCGGCTAGATTGAAGAGGG - Intronic
1015518574 6:134109449-134109471 ACCTTGGGATGGAGTGAAGTGGG + Intergenic
1016233977 6:141839086-141839108 ACATGGGGCTGGAGGCAAGAGGG + Intergenic
1016706914 6:147119470-147119492 GCCAGGGGCTGGAGGGAAGAGGG + Intergenic
1019024296 6:168944141-168944163 AGCTGAGGCTTGAGTGAAGACGG + Intergenic
1019380283 7:718118-718140 ATCTGAGGCTCGACTGAGGAAGG - Intronic
1022811548 7:33873528-33873550 ACCTGGGGCTGTGGTGGAGATGG + Intergenic
1026369059 7:69680606-69680628 ACCAGGGGCTGGAGGGAACAAGG - Intronic
1026907153 7:74069071-74069093 ACCTGGGGCTCCTCTAAAGATGG + Intronic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1030237958 7:107287638-107287660 GCCTGGGGATGGAGTGAGGAAGG - Intronic
1030434151 7:109493926-109493948 ACTTAGGTCTTGAGTGAAGATGG + Intergenic
1030847734 7:114442298-114442320 ACCTGGGGCCGGAGGTAAGAAGG + Intronic
1033232597 7:139613241-139613263 TCCTGGGGCTTGAGTGACGATGG + Exonic
1033531626 7:142269721-142269743 ACATGGGGGTTGAGTGAAGCAGG + Intergenic
1034278298 7:149834002-149834024 TCCTGGGGCTCGAGGGAAGAGGG + Intergenic
1034473869 7:151271363-151271385 ACCTGAGGCCCAAGTGTAGAAGG - Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1038455686 8:27670879-27670901 ACCTGAGGTTGGAGAGAAGATGG - Exonic
1038694058 8:29789888-29789910 ACCAGGGGCTGGAGGGAGGAAGG + Intergenic
1038942326 8:32318967-32318989 ATCTGGGCCTCAAGTGATGAAGG - Intronic
1039490012 8:37940328-37940350 ACCTGGGGCTAGAGAAGAGAAGG - Intergenic
1040745656 8:50638521-50638543 ACTGGGTGCTCCAGTGAAGAAGG + Intronic
1042473104 8:69213716-69213738 ACCTGGCCCTTGAGTGATGAGGG - Intergenic
1045204989 8:100029189-100029211 ATCTGGGGCTCGACTGGGGAAGG - Intronic
1045459373 8:102412687-102412709 AACTGGGGCAGAAGTGAAGATGG - Exonic
1045727090 8:105186419-105186441 GCCTGGGGGTGGAGTGGAGATGG + Intronic
1047370805 8:124254249-124254271 GGCCGGGGCTGGAGTGAAGATGG + Intergenic
1057772209 9:97978752-97978774 ACCAGGGTCTAGAGTGAAAAAGG + Intergenic
1057910545 9:99016721-99016743 AGCTTGGGCTTGTGTGAAGAGGG + Intronic
1061306728 9:129736650-129736672 ACCTGGGGCGTGGGTGAAGGAGG - Intergenic
1192079285 X:68032143-68032165 ACCTGGGGCACTGATGAAGAAGG + Intergenic
1193780896 X:85699620-85699642 TCCTGGGGGTGGAGTCAAGATGG - Intergenic
1197408747 X:126089177-126089199 ATCTGGGGCTCTGATGAAGAGGG + Intergenic
1199730014 X:150622730-150622752 GTCTGGGGCTTGAGTGATGAGGG + Intronic