ID: 1163555942

View in Genome Browser
Species Human (GRCh38)
Location 19:17992958-17992980
Sequence CCCCGGGAGGTGGGCAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 1, 2: 6, 3: 80, 4: 571}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163555935_1163555942 -10 Left 1163555935 19:17992945-17992967 CCTAGGGTGGCATCCCCGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG 0: 1
1: 1
2: 6
3: 80
4: 571
1163555921_1163555942 20 Left 1163555921 19:17992915-17992937 CCTCGGCCATCTGGGAACCCCGC 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG 0: 1
1: 1
2: 6
3: 80
4: 571
1163555919_1163555942 22 Left 1163555919 19:17992913-17992935 CCCCTCGGCCATCTGGGAACCCC 0: 1
1: 0
2: 1
3: 7
4: 131
Right 1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG 0: 1
1: 1
2: 6
3: 80
4: 571
1163555931_1163555942 1 Left 1163555931 19:17992934-17992956 CCGCGCGGGGCCCTAGGGTGGCA 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG 0: 1
1: 1
2: 6
3: 80
4: 571
1163555934_1163555942 -9 Left 1163555934 19:17992944-17992966 CCCTAGGGTGGCATCCCCGGGAG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG 0: 1
1: 1
2: 6
3: 80
4: 571
1163555930_1163555942 2 Left 1163555930 19:17992933-17992955 CCCGCGCGGGGCCCTAGGGTGGC 0: 1
1: 0
2: 3
3: 13
4: 141
Right 1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG 0: 1
1: 1
2: 6
3: 80
4: 571
1163555924_1163555942 14 Left 1163555924 19:17992921-17992943 CCATCTGGGAACCCCGCGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG 0: 1
1: 1
2: 6
3: 80
4: 571
1163555920_1163555942 21 Left 1163555920 19:17992914-17992936 CCCTCGGCCATCTGGGAACCCCG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG 0: 1
1: 1
2: 6
3: 80
4: 571
1163555928_1163555942 3 Left 1163555928 19:17992932-17992954 CCCCGCGCGGGGCCCTAGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG 0: 1
1: 1
2: 6
3: 80
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163555942 Original CRISPR CCCCGGGAGGTGGGCAGGGT TGG Intronic
900399330 1:2466593-2466615 GCCCCGGATGTGGGCAGGGCAGG - Intronic
900404782 1:2487745-2487767 GCCCCAGAGGTGGGCAGGGTAGG + Intronic
900480252 1:2894730-2894752 CCCAGGAAGGAGGTCAGGGTGGG - Intergenic
900501726 1:3009148-3009170 CCACAGGAGGTGGGCATGGAAGG - Intergenic
900506096 1:3030395-3030417 TGCCGGGAGCTGGGCAGAGTCGG + Intergenic
900788803 1:4666253-4666275 ACCCAGGAGGAGGGCAGGGCAGG + Intronic
900793261 1:4693101-4693123 CCCAGGGAGGTTGACAGGGCTGG + Intronic
900806787 1:4772759-4772781 CCCCTGGACGTGGGCAGTGGCGG + Intronic
900948342 1:5843852-5843874 GCCCTGGAGCTGGGCAGGGGAGG - Intergenic
900992509 1:6104449-6104471 CCTCCGGAGGTGGGCAGGGTAGG + Exonic
900995672 1:6122024-6122046 CCCCGGGAGGTGGGCACAGCCGG + Intronic
901075757 1:6554029-6554051 CCCCGGGAGAGCTGCAGGGTAGG - Intronic
901397202 1:8990034-8990056 CCCCGGGAGGTTGGTGGGGGCGG + Intergenic
901497621 1:9630903-9630925 CCCTGGGAGGCTGGCTGGGTTGG + Intergenic
901658243 1:10782784-10782806 CCCTGGGAGGGGGGAAGGCTGGG + Intronic
902228812 1:15014336-15014358 CCCTGCAAGGTGGGCAGGGTGGG - Intronic
902378307 1:16040722-16040744 CCCCCGGGGGAGGGCAGGGATGG - Intergenic
902395532 1:16130485-16130507 CCTATGGAGGTGGGCAGGGGAGG + Intronic
902400099 1:16152873-16152895 CCCTGGGAGGGGGCCGGGGTTGG - Intronic
902550019 1:17213792-17213814 CCACAGGAGGCGGGCAGGGGTGG + Intronic
903072175 1:20731972-20731994 CGCCGGGAGCCGGGCAGGGGCGG - Intronic
903130882 1:21279012-21279034 ACCCGGGAAGTGGGCAGCGTGGG - Intronic
903213819 1:21832464-21832486 CCCCTGTAGGTGGGGAGGCTGGG + Intronic
903240712 1:21980953-21980975 CCCGGGCAGCTGGGGAGGGTGGG + Intronic
903469121 1:23573092-23573114 CCCTGGGAGGGAGTCAGGGTTGG - Intergenic
903846005 1:26280285-26280307 CCCCAGGACGGGGGCGGGGTGGG + Intronic
904010757 1:27388848-27388870 ACCTGGTAGGTGGGAAGGGTTGG + Intergenic
904093438 1:27960375-27960397 CCCCGGGAGGGGAGGAGTGTCGG + Intronic
904198273 1:28802215-28802237 CCTCAGGAGGTGAGCAGGGGAGG + Intergenic
904537400 1:31208935-31208957 CCCTGGGAGGTGAGAAGGGTAGG - Intronic
904621008 1:31775312-31775334 CCCCGGCAGCTGGGTAGGATTGG - Intergenic
904641922 1:31937862-31937884 CCCCGGAAGGAGGGCCGGGCCGG - Intronic
904768489 1:32868435-32868457 CACTGGGAGGTGGGCAGGAGCGG - Intronic
905037801 1:34929304-34929326 CCCCGGGAGGGGGGAGGGGCTGG - Intronic
905104600 1:35557189-35557211 CCCCGGTAGGTGGCCGGGGGCGG - Exonic
905137473 1:35810589-35810611 CTCTGGGAGGTAGGCAGGGCAGG + Intronic
905166872 1:36088197-36088219 CTGCAGGAGGAGGGCAGGGTTGG + Exonic
905631846 1:39523130-39523152 CCCAGGGGGCTGGGCAGGATGGG - Intronic
905665916 1:39763057-39763079 CCCAGGGGGCTGGGCAGGATGGG + Intronic
905774640 1:40660752-40660774 ACCCGGGAGGTAGGGAGGGAGGG + Intronic
905807955 1:40890534-40890556 CCCCAGGAGGTGGTGGGGGTAGG + Intergenic
906058267 1:42932273-42932295 CCGTGGGAGCTGGCCAGGGTGGG - Intronic
906608980 1:47189327-47189349 CCCTGGGAGGTGGGCAGGGTGGG + Intronic
907640618 1:56185726-56185748 CAGCGGGAGCTGGGCAGAGTTGG + Intergenic
908534858 1:65067524-65067546 CCGCGGGAGGCGGGCTGCGTGGG - Intergenic
909352721 1:74673543-74673565 CCGCGGCAGGTGCGGAGGGTGGG + Exonic
911101736 1:94100960-94100982 TCCTGGGAAGTGGGCAGGGAGGG + Intronic
911144954 1:94542361-94542383 CCCCGCGAGGTGGGCAGGCCAGG - Intergenic
912391570 1:109306819-109306841 CCATGGCAGGTGGGGAGGGTGGG - Intronic
912505163 1:110151011-110151033 GCCCGGGACGAGCGCAGGGTCGG - Intronic
912715845 1:111982988-111983010 CTCCTGGAGCTCGGCAGGGTGGG + Intronic
913294805 1:117309033-117309055 CCCTGGGAGGTAGGCAGGTCAGG - Intergenic
913529157 1:119721239-119721261 CTCCAGGTGGTGGGCAGGGCTGG + Exonic
914802941 1:150974089-150974111 GCCTGCGAGGTGGGCACGGTGGG + Intronic
914900514 1:151708940-151708962 GCCTGGCAGGTGGGCAGGGTGGG + Intronic
914942737 1:152037067-152037089 GCCCGGGAGGCGGGGAGGGGCGG - Intronic
915443713 1:155962531-155962553 CCCCATGAGTTGGGGAGGGTGGG + Intronic
915473707 1:156140244-156140266 CCCCTGGAGCAGGGCAGGGCTGG - Intergenic
915555922 1:156660804-156660826 GCCCAGGAGCTGGGCAGGGATGG - Intergenic
915634105 1:157174369-157174391 CCGAGGGAGGAGGGCAGGGCTGG + Intergenic
916386792 1:164282009-164282031 CCACTGAAGGTGGGCAGGGCAGG + Intergenic
916588274 1:166166537-166166559 GCCCGGGCGGAGGGCAGGGAGGG + Exonic
916792626 1:168137029-168137051 CGCCGGGAGCTGGGCGGGGCGGG - Intronic
917512294 1:175678544-175678566 ACAGGGGAGGTGGGCAGGGCAGG - Intronic
919835416 1:201569955-201569977 CCCCAGGAGCTGGACAGGGCAGG - Intergenic
919991350 1:202710140-202710162 TCCCGAGAGGTGAGTAGGGTTGG - Intronic
920054908 1:203184641-203184663 CACAGGGAGGTGGGGAGGGCAGG + Intronic
920558645 1:206922925-206922947 CCATGTGAGGTGGGCAGGGTAGG - Intronic
921838987 1:219808378-219808400 TCCTGGGAGGTGGCCAGGGTGGG + Intronic
921964508 1:221074148-221074170 GGGTGGGAGGTGGGCAGGGTTGG + Intergenic
922572384 1:226641866-226641888 CCCCCTGAGGTGGGCACGGGTGG + Intronic
922988300 1:229883906-229883928 CCCAGGGAGCTGGGCACAGTGGG + Intergenic
1064381344 10:14844223-14844245 CCCTGTGAGGTAGGCAGGGCAGG - Intronic
1065699237 10:28408905-28408927 CTGCAGGAGGTGGGCAGGTTTGG - Intergenic
1065846324 10:29746631-29746653 TCCAGGGTGGTGGGCAGGTTTGG + Intergenic
1065883865 10:30059621-30059643 CCCCGGGCGGTGGGCGGGGCGGG - Intronic
1066449977 10:35520090-35520112 CACTGGGAGCTGGGCAGGGTGGG + Intronic
1067768698 10:49108465-49108487 GCCCTGGAGCAGGGCAGGGTAGG + Intronic
1069462909 10:68611831-68611853 GCTCGGGAGGTGGGGGGGGTGGG + Intronic
1069557873 10:69409184-69409206 CCCTGGGAGGCGCCCAGGGTGGG - Intronic
1069637184 10:69932041-69932063 CTGCGGGAGGTGGGGAGGGCAGG - Intronic
1069718042 10:70533118-70533140 CCCATGGAGGTGCTCAGGGTGGG + Intronic
1070151336 10:73807038-73807060 CCCAGGGAGGTGGACAGTGAAGG + Intronic
1070664950 10:78336291-78336313 CCCTGGGAGGTAGGCAGGGATGG + Intergenic
1070669869 10:78370231-78370253 CCCCAGGATGTGGACAGGATAGG + Intergenic
1072537039 10:96371700-96371722 CCCAGGCAGGTGGGGAGGGTGGG - Intronic
1073063607 10:100745978-100746000 CCCGGGGCGGTGGGCCGGGCCGG - Exonic
1073133399 10:101205394-101205416 CGCCGGGAGCTGGGCAAGGTAGG - Intergenic
1073288606 10:102402565-102402587 GCCTGGCATGTGGGCAGGGTGGG - Intergenic
1074868745 10:117560949-117560971 TCAGGGGAGCTGGGCAGGGTGGG - Intergenic
1075706712 10:124506635-124506657 CTTAGGGAGGTGGGGAGGGTAGG + Intronic
1076067466 10:127460067-127460089 CCATGGGAGGTGTGCAGGGGAGG - Intergenic
1076417282 10:130300861-130300883 CCCCGGCAGGCGGGCACTGTAGG - Intergenic
1076523483 10:131095310-131095332 TCCCGAGAGGCGGGCAGGGCTGG + Intronic
1076546080 10:131246438-131246460 GGCTGGGAGGTGGGCAGGGCAGG + Intronic
1076635562 10:131880113-131880135 GCCCTGGAGGCAGGCAGGGTGGG + Intergenic
1076833531 10:133008642-133008664 GCCCGGGAGCTGGGCGGGGAAGG + Intergenic
1076843376 10:133057355-133057377 CACAGGGAGGAGGGCAGGGCAGG + Intergenic
1077111516 11:864166-864188 CCCAGGGATGGGGGCAGGGGAGG + Intronic
1077160322 11:1109703-1109725 GCCTGGGGGGTAGGCAGGGTGGG + Intergenic
1077226049 11:1439592-1439614 GCCCAGGAGGTGGGCATGGCCGG + Intronic
1077236930 11:1486361-1486383 CCCAGGAAGGAGGTCAGGGTGGG - Intronic
1077340036 11:2022129-2022151 CACTGGGAGGAGGGCAGGGAGGG + Intergenic
1078085622 11:8231661-8231683 GCCGGGGAGGTGGGGAGGGGTGG - Intronic
1078355118 11:10627287-10627309 CCCCTCGATGTGAGCAGGGTGGG + Intronic
1078364148 11:10692898-10692920 GCCCTGGAGGTGAGCAGGGCCGG + Intronic
1078432280 11:11297493-11297515 CCCAGGGAGGTGGGCAAGGGAGG - Intronic
1078561494 11:12377236-12377258 CCCCGGGAGAGTAGCAGGGTTGG + Exonic
1078715682 11:13836905-13836927 CCCTGGGAAGTGGACAGGGAGGG + Intergenic
1078916519 11:15783734-15783756 CCCAGGGAGGTGTGCAGTGCAGG - Intergenic
1079026132 11:16949261-16949283 CCCCTGCAGGTGGGAAGGGGTGG + Intronic
1079128737 11:17735615-17735637 CCCCGGGAGGTGGGGAAAATGGG - Exonic
1079330442 11:19528515-19528537 CTCCGGCAGGTGGGCAGAGGCGG + Intronic
1081614993 11:44585557-44585579 CTGCGGTAGGTGGGCGGGGTTGG + Intronic
1081733642 11:45388807-45388829 TCCTGGGAGGTGGGCAAGGCAGG + Intergenic
1081778851 11:45695994-45696016 CCCTGTGAGGTAGGCAGGATGGG - Intergenic
1082795710 11:57376577-57376599 CCCCGGGCGTGGGGTAGGGTTGG - Intergenic
1083222785 11:61264509-61264531 CCCAGGAAGCAGGGCAGGGTCGG + Exonic
1083474680 11:62908408-62908430 TGCAGGGATGTGGGCAGGGTTGG + Intergenic
1083528952 11:63398689-63398711 TGCTGGGAGATGGGCAGGGTTGG + Intronic
1083781957 11:64923383-64923405 GCCTGGGAGGTGGGCAAGGAGGG + Intronic
1084083776 11:66845400-66845422 CCCCGGGGGGAGGGGATGGTCGG + Intronic
1084129112 11:67119584-67119606 CCCCGGGGGGCGGACAGGGCGGG - Intronic
1084153207 11:67300792-67300814 CCCAGGGAGGAGGGCAGCTTGGG + Intronic
1084180027 11:67441583-67441605 CCCAGGGTGGTGGGCAGAGTGGG - Intronic
1084214328 11:67639394-67639416 CCAGGGTGGGTGGGCAGGGTGGG - Intronic
1084420393 11:69057810-69057832 CCATGGGAGGTGGGCAGTGCTGG - Intronic
1084517029 11:69642803-69642825 CCCCGCGAGGCTGGCACGGTGGG - Intronic
1084621346 11:70271807-70271829 CCCAGTGGGGTGGGGAGGGTGGG - Intronic
1084816197 11:71648313-71648335 GCTCTGGAGGGGGGCAGGGTGGG + Intergenic
1084932891 11:72571076-72571098 CCGCTGGAGGTGGTGAGGGTCGG - Intergenic
1085170114 11:74442534-74442556 CCCTCTGAGGTGGACAGGGTAGG + Intergenic
1085509697 11:77082041-77082063 CCCCTGGAGGGGCACAGGGTAGG + Intronic
1087241775 11:95789360-95789382 CTCCGGGAGGCGGGCGGGATGGG - Intronic
1087377949 11:97367823-97367845 CCTTGGGTGGTGGGCAGGGTGGG + Intergenic
1087490654 11:98822935-98822957 CTTGGGGCGGTGGGCAGGGTGGG + Intergenic
1088583202 11:111334912-111334934 CCCGGGGAGCTGTGCAGGGCAGG + Intergenic
1088749448 11:112831429-112831451 CCCCTGGAGATGTGGAGGGTTGG + Intergenic
1088847168 11:113678293-113678315 TCCTGGGAGGTGGGCAGGCATGG - Intergenic
1089491461 11:118886739-118886761 TCCCGGCTGGTGTGCAGGGTGGG - Intronic
1089582889 11:119492569-119492591 CCCCGGGAGGTCACCTGGGTTGG - Intergenic
1089586334 11:119512139-119512161 CGTGGGGAGGTGGGCAGGGGCGG + Intergenic
1089607053 11:119647551-119647573 CCAGAGGAGGTGGGCAGGCTGGG - Intronic
1089613375 11:119681818-119681840 GCCCTGGTGATGGGCAGGGTGGG + Intronic
1089765267 11:120758507-120758529 CCACGGGAGGTGGGCAATGCTGG - Intronic
1090226092 11:125073115-125073137 CACCTGGAGGAGGGCAGGGCTGG + Intronic
1090461019 11:126891745-126891767 TCCCTGGAGATGGGCAGGGCTGG + Intronic
1090805142 11:130197986-130198008 CCATGGGACGCGGGCAGGGTGGG - Intronic
1091221256 11:133931234-133931256 ACTCGGGAGGAGGGCAGCGTGGG - Intronic
1091353521 11:134916191-134916213 CCTCAGGAGGAGGGCAGGGTGGG - Intergenic
1202823021 11_KI270721v1_random:77318-77340 CACTGGGAGGAGGGCAGGGAGGG + Intergenic
1091498383 12:991522-991544 GCCCGGGGGGTGGGGAGGGGCGG + Intronic
1091657319 12:2355070-2355092 CCCGGGGAAGCGGGCAGAGTTGG - Intronic
1091805525 12:3353352-3353374 CCCCAGCAGGTGGGCAGCCTGGG - Intergenic
1093685260 12:22046842-22046864 ACCCGGGAGGAGGGGACGGTTGG - Intronic
1095956360 12:47808613-47808635 TCCCGGGAGTTGGACAGGGCTGG - Intronic
1095983109 12:47983806-47983828 CCAGGGGAGGTCAGCAGGGTGGG + Intronic
1096515196 12:52151908-52151930 GCCCAGGAGGTGGGCAGAGCTGG - Intergenic
1096515359 12:52152503-52152525 CGGCGTGGGGTGGGCAGGGTGGG - Intergenic
1096741348 12:53696118-53696140 CCCCCGGGGGCGGGGAGGGTGGG - Intergenic
1096788645 12:54031852-54031874 ACCTGGGGGGTGGGCAGGGCAGG - Intronic
1098425887 12:70365907-70365929 CCCCGGGAAGCGGGCACGGGTGG - Intergenic
1100655141 12:96635988-96636010 CTCCAGGAGGTGGGAGGGGTGGG + Intronic
1101376752 12:104177945-104177967 CCCAGTGAGGAGGTCAGGGTGGG - Intergenic
1101443910 12:104723608-104723630 CCCTGGGAGGTGGTAAGAGTTGG + Intronic
1101778187 12:107812911-107812933 CCCCGAGAGATGGGCAGAGCAGG + Intergenic
1102214496 12:111150749-111150771 CCTCGGGGGGTGGGAGGGGTGGG + Intronic
1102257628 12:111425338-111425360 CCACTGCAGGTGGGCAGCGTGGG + Intronic
1102418867 12:112788146-112788168 ACCAGGGAGGTGGGCAGGATGGG + Intronic
1102442862 12:112977069-112977091 CACCGAGAGGTAGGCAGGCTGGG - Intergenic
1102960855 12:117092473-117092495 CCCAGAGAGGAGGGCAGGGGAGG + Intronic
1103166467 12:118774290-118774312 CCCCGCGTGGTAGGCAGTGTGGG - Intergenic
1103559749 12:121787300-121787322 CCCTGGGAGGTGCGCTGGGTGGG + Intronic
1103603271 12:122067899-122067921 CCCTGGGAGGTGGGCAGGTCAGG - Intergenic
1104096108 12:125559601-125559623 CCCCGGGAGGTCAGCAGGAAAGG - Intronic
1104278461 12:127352223-127352245 CCCAGGGAGGTCAGCAGGGAAGG + Intergenic
1104568477 12:129904568-129904590 CCCTGGGAGATGCGCAGGGCGGG - Intergenic
1104754128 12:131258376-131258398 CCTGGGGAGCTGGGCGGGGTAGG + Intergenic
1104778734 12:131406066-131406088 CCTGGGGAGGTAGGTAGGGTCGG - Intergenic
1104810388 12:131616952-131616974 TCCTGGGAGGCGGACAGGGTGGG - Intergenic
1104986443 12:132600249-132600271 CCCCGGCAGGTGGGCATGGCAGG + Intergenic
1105472254 13:20704318-20704340 GCCCGGCAGGTGGGGAGGGCAGG + Intronic
1108602979 13:52011182-52011204 CCCCAGGGGGTGCGCAGGGAAGG - Intronic
1108615580 13:52128957-52128979 CTTCGGGAGCTCGGCAGGGTGGG - Intronic
1110450844 13:75636252-75636274 CCCCGGGAGGGCGGTGGGGTGGG + Intronic
1112783772 13:102929642-102929664 CCCTGGGAGGTGGGGAGAGGAGG + Intergenic
1113117082 13:106885283-106885305 CACCGGAAGGTGGGGAGGGGTGG + Intergenic
1113200755 13:107866190-107866212 CCCGGGGAGGGGGGCAGGGTGGG + Exonic
1113444740 13:110356544-110356566 CCCAGAGAGGTGGGCAGGAGTGG - Intronic
1113608846 13:111629088-111629110 CACAGGAAAGTGGGCAGGGTGGG + Intronic
1113697099 13:112354468-112354490 CCCAGGGAGGGAGGCCGGGTCGG - Intergenic
1113957190 13:114105182-114105204 CCCCAGGAGGAGGGCAGGTCCGG + Intronic
1114616462 14:24071394-24071416 CCGGGGGAGGAGGGCAGGCTGGG - Intronic
1114646923 14:24261061-24261083 CCCCAGGAAGCAGGCAGGGTTGG - Intronic
1114648369 14:24268196-24268218 CACCTGAGGGTGGGCAGGGTGGG + Exonic
1114657805 14:24326357-24326379 CAGGGGGAGGTGGGCATGGTGGG + Intronic
1114659935 14:24337651-24337673 CCCCAGGAGCTGGTCAGGGATGG - Intronic
1114671946 14:24416095-24416117 CCCAGGGGGGTGGGCAGTGGTGG + Exonic
1120216267 14:81683527-81683549 CCCCGCGGGGTGGGGTGGGTGGG + Intergenic
1122217666 14:100214614-100214636 CCCGGGGAGGAGGGCGGGGCGGG - Intergenic
1122290533 14:100678304-100678326 CCCCGGCAGCTGGGCAGGGGTGG + Intergenic
1122321612 14:100858973-100858995 CCCTTGGAGGTGGGCGGGGCTGG + Intergenic
1122466141 14:101934890-101934912 CGCCGTGAGGTGCCCAGGGTGGG + Intergenic
1122719062 14:103712152-103712174 CCCCGTGAGGCGGGCAGGGCAGG + Intronic
1122772570 14:104103864-104103886 TCTCGGGGAGTGGGCAGGGTTGG + Intronic
1122813415 14:104300225-104300247 CCGGTGGAGGAGGGCAGGGTGGG + Intergenic
1122859888 14:104577786-104577808 CCCCGGGAGCTGGGAATGATCGG - Intronic
1122880294 14:104687807-104687829 CCCAGGCAGGTGGACAGGGGAGG + Intergenic
1123019597 14:105391513-105391535 CTCCTGGGGGTGGGCAGGGTGGG - Intronic
1123031026 14:105451137-105451159 CCCCCTGGGATGGGCAGGGTGGG - Intronic
1123047741 14:105526914-105526936 CCCCGGGAGGAGGGGCGGGAGGG - Intronic
1124121456 15:26892401-26892423 CCCCGGGGCGCGGGCTGGGTAGG - Intronic
1124720891 15:32110022-32110044 CCCTGGAAAGTGGGCATGGTAGG - Intronic
1124725020 15:32148845-32148867 CCCCTGGCGGAGGGCATGGTGGG - Intronic
1125462477 15:39920188-39920210 GCCCGGGAGGCGGGGAGGGAGGG + Exonic
1125606341 15:40941853-40941875 GCCCGGGAAGTGAGCCGGGTCGG - Intergenic
1126309571 15:47300425-47300447 CCTGGGGGGGTGGGCAGTGTTGG + Intronic
1126684886 15:51240045-51240067 CCGGGGGAGGGGGGCGGGGTTGG - Intronic
1127974605 15:63987895-63987917 CCCTGGGAAGTGGGCAGGGCAGG - Intronic
1128141023 15:65301156-65301178 CCATGGCGGGTGGGCAGGGTAGG + Intergenic
1128617573 15:69122059-69122081 CCCCTGTAGGCTGGCAGGGTAGG - Intergenic
1129471890 15:75760634-75760656 CCCTGGGAGGAGGTCATGGTGGG - Intergenic
1129604333 15:77017499-77017521 TCCAGGGAGGTGGGCATGGAGGG - Intronic
1129672084 15:77613097-77613119 CCCTGTGAGGTAGGCAGGGCAGG + Exonic
1129738084 15:77976715-77976737 GACAGGGAGGGGGGCAGGGTGGG + Intergenic
1129847992 15:78776894-78776916 GACAGGGAGGGGGGCAGGGTGGG - Intronic
1130253923 15:82317041-82317063 GACAGGGAGGGGGGCAGGGTGGG + Intergenic
1130394389 15:83489462-83489484 CCACGGGAGGTGGGGTGGTTAGG - Intronic
1130546749 15:84862523-84862545 GCCCAGCAGGTTGGCAGGGTGGG + Intronic
1130967906 15:88710678-88710700 CTTGGGGAGGAGGGCAGGGTTGG + Intergenic
1131431879 15:92394427-92394449 GCCAGGCAGGGGGGCAGGGTGGG - Intronic
1132632708 16:927579-927601 CCCTGGGAGCTGGGAAGGGGAGG + Intronic
1132640846 16:977653-977675 CCGCAGGAGGAGGGCCGGGTTGG + Intronic
1132684970 16:1158437-1158459 CCCGGGGATGATGGCAGGGTAGG + Intronic
1132779404 16:1614435-1614457 CCCGGGCTGGTGGGCAGGGCCGG + Intronic
1132786251 16:1658416-1658438 CCCAGGGAAGGGGCCAGGGTGGG + Intronic
1132864609 16:2087255-2087277 TTCCTGGAGGTGGGCTGGGTCGG + Intronic
1132875400 16:2134946-2134968 CCACGGGAGGTGTGAGGGGTAGG - Intronic
1132884631 16:2177228-2177250 CTCCAGCAGGTGGGCAGGGGAGG - Exonic
1132887699 16:2189769-2189791 CCCTGGGAGGTGGGAATGCTGGG + Intronic
1132939799 16:2501044-2501066 CCCCATGTGGTAGGCAGGGTTGG + Exonic
1132996381 16:2825654-2825676 GCCACGGAGGTGGACAGGGTCGG + Intronic
1133236614 16:4390208-4390230 CCAAGGGAGGTGGCCAGGCTGGG - Intronic
1134519584 16:14912414-14912436 CCACGGGAGGTGTGAGGGGTAGG + Intronic
1134554347 16:15153821-15153843 CCACGGGAGGTGTGAGGGGTAGG - Intergenic
1134685437 16:16155018-16155040 CCCGGGCAGGTGGGCATCGTTGG - Exonic
1134707256 16:16311070-16311092 CCACGGGAGGTGTGAGGGGTAGG + Intergenic
1134781015 16:16895693-16895715 CCGGGGGAGGGGGGCGGGGTGGG - Intergenic
1134960285 16:18401055-18401077 CCACGGGAGGTGTGAGGGGTAGG - Intergenic
1135048483 16:19173370-19173392 AGAGGGGAGGTGGGCAGGGTGGG - Intronic
1137617949 16:49858011-49858033 ACCCGGGAGGGGGGCGAGGTCGG - Intergenic
1137720531 16:50625102-50625124 CCCCAGGAGGATGCCAGGGTAGG - Intronic
1138328045 16:56191636-56191658 CCCCGCGCGCTGGGCAGGGTTGG - Intronic
1138555113 16:57766360-57766382 GCCCTGGAAGGGGGCAGGGTTGG + Intronic
1139590194 16:67929017-67929039 CTGCGGGAGGTGGGTGGGGTTGG + Exonic
1139655269 16:68383610-68383632 CCCTAGGAAGTGGGCAGGGAAGG - Intronic
1139663980 16:68443204-68443226 CTCCAGAAGGTGGGCAGGTTTGG - Intronic
1139914748 16:70421104-70421126 CCCTGGGAGGTGGGCTGGGGAGG + Intronic
1139939205 16:70592336-70592358 CCTCAGGAGGCGGTCAGGGTGGG - Intronic
1140473982 16:75229479-75229501 CCCCAGGAGGGAGGCAGGGGAGG - Exonic
1142303128 16:89270449-89270471 GCCAGGGCGGTGGGCAGGGGCGG - Intronic
1142961329 17:3554089-3554111 CCCTGGGAACTGGGCAGGGCTGG - Intronic
1143024068 17:3930576-3930598 TCCCGGGAGGGGTGCGGGGTCGG + Intronic
1143473818 17:7192000-7192022 CCCCTGGGGGCAGGCAGGGTGGG + Exonic
1144065238 17:11618774-11618796 CCCTGCAAGGTGGGCAGGGAAGG + Intronic
1144316727 17:14069253-14069275 CCGGGTGAGGTGGGCAGGGTTGG - Intergenic
1144494110 17:15736234-15736256 CCCCGGGAGTGGTGCAGGGAAGG + Intronic
1144581271 17:16460871-16460893 CCTAGGGAGGTGGGAAGGGACGG - Intronic
1144754059 17:17668860-17668882 CCCCGGATGCTGGGCTGGGTAGG - Intergenic
1144787538 17:17840300-17840322 ACCCGGGAGGTAGGGAGGGGCGG + Intergenic
1144816991 17:18041199-18041221 CCCCGGGGGGTGGGGCGGGGGGG - Intronic
1144829405 17:18123010-18123032 CCCCATGAGGGGTGCAGGGTAGG + Intronic
1144906150 17:18640442-18640464 CCCCGGGAGTGGTGCAGGGAAGG - Intronic
1147567877 17:41548692-41548714 CCCGGTGAGGTGGGCAGGGCAGG - Intergenic
1147965323 17:44191614-44191636 TCCTTGGAGTTGGGCAGGGTAGG - Exonic
1148027790 17:44600384-44600406 AGGAGGGAGGTGGGCAGGGTGGG - Intergenic
1148040530 17:44703252-44703274 CGGTGGGGGGTGGGCAGGGTGGG + Intergenic
1148466861 17:47870289-47870311 CCACGAGAGGTGGAGAGGGTAGG - Intergenic
1148738794 17:49880437-49880459 CCCCAGGACGGGGGCAGGATGGG - Intergenic
1148789986 17:50167606-50167628 TCCCTGGAGGTGGGCGTGGTAGG - Exonic
1148856128 17:50580211-50580233 CCCTGGGAGGCTGGCAGAGTTGG - Intronic
1148908435 17:50926561-50926583 CCCCAGGATGTGGGCTGGGAAGG + Intergenic
1149029876 17:52070485-52070507 CCCAGGGAGCTGAGCTGGGTAGG + Intronic
1150223311 17:63509254-63509276 ACCCAGGAGGTGGGCAGGGATGG - Intronic
1151426263 17:74032818-74032840 ACCAGGGAGGCCGGCAGGGTAGG + Intergenic
1151574652 17:74946640-74946662 GCCTGGGAGGGAGGCAGGGTGGG - Exonic
1151727761 17:75894493-75894515 CCCAGGGAGATGGGGAAGGTCGG - Intronic
1151875745 17:76867471-76867493 GGCCGGGAGGTGGGCAGGGCAGG + Intergenic
1152095299 17:78268825-78268847 CGGCAGGGGGTGGGCAGGGTGGG - Intergenic
1152166355 17:78710150-78710172 CCCCCTGAGGTGGGGAGGGGAGG + Intronic
1152244852 17:79179949-79179971 CTCCTGGAGGTGGGCTGAGTGGG + Intronic
1152256754 17:79244482-79244504 GCCCTGAAGGTGGGGAGGGTGGG - Intronic
1152325477 17:79633432-79633454 CGTAGGGAGGTGGGCTGGGTGGG + Intergenic
1152583285 17:81178453-81178475 CCCCTGGTGGTGAGCAGGGAGGG - Intergenic
1152610946 17:81314774-81314796 GCCAGGGAGGTCGGCAGGCTCGG + Intronic
1152627744 17:81396099-81396121 TCCGGGGAGGGGAGCAGGGTAGG - Intronic
1152628843 17:81400563-81400585 CCCGGGGAGGAGGGCAGCGCGGG + Intronic
1152748353 17:82051441-82051463 CCCTGGGAGGCGGGGCGGGTGGG + Intronic
1152892935 17:82892691-82892713 GCCTCGGAGGTGGGCAGGCTTGG + Intronic
1152926388 17:83089639-83089661 TCCAGGGCGGTGGGGAGGGTCGG - Intronic
1153451621 18:5237313-5237335 CTTCGGGTGGTGGGCAGGCTCGG - Intergenic
1153624563 18:7011929-7011951 CCCTGGGAGGTGGGTGGGGGTGG - Intronic
1153814986 18:8784052-8784074 CCCCGGGAGCCGGGCTGGCTAGG + Exonic
1153913771 18:9727128-9727150 CCTGGGGAGATGGGCTGGGTAGG + Intronic
1154197736 18:12278826-12278848 CCCCGGGAAGGGGGTAGGGGAGG - Intergenic
1155187396 18:23399276-23399298 CCCGTGGAGATGGGCAGAGTGGG - Intronic
1155314712 18:24559998-24560020 CTCTATGAGGTGGGCAGGGTGGG - Intergenic
1157240936 18:46008869-46008891 CCCCAGGGGGTTGGCAGGGTAGG - Intronic
1158419816 18:57283256-57283278 CCCCAAGAGGTGGGCATGCTGGG + Intergenic
1159770394 18:72541765-72541787 CCCCGGGCTGGGGGCGGGGTGGG + Intronic
1160447119 18:78936625-78936647 GCCGGGGAGGTGGGCAGGGAGGG + Intergenic
1160447138 18:78936671-78936693 GCCAGGGAGGTGGGCGGGGCGGG + Intergenic
1160447155 18:78936717-78936739 GCCAGGGAGGTGGGCAGGGCAGG + Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160704610 19:524200-524222 CCCGGGGAGCTGGGCGGGGCAGG - Intergenic
1160788762 19:913226-913248 CGCCCGGAGGCGGGCAGGGGCGG + Exonic
1160911083 19:1474106-1474128 CCCCGGAAGCTGGGGAGGGATGG - Exonic
1160989337 19:1854133-1854155 CCCCGGGAGGGGGGCAGCAGGGG + Exonic
1161140679 19:2645955-2645977 CCCCTGGATGGGGTCAGGGTGGG - Intronic
1161268200 19:3374961-3374983 GCCAGGGAGGCGGGCAGGGGTGG - Intronic
1161332650 19:3695616-3695638 TCCCGGGAGGCGGCCAGGGCGGG + Intronic
1161510906 19:4670446-4670468 CCCCGGGCGGTGGACAGGGCGGG - Intergenic
1161513101 19:4682660-4682682 CCCGGGGAGGAGCGCAGGGCAGG + Intronic
1161624870 19:5320375-5320397 TCCCGGGAAGTGGCCAGTGTAGG + Intronic
1162086933 19:8254844-8254866 CCCAGGGAGGCTGGAAGGGTGGG - Intronic
1162796262 19:13089172-13089194 TCATTGGAGGTGGGCAGGGTGGG + Intronic
1162936316 19:13983430-13983452 GCCCGGGAGGGGGGCAGTGCAGG - Intronic
1163555942 19:17992958-17992980 CCCCGGGAGGTGGGCAGGGTTGG + Intronic
1163779864 19:19240465-19240487 AGCCTGGAGGTGGGCTGGGTGGG - Intronic
1163832782 19:19554960-19554982 CCCAGGTAGGTGGTCAAGGTGGG + Intergenic
1164188480 19:22894040-22894062 CGGCGGGAGGTGGGCGGGGCAGG + Intergenic
1164531055 19:29048500-29048522 TCATGGGAGGTGGCCAGGGTGGG + Intergenic
1164574967 19:29400672-29400694 ACTGGGGAGGTGGGCAGGGCAGG + Intergenic
1164595647 19:29529356-29529378 CTCCGGGAGGTGAGGAGGGCCGG + Intronic
1164645953 19:29858885-29858907 CCCCGGGAGCTCAGGAGGGTGGG - Intergenic
1165305480 19:35000435-35000457 CCCCGGGCGCAGGGCAGGGCAGG - Exonic
1165374193 19:35430032-35430054 CACCTGGAGAGGGGCAGGGTAGG + Intergenic
1165487532 19:36104595-36104617 CCCCTTGAGCTGAGCAGGGTGGG + Exonic
1165896161 19:39142551-39142573 CCCCGGGGGGTGGGGAAGGGGGG - Intronic
1165906833 19:39199388-39199410 GCCAGGGAGGTGGGCAGGGCAGG - Intronic
1165948413 19:39458879-39458901 CCTCTGGAGGTGGGCAAGGAAGG + Exonic
1165994445 19:39833965-39833987 CGCAGGGAGGTGGGCAGGACGGG - Intronic
1166803534 19:45471902-45471924 CCCCGGGAGGTAGAGAGGGAGGG + Intronic
1167038519 19:47008482-47008504 TCCTGGGAGGTGGGCGGGGTCGG - Intergenic
1167104000 19:47419870-47419892 CCCCTGGAGATGGCCAGGGAGGG - Intergenic
1167270175 19:48501953-48501975 CCAGGGGAGGGGGGCAGGGGAGG - Intronic
1167287456 19:48606627-48606649 CCCCGGCAGGTCGGCGGGGCAGG + Intronic
1167744447 19:51342353-51342375 CCCCTGGGGGTGGGGAGGGCAGG - Intergenic
1168177994 19:54638815-54638837 CCCCGGGAGCTGGGCTGGGGTGG - Intronic
1168297231 19:55383484-55383506 CCCCTGGAGATGGGAAGTGTGGG - Intronic
1168340704 19:55621680-55621702 CCCGGGGAGGGGGACGGGGTGGG - Exonic
1168340903 19:55622429-55622451 CCGAGGGAGGCGGGCAGGGTGGG - Exonic
1168707777 19:58479744-58479766 CCCAGGGAGAGGGGCGGGGTGGG - Intronic
925251431 2:2442187-2442209 CTCAGGGAGGTGGGCATGCTGGG + Intergenic
925306388 2:2850314-2850336 GCCCGGGAGCTGCGCAGGATGGG - Intergenic
925666114 2:6258038-6258060 CCCCCGCAGGAGGGCAGGGGTGG - Intergenic
925912653 2:8583551-8583573 CCCCGGGGGGTGCCCGGGGTTGG - Intergenic
926699022 2:15790415-15790437 CCAGGGGAGGTGGGCAGGACAGG - Intergenic
927514249 2:23662702-23662724 GCTCGGGAGGTGAGCTGGGTGGG - Intronic
927706185 2:25297849-25297871 CCCCAGGAGGTGGACAGGGCAGG + Intronic
928436962 2:31260934-31260956 CCCTGGGAGGTGGGCAGCTTGGG + Intronic
930338620 2:50083595-50083617 CCCCAGCAGGTGGCCAGGGCTGG + Intronic
931894771 2:66716497-66716519 CTCAGGGAGGTGGGCAGGGATGG + Intergenic
932202643 2:69845411-69845433 GCTTGGGTGGTGGGCAGGGTGGG - Intronic
932400774 2:71479645-71479667 CCCAGTGAGGTGGGCAGGTGAGG - Intronic
932449776 2:71802107-71802129 CCCCAGGAGCTGCGCAGGCTGGG - Intergenic
933902949 2:86862170-86862192 CCCCGGGAGGTGCTCAGGAAAGG + Intergenic
934045580 2:88170467-88170489 CCCCGGGAGGGCGGCGAGGTTGG - Intronic
935777596 2:106487099-106487121 CCCCGGGAGGTGCTCAGGAAAGG - Intergenic
935842853 2:107132316-107132338 CACTGGGAGGTGGGCAGCGCGGG - Intergenic
936057738 2:109273429-109273451 CCCCAGGAGGTGTGCGGGGCTGG + Intronic
936525887 2:113241515-113241537 CCCTGGGAGGTGAACAGGGTGGG - Intronic
936970876 2:118175215-118175237 ACCCGGGAGGGGTGCTGGGTGGG + Intergenic
937061023 2:118980650-118980672 CCCCTGGGGGTGGGTAGAGTGGG - Intronic
937242837 2:120473690-120473712 CCCTGTGAGGTTGGCAGGGAGGG - Intergenic
938014782 2:127858190-127858212 CCCCGAGGGGTGGGCGGGGCCGG + Intergenic
938116334 2:128605258-128605280 CCGCAGGAGGTGGCCAGCGTAGG + Intergenic
938406507 2:131035832-131035854 GTCTGGTAGGTGGGCAGGGTGGG + Intronic
938566894 2:132526635-132526657 CTCCGGGGGATGGGCAGTGTGGG - Intronic
941905183 2:170713059-170713081 CCCAGGGAGGCGGGCAGGGCCGG - Exonic
944615392 2:201453763-201453785 CCCTGGAAGGTTGGCAGGGCAGG + Intronic
946006020 2:216525611-216525633 CCCTCAGAGGTGGACAGGGTGGG - Intronic
946057586 2:216915706-216915728 GCCAAGGAGGTGGGCAGGGCTGG - Intergenic
946188574 2:217995509-217995531 ACCCGGGGGGAGGGCTGGGTAGG - Intronic
946395355 2:219441583-219441605 CCGCGGGAGGAGGTGAGGGTGGG + Intronic
947526209 2:230878236-230878258 TACAGGGAGGTGGGCAGGGTTGG - Exonic
947539327 2:230964326-230964348 CCCACGGAGGTGGGGAGGCTCGG + Intergenic
947949600 2:234135909-234135931 CCCAGGGTGGCGGCCAGGGTTGG - Intergenic
948126442 2:235567736-235567758 CACTGGGGGGTGGGCAGGGTGGG + Intronic
948231904 2:236355075-236355097 ACCCGGGAGGGGCCCAGGGTGGG - Intronic
948269343 2:236662388-236662410 CCCGGGGTGGAGGGAAGGGTTGG - Intergenic
948553456 2:238791465-238791487 CCGGGGTAGGGGGGCAGGGTGGG + Intergenic
948607768 2:239146884-239146906 CCCAGGCAGGTGTGCAGGCTGGG - Intronic
948861522 2:240754964-240754986 CCCTGGGAGGGGAGCAGGGCTGG - Intronic
1169345324 20:4823941-4823963 CCGCTGGAGGTGGGCTTGGTAGG - Intergenic
1171248505 20:23632131-23632153 CACCGGGCGGAGGGCAGGGAAGG + Intronic
1171291807 20:23986645-23986667 CCTAGGGAGGTGGGGAGGGAGGG + Exonic
1171947625 20:31392469-31392491 CTCTGGGAGGTGGACAGGATTGG - Intergenic
1172119311 20:32588433-32588455 CCCCAGGAGTTGGGCATTGTGGG - Intronic
1172389937 20:34559470-34559492 CGCCAGGAGGTGGCTAGGGTCGG + Intronic
1173572749 20:44088060-44088082 GCGGGGGAGGTGGGCAGGGGTGG - Intergenic
1173860857 20:46282746-46282768 CCCCCGGGGGAGGGAAGGGTGGG + Intronic
1173975805 20:47185677-47185699 GGCCGGGATGAGGGCAGGGTGGG + Intronic
1174093636 20:48069912-48069934 CACCAGGAGGTGGGCAGGAAGGG - Intergenic
1174104913 20:48155254-48155276 CGCCAGGAGGTGGGCAGCTTGGG - Intergenic
1174396510 20:50250286-50250308 CCTCGAGAGGTGCCCAGGGTAGG - Intergenic
1174404787 20:50296100-50296122 CCAGGGGAGGTGGGCACGGGGGG + Intergenic
1175226615 20:57448136-57448158 CCCTGGGAGGTGGCAGGGGTAGG + Intergenic
1175403852 20:58714913-58714935 CCCCGGGAGCTCCTCAGGGTGGG - Intronic
1175714643 20:61247326-61247348 GCCGGGGAGGCGGGCGGGGTGGG + Intergenic
1175836713 20:62000765-62000787 CATCGGGAGGTGGGCTGGGGTGG + Intronic
1175979348 20:62729238-62729260 CTCCGGGAGGAGGGCAGGGTGGG + Intronic
1176148332 20:63575252-63575274 CCTCGGGAGGTCGGCTGGGTGGG + Intergenic
1176288900 21:5033953-5033975 CCCCGTGGGGTGTGCAGGGCGGG + Intronic
1177834196 21:26171124-26171146 CCCCGGGAGGCCTGCGGGGTCGG - Intronic
1178891289 21:36523042-36523064 CCTGGGGAGGTGGGGAGGGGTGG - Intronic
1178910340 21:36668836-36668858 GCCGAGGAGGTGGGCACGGTGGG - Intergenic
1178934677 21:36850986-36851008 CCACAGGTGATGGGCAGGGTGGG + Intronic
1179171346 21:38975341-38975363 CCCAGTGAGTTGGGCAGGATGGG + Intergenic
1179179911 21:39036228-39036250 CCACTGCAGGTGGTCAGGGTAGG - Intergenic
1179518118 21:41923812-41923834 CCCCGGGAGGGGAGCGGGGAGGG - Intronic
1179656704 21:42850386-42850408 TCCCAGGAGGTGGGCACCGTGGG - Intronic
1179707572 21:43191121-43191143 TTCCAGGAGGTGGGCACGGTGGG - Intergenic
1179775359 21:43658709-43658731 CCAGGGGAGTTGGGCAGGGCGGG - Intronic
1179886224 21:44315344-44315366 CCCTGGGTGGTGGGCAAGGCGGG - Intronic
1179886642 21:44316958-44316980 CCCTGGGAGAGGGGCTGGGTGGG + Intronic
1179960550 21:44765007-44765029 CCCCGAGAGGTGGGCGGGGGTGG + Intergenic
1179988113 21:44932369-44932391 CCCAGGGAGGCGGCCAGGCTCGG - Intergenic
1180000343 21:44992744-44992766 CCCTGGGGGGTGGGCAGAGCAGG + Intergenic
1180000356 21:44992785-44992807 CCCTGGGGGGTGGGCAGAGCAGG + Intergenic
1180712306 22:17847615-17847637 CGCCGGAAGGTGGTCACGGTCGG - Intronic
1180868502 22:19133287-19133309 CCCCAGGAAGTGGGGAGGGAGGG - Exonic
1181510469 22:23386611-23386633 CCCCAGGAGGTGGCCATGCTGGG - Intergenic
1182134363 22:27887551-27887573 CCTGGGGAGGTGGGGTGGGTGGG - Intronic
1182280056 22:29213405-29213427 GCCCTGGAGGTGGGAAGGCTGGG - Intronic
1182420215 22:30245332-30245354 CCACGGGAGGTGGGAAGAGAGGG - Intronic
1182501789 22:30753342-30753364 CTCCAGGTGGTGGGCATGGTTGG + Intronic
1182558568 22:31141975-31141997 CCCCAGGTGATGGGCAGGGAAGG - Intergenic
1182697480 22:32206566-32206588 CCCCTGGTGGTGGGCAGCGGAGG + Intergenic
1183393557 22:37559695-37559717 TCCATGGAGGTGGGCGGGGTGGG + Intergenic
1183479872 22:38057598-38057620 CTCCGGGTGGGGGGCTGGGTAGG - Intronic
1183739909 22:39663704-39663726 ACCCGGAACCTGGGCAGGGTGGG - Exonic
1183752601 22:39730194-39730216 CCCTGGGAGTGGGACAGGGTTGG - Intergenic
1183938878 22:41281127-41281149 CCCCTGGTTGGGGGCAGGGTAGG + Exonic
1184093476 22:42304347-42304369 CACAGGGAGGTGGGGAGGCTGGG + Intronic
1184244494 22:43228968-43228990 CCCAGGGTTGAGGGCAGGGTTGG + Intronic
1184293528 22:43510206-43510228 CCTAGGGAGGTGTGCAGGGCAGG + Intergenic
1184520464 22:44991029-44991051 CCCTGGAAGGTGGGCAGGGCGGG - Intronic
1184538004 22:45100532-45100554 CTAAGGGAGGAGGGCAGGGTTGG - Intergenic
1184643165 22:45882865-45882887 CCTAGGGAGGAGGGCAGGGATGG + Intergenic
1184695255 22:46135360-46135382 CCCAGGGAGGGTGGCAGGCTGGG + Intergenic
1184788200 22:46682111-46682133 CCCCAGGAGGAGGGCAGAGCTGG - Intergenic
1184992706 22:48181677-48181699 CACAGGGAGGAGGGCAGGGGAGG + Intergenic
1185041349 22:48506076-48506098 CCCCGTGGGGTGTGCAGGGAAGG - Intronic
1185047679 22:48537200-48537222 ACCCGGGGTGGGGGCAGGGTGGG + Intronic
1185070532 22:48653395-48653417 GCCCAGCAGGTGGGCAGGGCAGG + Intronic
1185246774 22:49776897-49776919 CCCCGGGAGGTTGGCCAGGGTGG + Intronic
949866725 3:8553247-8553269 CCCCAGCAGGTGGACAAGGTGGG - Intronic
950208307 3:11096859-11096881 CCCCGGGGGCTGGGGACGGTTGG + Intergenic
950507488 3:13404216-13404238 CCCTGTGAGGAAGGCAGGGTGGG - Intronic
950637205 3:14323620-14323642 CCCCGGGAGGCAGGCGGGGCTGG + Intergenic
950878384 3:16299970-16299992 CCCTGTGAGGTGGGCAGTGCAGG + Intronic
951528620 3:23678259-23678281 CCCAGGAAGGTGAGCAGGGCTGG - Intergenic
951725794 3:25757400-25757422 CCCTGTGAGGTAGGCAGGGTAGG - Intronic
952706210 3:36380458-36380480 GCCGGGGAGGTGGGCAGGGCGGG + Exonic
953246808 3:41200054-41200076 CCCTGGGTGGGGGGCGGGGTGGG + Intronic
953464276 3:43105615-43105637 GCGCGGGAGGTGGGCGGGGCGGG - Intronic
953561333 3:43995665-43995687 CCCCGAGCTGAGGGCAGGGTAGG + Intergenic
953914024 3:46906562-46906584 CCCTGGGAGGTGGCCAGAGGGGG + Intergenic
953921141 3:46952551-46952573 TCCCAAGAAGTGGGCAGGGTTGG - Intronic
954225136 3:49176408-49176430 CCCTGTGAGGTAGGTAGGGTAGG - Exonic
954671650 3:52294339-52294361 CTCAGGGAGGAGGGGAGGGTTGG - Intergenic
954672868 3:52299856-52299878 CCCAGGGAGGAGGGCAGGGTAGG + Intergenic
954699203 3:52442733-52442755 CCCCGGGAGGTGAGCTGGACTGG - Exonic
954868317 3:53748305-53748327 CTGCAGGAGGTGGGCAGGCTGGG + Intronic
955227520 3:57073393-57073415 CCACTGGAGTTGGGCAGCGTGGG + Exonic
955601970 3:60655220-60655242 CAGCTGGAGGTGGGAAGGGTGGG + Intronic
956698384 3:71937589-71937611 ACCCTGGAGGTGGGTAGGATGGG + Intergenic
960245063 3:115391187-115391209 CCCTGGTTGATGGGCAGGGTGGG - Intergenic
961649745 3:128411382-128411404 CCCAGGGGTGTGGGCAGGGCAGG + Intergenic
961673173 3:128549435-128549457 CCCTGGGCTGGGGGCAGGGTGGG + Intergenic
962713437 3:138106967-138106989 CCCTGTGAGGTAGGCAGGGCTGG - Intronic
963252924 3:143119350-143119372 CCCGGAGAGGTTGGCAGTGTCGG + Exonic
965510146 3:169559489-169559511 CCCCAGGAGGTGTGCAGGTGTGG - Intronic
966712021 3:182980710-182980732 CCCCGGGGAGTGGGCGGGGGCGG + Intronic
967107348 3:186264617-186264639 CTCTGGGAGGTGGGCAGGGCAGG + Intronic
967904122 3:194486845-194486867 CGGCGGGAGGTGGGCAGGGGAGG + Intronic
967932528 3:194700648-194700670 GCCTGGAGGGTGGGCAGGGTAGG + Intergenic
967988306 3:195112658-195112680 CCCCGGGTGGTGGGAATAGTTGG + Intronic
968503302 4:961003-961025 CCAGGGGAGGTGGGCCGGGCTGG - Intronic
968585519 4:1414435-1414457 CCGCGGGAGGGGGTAAGGGTGGG + Intergenic
968585538 4:1414496-1414518 CCGCGGGAGGTGGGTGGGGGTGG + Intergenic
968585560 4:1414557-1414579 CCGCGGGAGGGGGTAAGGGTGGG + Intergenic
968585579 4:1414618-1414640 CCGCGGGAGGTGGGTGGGGGTGG + Intergenic
968585601 4:1414679-1414701 CCGCGGGAGGTGGGTGGGGGTGG + Intergenic
968585613 4:1414710-1414732 CCGCGGGAGGTGGGTGGGGGTGG + Intergenic
968909853 4:3472165-3472187 CCCGGGGAGGTGGGCACGGCTGG + Intronic
969373771 4:6749998-6750020 CCACGGGAGGTGGGGTGGGCAGG + Intergenic
969575389 4:8033523-8033545 CCTCGGCAGGTGGACAGGGCTGG - Intronic
969660200 4:8522974-8522996 CCCCGAGTGGAGGGCAGGGTGGG + Intergenic
971195932 4:24471826-24471848 CCCGCGGAGGTGGGGGGGGTGGG - Intergenic
973070861 4:45856536-45856558 CTCCAGGAGGTGGGCAAGCTGGG + Intergenic
976733111 4:88284057-88284079 CGGCGCGAGGCGGGCAGGGTGGG - Intronic
977574222 4:98659280-98659302 CTCCGGTAGGTGGGGAGGTTGGG - Intergenic
981549361 4:145927806-145927828 GCCTGTGAGGTGGGCAGGGAAGG - Intronic
982274408 4:153624599-153624621 CCCCGTGAGAAGGGCAGGGCAGG + Intronic
982666740 4:158274191-158274213 CCCTGGGTGCTAGGCAGGGTTGG - Intergenic
983238571 4:165207187-165207209 CCCAGGGAGATGGGAAGGGTAGG - Intronic
984767372 4:183409896-183409918 CCCAGGGAGGTAGGCAGGGAAGG - Intergenic
985624818 5:979822-979844 CACAGGGAGGTGGGCAGAGGCGG + Intronic
985781673 5:1875094-1875116 CGCCGGGAGGCCGGCAGGGCCGG - Intergenic
985800461 5:2002431-2002453 GCCCTGGAAGTAGGCAGGGTAGG - Intergenic
985945211 5:3177102-3177124 CACAGGAAGGTGGGGAGGGTTGG + Intergenic
986236112 5:5912250-5912272 CCCAGGGAGGAGGGGAGTGTGGG + Intergenic
986402590 5:7395429-7395451 CGCGGGGAGGCGGGAAGGGTGGG + Intergenic
987393758 5:17401582-17401604 CCCAGGCAGGGGTGCAGGGTGGG - Intergenic
991667191 5:69011229-69011251 CCCCGACAGGTGCACAGGGTTGG - Intergenic
991944717 5:71888963-71888985 CCCTGGGAGAAGAGCAGGGTGGG - Intergenic
992124369 5:73626029-73626051 GGCCGGGAGGTGGGCAGGCGGGG + Intergenic
994180886 5:96764963-96764985 CACCAAGAGATGGGCAGGGTTGG + Intronic
997585243 5:135039831-135039853 GGCCGGGAGGCGGGAAGGGTGGG + Intronic
997659477 5:135578606-135578628 CCGCGGGGGGTGGTCTGGGTGGG - Intronic
997979557 5:138460270-138460292 CCACAGGGGCTGGGCAGGGTTGG + Intergenic
998172082 5:139878394-139878416 CTCCGGGTGGTGGGCTGGGATGG + Intronic
998173486 5:139885998-139886020 TCTCGGAAGGTGGGCTGGGTGGG + Intronic
999188206 5:149728543-149728565 CCTTGTTAGGTGGGCAGGGTGGG + Intergenic
999247293 5:150161904-150161926 TACCTGGAGGTGGGCAGGGCAGG + Intergenic
999283271 5:150379060-150379082 CCACAGGAGGTGTGGAGGGTTGG + Intronic
999320432 5:150611593-150611615 CCCCAGGAGGTGGGCAGAAATGG + Intronic
999323159 5:150626995-150627017 CTCTGGGAGGTGGGCAGGGCAGG + Intronic
999404179 5:151292512-151292534 CCTTGTGAGGTAGGCAGGGTGGG - Intronic
999769073 5:154761443-154761465 TTCTGGGAGGTGGGCAGGGTGGG + Intronic
1001070057 5:168578304-168578326 CCCCGATAGGCGGGCAGGGAAGG + Intronic
1001166024 5:169368167-169368189 CACCTGGATGTGGGCGGGGTGGG + Intergenic
1002299310 5:178248413-178248435 CCCCGGGTGGTGGGCAGTGTGGG + Intronic
1002435816 5:179230164-179230186 CGGCGGGAGGAGGGCAGGGCAGG + Intronic
1002587137 5:180256378-180256400 TCCTGGGATGTGGGCAGGGGTGG + Intronic
1002837369 6:876347-876369 CCCTGGGAGAGGGTCAGGGTGGG - Intergenic
1002839513 6:893870-893892 CCCCAGGAGGAGGCCAGGGCTGG - Intergenic
1002894041 6:1364663-1364685 TACCAAGAGGTGGGCAGGGTTGG + Intergenic
1003074493 6:2971432-2971454 AGCGGGGAGGGGGGCAGGGTGGG - Intronic
1003234206 6:4281608-4281630 CCCAGGCATGTGGGCAGGGGAGG - Intergenic
1004706129 6:18125403-18125425 CCCTGGGAGGAGGGCAAGGCTGG - Intergenic
1005968443 6:30743088-30743110 CCCAGGGAGGTGCGCGGGCTGGG + Intergenic
1006073649 6:31515574-31515596 CCGAGGCAGGTGGTCAGGGTAGG + Intergenic
1006401742 6:33821748-33821770 CCTGGGGAGGTGGGCAGGCTGGG - Intergenic
1006420733 6:33932218-33932240 CCCCTGGAGGTGGGCAGCAAAGG - Intergenic
1006425785 6:33962137-33962159 GCCAGGGAGGTAGGCAGGGTGGG - Intergenic
1006639891 6:35484466-35484488 CTCGAGGAGGTGGGCAGGGTAGG + Intronic
1006924386 6:37646454-37646476 CCCTGGGAGGTGGGCACGGAAGG - Intronic
1006950992 6:37820377-37820399 CCCCGGGAGGGAGGAAGGGCTGG - Intronic
1007010839 6:38416132-38416154 CACTGGGAGGTGGGTAGGGTAGG + Intronic
1008320344 6:50104413-50104435 TATGGGGAGGTGGGCAGGGTGGG + Intergenic
1008661562 6:53673186-53673208 GCCTGGGAGATGGGCAGGGGTGG - Intergenic
1008711136 6:54228479-54228501 CCCAGGCAGCTGGGCAGGGAGGG - Intronic
1011704709 6:89989450-89989472 CCCAGGGAGGTGGGAAGGGAGGG + Intronic
1012050978 6:94343568-94343590 TCTGGGGAGGTGGGCAGTGTTGG + Intergenic
1012160216 6:95874862-95874884 CCATGGGAGATGGGCATGGTAGG + Intergenic
1012429638 6:99151174-99151196 CCACTGGAGGTGAGAAGGGTGGG - Intergenic
1014110626 6:117616402-117616424 CCCCATGAGGTGGGCAGGATGGG + Intergenic
1015402130 6:132798642-132798664 CCCCGGGAGGAGGCCGGGGGCGG + Intergenic
1018686589 6:166308322-166308344 CCCCAGGAGGAGGGGAGGGTGGG - Exonic
1018851684 6:167644936-167644958 CCCCTGCAGGTGGGCAGGGTGGG - Intergenic
1019111865 6:169723800-169723822 GCCCGGGACGGGGTCAGGGTCGG + Intronic
1019530072 7:1498940-1498962 CCCGGGGGGGTGGGCGGGGCAGG - Intronic
1019574501 7:1729934-1729956 CCCCAGGAGGTGGGCGGGGGTGG + Intronic
1020111816 7:5451878-5451900 CCCTGGGAGGAGGGGAGAGTGGG - Intronic
1020418318 7:7969817-7969839 GCCCGGGAGGACGGGAGGGTTGG - Intronic
1021515607 7:21481268-21481290 GACCGGGAGGTGGGAAGAGTAGG + Intronic
1022013612 7:26329948-26329970 CACAGGGAGATGGGAAGGGTGGG + Intronic
1022389005 7:29927482-29927504 CCTCTGGATGTGGGGAGGGTAGG - Intronic
1023448778 7:40259155-40259177 CCTGGGGAGGAGGGCAGGTTAGG + Intronic
1024317602 7:48035784-48035806 CCGCGGGACTTGGGCAGGCTTGG - Intronic
1024950988 7:54860233-54860255 CTCCTGGAGTGGGGCAGGGTTGG + Intergenic
1026949747 7:74339082-74339104 CCCCCTGGGCTGGGCAGGGTGGG + Intronic
1027238272 7:76310935-76310957 CCTGGGGCGGTGGGCAGGGAGGG - Intergenic
1027548232 7:79557502-79557524 CCCTAGGAGGTGGGGAGAGTAGG + Intergenic
1029590897 7:101506473-101506495 TCCCAGGGGGTGGGCTGGGTAGG - Intronic
1031969744 7:128055461-128055483 CACTGGGAGGTGGTCAGGTTAGG - Intronic
1031990015 7:128191435-128191457 CCCTGTGTGGTGGGCAGGGCAGG + Intergenic
1032013597 7:128361755-128361777 CCGCGGGTGGCGGGCTGGGTGGG - Intergenic
1033275609 7:139969624-139969646 CCCAGGGAGGAGGGCATGGTTGG + Intronic
1034867612 7:154655770-154655792 GCCCAGGGGGTGGGCAGGGCAGG + Intronic
1035064359 7:156094526-156094548 CCCTGAGGGGTGGGCAGGCTGGG - Intergenic
1035355823 7:158275722-158275744 CACGTGGAGGTGCGCAGGGTGGG - Intronic
1035754936 8:2023884-2023906 CCGCGGGAGCTGGGCAGGGATGG + Intergenic
1036210947 8:6841053-6841075 GCCCGTGGGGTGGGCAGGGCAGG + Intergenic
1036620329 8:10421062-10421084 CCCGGGGATGTGAGCTGGGTAGG + Intronic
1037514478 8:19616893-19616915 CCACGGGGGTGGGGCAGGGTTGG + Intronic
1037585101 8:20270656-20270678 CTCCAGGAGGTGGGCAGGTGTGG + Intronic
1037811607 8:22089805-22089827 CCCCGGGACGTGGGAAGTGCAGG + Intronic
1037882162 8:22578757-22578779 CCCCAGGTCCTGGGCAGGGTGGG - Exonic
1038017635 8:23528954-23528976 CTGCAGGAGGTGGGCAGGGAGGG - Exonic
1038420508 8:27431211-27431233 CTCTGGGAGGTGGGCAGGACAGG + Intronic
1038423770 8:27451566-27451588 CCCTGGGCGGTGGGCAAGGATGG - Intronic
1039430315 8:37520444-37520466 AGCCGGGAGGTGGGGAGGGAGGG - Intergenic
1039899466 8:41740957-41740979 CCCCAGGAGGGGGACAGGGCAGG + Intronic
1039902971 8:41766608-41766630 CCCTGGAGGCTGGGCAGGGTGGG + Intronic
1039917688 8:41871938-41871960 CCCCGGGATGGGGGAAGGGAGGG + Intronic
1041373885 8:57193207-57193229 CTCCTGGTGGCGGGCAGGGTCGG - Intergenic
1043395307 8:79829643-79829665 CCCCCAGAGGGGGGCAGGGGAGG - Intergenic
1045543325 8:103106281-103106303 GGCGGGGAGGGGGGCAGGGTTGG + Intergenic
1046933800 8:119867368-119867390 TCCTGGGAGGTGAGCAGGGTTGG + Intergenic
1047411422 8:124627650-124627672 CCCTGGGAGATGGCCAGGGGTGG + Intronic
1048443488 8:134476933-134476955 CCCCCTGGGGTGGGCAGTGTGGG - Intergenic
1049508994 8:143018466-143018488 CCCCGGGGCGGGGGCAGGGGCGG - Intronic
1049534667 8:143173148-143173170 TCACTGGAGCTGGGCAGGGTAGG - Intergenic
1049646934 8:143739722-143739744 CCTCGGGAGGAGGCCCGGGTGGG + Intergenic
1049748694 8:144273664-144273686 CCCGGGGAGGTGGGCCGGGGTGG - Intronic
1051170072 9:14313214-14313236 CGCCGGGGGGTGGGCAGGGCCGG - Intronic
1051335673 9:16063932-16063954 CTCCAGGAGGTGGGCATTGTCGG - Intergenic
1052816570 9:33106664-33106686 CCCTGGGAGGGAGGCAGGGAGGG + Intronic
1056126217 9:83538340-83538362 CCCCGGGACATCGGCAGCGTCGG + Exonic
1056282674 9:85057173-85057195 CACAGGGAGGTGGGCAGCATGGG + Intergenic
1057077765 9:92147844-92147866 TCCCGAGAGGCGGGCAGGGCTGG + Intergenic
1057555957 9:96087587-96087609 CCTCGGGAGTTGGGCTGGGCAGG + Intergenic
1057727517 9:97578701-97578723 CCCTGGGAGGTGAGCAGGGCAGG - Intronic
1058005154 9:99906617-99906639 TCACGAGGGGTGGGCAGGGTTGG - Exonic
1058023718 9:100117610-100117632 CAGCGGGAGGTGGGCGGGGGGGG - Intronic
1058095038 9:100850323-100850345 CACTGGGAGGTGTGGAGGGTGGG + Intergenic
1059145681 9:111897137-111897159 CCGCAGGAGGAGGACAGGGTGGG - Exonic
1059961737 9:119571828-119571850 CTTGGGGAGGTGGGCTGGGTGGG + Intergenic
1060721542 9:125983011-125983033 CCGTGGGAGGAGGGCAGGTTCGG - Intergenic
1061022795 9:128027085-128027107 CCCTGGGAGGAGGGAAGGGCAGG - Intergenic
1061038154 9:128124790-128124812 CCCAGGTAGAGGGGCAGGGTGGG + Intronic
1061086856 9:128404666-128404688 CCCCAGGAGGGGAGCAGGGTGGG - Intergenic
1061579772 9:131529865-131529887 TCCTGGGAGGTGGGTAGGCTGGG + Intronic
1061615466 9:131776086-131776108 TCTCAGGAGGTGGGCTGGGTGGG - Intergenic
1061822821 9:133238266-133238288 CCCCCAGAGCTGGGCAGGGTTGG + Intergenic
1061862409 9:133474900-133474922 CCCCTGGAGGCTGGCAGGGCAGG - Intronic
1061865387 9:133489469-133489491 CCCTGGAAGGTGGGGAGGGGAGG - Intergenic
1061894984 9:133642496-133642518 GCCCGGGAGGAAGGCAGGGCTGG - Intronic
1062026881 9:134344598-134344620 GCCCGGGAGGTGGGGAGGAGAGG - Intronic
1062179674 9:135184597-135184619 TACGGGGAGGTGGGCAGGTTAGG - Intergenic
1062242373 9:135547347-135547369 TCCTTGGAGGTGGGCAGGGCTGG - Intronic
1062281798 9:135755178-135755200 AGTCGGGAGGGGGGCAGGGTAGG - Intronic
1062421375 9:136484137-136484159 CCCCGGGAGGACAGCAGGGCTGG - Exonic
1062429658 9:136521350-136521372 CCCTGGGGAGTGGGCAGGGAGGG - Intronic
1062532300 9:137007290-137007312 CCCAGGGAGGTGGGCGGGCAGGG + Exonic
1062582013 9:137232945-137232967 CCCCGGGTGGTGGGGGGGGCAGG + Intronic
1062592677 9:137281157-137281179 GCCCGGGAGGAGCGCAGGGGCGG + Exonic
1185468384 X:368653-368675 CCCCGGTCGGTGCCCAGGGTGGG - Intronic
1186407020 X:9313203-9313225 TCTCAGGAGGTGGGCAGGGCCGG - Intergenic
1186410230 X:9340383-9340405 CCCAGGGAAGTGGGCGGGGTGGG - Intergenic
1189390018 X:40568773-40568795 ACCTGGGAGGTGGGCAGAGGTGG - Intergenic
1190326363 X:49209453-49209475 CCCCTGCAGGCGGGTAGGGTGGG + Intronic
1193046866 X:77063111-77063133 CCATGACAGGTGGGCAGGGTAGG + Intergenic
1193151567 X:78129860-78129882 CCCTGTGAGGTAGGCAGGGTAGG + Exonic
1195018450 X:100801113-100801135 CACTGGGAGTTGGGCAGGCTGGG - Intergenic
1195105909 X:101601158-101601180 CACCTGGAGGGGGGCGGGGTGGG - Intergenic
1195106974 X:101612609-101612631 CACCTGGAGGGGGGCGGGGTGGG + Intergenic
1195394906 X:104399902-104399924 ACCCAGGGGGTGGGCGGGGTGGG + Intergenic
1195717642 X:107832536-107832558 GCCCGTGAGATGGGCAGGGCAGG + Intronic
1195722486 X:107879550-107879572 CACAGGGTGGTGGGCAGGGTGGG + Intronic
1198228523 X:134668845-134668867 CTGGGGGAGGTGGGTAGGGTGGG - Intronic
1199698724 X:150361751-150361773 ACCCGGGAGGTGGGATAGGTGGG + Intronic
1200229422 X:154436810-154436832 CCCGGGGGGGTGGGCGGGGGTGG + Intergenic
1201250735 Y:12054970-12054992 CTCAGGGAGGTGGGAAGGCTGGG + Intergenic
1201344264 Y:12965594-12965616 CTCTGGGAGGTGCGCAGGGCAGG + Intergenic