ID: 1163556109

View in Genome Browser
Species Human (GRCh38)
Location 19:17993595-17993617
Sequence AGGTGGGGCCCCGGAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 318}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163556090_1163556109 26 Left 1163556090 19:17993546-17993568 CCGACCTAGCCAAGGTGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1163556109 19:17993595-17993617 AGGTGGGGCCCCGGAGCAGATGG 0: 1
1: 0
2: 3
3: 29
4: 318
1163556096_1163556109 17 Left 1163556096 19:17993555-17993577 CCAAGGTGAGTGGGTTGGGGCAG 0: 1
1: 0
2: 4
3: 29
4: 323
Right 1163556109 19:17993595-17993617 AGGTGGGGCCCCGGAGCAGATGG 0: 1
1: 0
2: 3
3: 29
4: 318
1163556092_1163556109 22 Left 1163556092 19:17993550-17993572 CCTAGCCAAGGTGAGTGGGTTGG 0: 1
1: 0
2: 2
3: 18
4: 215
Right 1163556109 19:17993595-17993617 AGGTGGGGCCCCGGAGCAGATGG 0: 1
1: 0
2: 3
3: 29
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163556109 Original CRISPR AGGTGGGGCCCCGGAGCAGA TGG Intronic
900144318 1:1151292-1151314 AGGTGGCTCCTCGGAACAGACGG - Intergenic
900364927 1:2307445-2307467 AGGAGCTGCCCCGGAGCTGAGGG + Exonic
900596094 1:3480850-3480872 AGGTGGGGCCCAGCAGCTGAGGG - Exonic
900727614 1:4228143-4228165 AGGTGGCGCCTGGGTGCAGAAGG - Intergenic
900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG + Exonic
900800774 1:4735765-4735787 AGATGGGACCCCGGAGGAGGCGG - Intronic
901459970 1:9385600-9385622 AGGCGGGGCCCAGGAACAGTGGG - Intergenic
901800007 1:11703120-11703142 TGGAGGGGCCGCAGAGCAGAAGG + Intronic
902549506 1:17210908-17210930 AGCAGGTGCCCGGGAGCAGACGG - Intronic
903016352 1:20364672-20364694 AGATGGGGCCCTAGAGCAGCAGG + Intergenic
903166390 1:21523553-21523575 AGGGGAGGCCCCTGAGGAGATGG - Intronic
903191548 1:21659352-21659374 GGGTGGGGACCCGGAGCCGCCGG + Intronic
903214099 1:21833651-21833673 AGGTGGGCCCCTGGAGCCGTGGG - Intronic
903384220 1:22916231-22916253 ATGTGGGGCCCCAGAACAGTTGG - Intergenic
903483480 1:23671693-23671715 ATGTGGGATCCCTGAGCAGAGGG - Intergenic
903973909 1:27137033-27137055 AGGTGGGCCCTGGGGGCAGATGG - Intronic
904380468 1:30107266-30107288 AGGTGTGGCCCCAGATCATAAGG - Intergenic
905207538 1:36351437-36351459 GAGTGGGGCCCCAGAGCGGAGGG + Intronic
905246177 1:36615545-36615567 AGGTGTGGCCCCAGGGCAGGAGG + Intergenic
905294749 1:36947151-36947173 AGGAGTGGGCCAGGAGCAGATGG - Intronic
905768969 1:40625233-40625255 AGGTGGGTGCCTGGAGCAGATGG + Exonic
906877662 1:49556738-49556760 ACCTGGGGCCTCGGAGCAGGGGG + Intronic
908768653 1:67575883-67575905 GGGTGGAGACCCGGGGCAGAAGG - Intergenic
912514630 1:110210287-110210309 AGGCGGGGCCCCGGAGGAAAAGG + Intergenic
912560706 1:110549460-110549482 AGGTGGGGAGCAGGAGCAGGTGG + Intergenic
915346968 1:155202521-155202543 GGGTGGGGACCAGGAGCACAAGG - Intronic
917537406 1:175884393-175884415 AGGTGCTGGCCAGGAGCAGATGG - Intergenic
919086903 1:192931179-192931201 AGTTTGGGCCCTGGAGCAGCAGG - Intergenic
920067041 1:203276552-203276574 AGCTGAGGCCAAGGAGCAGAGGG - Intergenic
920366978 1:205453351-205453373 AGATGGGACCTCGGAGCAGAGGG - Intronic
920379567 1:205527805-205527827 AGGCGAGGCCCCGGAGCAGCTGG - Exonic
922594178 1:226801027-226801049 AGGTGGGGACACAGAGGAGAGGG - Intergenic
922696233 1:227732328-227732350 TGGAAGGGCCCCGGAGCAGGAGG + Exonic
1063081042 10:2767387-2767409 AGGTGGGGCATGGGAGCAGATGG - Intergenic
1063159688 10:3410161-3410183 AGCTGGGGCCACAGAGCAGATGG - Intergenic
1064283509 10:13971824-13971846 ATGTGGGGCCAGGGACCAGAGGG - Intronic
1064384337 10:14877973-14877995 GGGTGGGGGCCGGGAGGAGAAGG - Intergenic
1064429882 10:15261770-15261792 ACGTGGGGTCCAGGGGCAGAGGG + Intronic
1065171615 10:23035814-23035836 ATGTGGGGCCCAGTAGCTGAAGG - Intronic
1065533697 10:26697976-26697998 GGGTGGGACTCCGGAGCTGAGGG + Intronic
1067917707 10:50418411-50418433 GGGTGTGGCCCGGCAGCAGAGGG + Intronic
1070596741 10:77837985-77838007 GAGTGGTGCCCCTGAGCAGATGG + Intronic
1072710558 10:97713519-97713541 AGCTGGGGGCCTGGCGCAGAGGG + Intronic
1072715933 10:97752764-97752786 TGGAGGGGCCCCCAAGCAGAAGG - Intronic
1074856907 10:117480517-117480539 AGGAGGGGCCCCAGCCCAGAAGG - Intergenic
1076690718 10:132222745-132222767 AGGTGGGGTCGCAGTGCAGACGG + Exonic
1077008952 11:371550-371572 AGGCATGGCCCTGGAGCAGAGGG - Intronic
1077146624 11:1049350-1049372 GGGTGAGGCCAAGGAGCAGAGGG - Intergenic
1077249324 11:1554100-1554122 AGGGAGGGGCCGGGAGCAGAAGG + Exonic
1077342469 11:2032188-2032210 AGGTGGGGACCCAGAGCCGTGGG + Intergenic
1077393823 11:2311607-2311629 AGGTGGGGACCAGGAGCTGCAGG - Intronic
1077533207 11:3106914-3106936 AAGTGGGGCCGCCCAGCAGATGG + Intronic
1078535161 11:12167338-12167360 GGGAGGGGCCCAGGAGCAAAAGG - Intronic
1078748035 11:14133955-14133977 TGATGTGGCCCTGGAGCAGAGGG + Intronic
1080590822 11:33721988-33722010 AGGAGGAGCCTCAGAGCAGAAGG + Intronic
1080617483 11:33957321-33957343 AGGTGGGGCCCCTGGGAAGATGG + Intergenic
1080822913 11:35824273-35824295 ACCTGGGGCTTCGGAGCAGAAGG + Intergenic
1081801562 11:45863239-45863261 AGGTTGGGCCAAGGGGCAGAAGG + Intronic
1082991032 11:59207271-59207293 AGGGGGTGGCCAGGAGCAGAAGG + Exonic
1083285750 11:61657672-61657694 AGGTGGGGCCACGGAGACCATGG + Intergenic
1083572915 11:63769439-63769461 GGGTCGGGCCCCGGCGCAGCCGG - Intergenic
1084647551 11:70467266-70467288 CGGGGGGGCCCCCGAGAAGATGG + Intergenic
1084673759 11:70622542-70622564 AGGGAGGGCCCCGGAACGGATGG - Intronic
1084732188 11:71080791-71080813 ATGCGGGGCCACGGAGCAGCTGG - Intronic
1085040438 11:73323618-73323640 AGGAGGGGCCCAGGAGCGGCAGG - Intronic
1088818517 11:113437654-113437676 AGGTGGAGCCAAGGAGCACAGGG + Intronic
1089402671 11:118173343-118173365 AGGAGGGGCCCAGGGGCAGGAGG - Intronic
1089732396 11:120527368-120527390 GGTGGGGACCCCGGAGCAGATGG + Intronic
1202825455 11_KI270721v1_random:87377-87399 AGGTGGGGACCCAGAGCCGTGGG + Intergenic
1094299491 12:28946318-28946340 AAGTGTGACCCTGGAGCAGAGGG - Intergenic
1096102794 12:48979676-48979698 AGGTGGGGCCCTGGAGCAGTGGG - Exonic
1098773894 12:74588212-74588234 AGGGGGGGCTCCCGGGCAGAGGG + Intergenic
1099237183 12:80095619-80095641 AGGTGAGGACCAGGAACAGATGG + Intergenic
1100610465 12:96187713-96187735 AGGTGAGGTCCTGGAGCACATGG + Intergenic
1102007285 12:109596866-109596888 AGGCGGGGGCCTGAAGCAGATGG - Exonic
1102506015 12:113384967-113384989 GGGTGGGGGCTCGGGGCAGAGGG + Intronic
1102971626 12:117172471-117172493 AGGTGGTGCCAAGGCGCAGAAGG - Exonic
1103212164 12:119175043-119175065 AGGGGAGGCCCGGGAGAAGAAGG - Intergenic
1103723450 12:122986625-122986647 AGGTGGGGCCCGGGAGGATGGGG - Exonic
1103739604 12:123082236-123082258 AGAAGGGGCCCTTGAGCAGAGGG - Intronic
1103971886 12:124677696-124677718 AGCTGGGGCCGCGGGGCAGAAGG - Intergenic
1105278262 13:18948579-18948601 GGGTGGGTCCAGGGAGCAGAGGG - Intergenic
1106160068 13:27193524-27193546 AGGTTGAGCCCGGGAGCTGAAGG + Intergenic
1106490382 13:30216274-30216296 AGGTGGTGACCCCCAGCAGAGGG + Intronic
1106799468 13:33242022-33242044 AGATGGGGCGGCGGGGCAGAGGG - Intronic
1107417767 13:40217219-40217241 AGGTGGGGCCCGGCAGGAGGTGG + Intergenic
1107837424 13:44423080-44423102 AAGTGTAGCCCAGGAGCAGAGGG - Intergenic
1108063265 13:46553378-46553400 TGGGGGGGCCCGGGAGAAGATGG + Exonic
1112375491 13:98836222-98836244 TGGTGGGGCACAGGAGGAGAGGG + Intronic
1113353456 13:109553203-109553225 AGGTGGGGCCATAGAACAGAAGG + Intergenic
1113460618 13:110479596-110479618 AGTTGGAGCCCCGAGGCAGAGGG + Intronic
1113467344 13:110521465-110521487 TGTTGGGTGCCCGGAGCAGATGG + Intergenic
1113840285 13:113355398-113355420 GAGTGGGGCCCAGGCGCAGATGG - Exonic
1113962115 13:114132136-114132158 AGGTGGGGTCCCTGCGCCGAGGG - Intronic
1114197286 14:20489961-20489983 TGCTGGGGCCCAGGAGCAGGTGG + Intergenic
1114493791 14:23119104-23119126 AGGTGGGGGCGGGGAGCCGAGGG - Exonic
1118904795 14:70016022-70016044 AGGTGGGACCCCTGAGCTGGGGG - Intronic
1119418838 14:74494011-74494033 AGGGTGAGCCCGGGAGCAGAAGG - Intronic
1119678572 14:76574841-76574863 ATGTGTGCCCCCGGAGCATAGGG - Intergenic
1120229717 14:81829495-81829517 CGGGGGGGCCCCGAAGCAGGGGG + Intergenic
1122687989 14:103518988-103519010 AGGTAGGGACCCTGGGCAGAAGG - Intergenic
1123105436 14:105839198-105839220 AGATGGGGCCCCGAAGGGGAGGG + Intergenic
1125685184 15:41559477-41559499 GGGTGGGGGTCCGGAGCCGAAGG + Intronic
1126379981 15:48036620-48036642 AGATGGGGACTGGGAGCAGAGGG - Intergenic
1126850944 15:52796394-52796416 AGGTGGGGCTGCGGGGCAGATGG + Intergenic
1128770732 15:70279556-70279578 AAGTGAGGCCCAGGAGCAGTGGG + Intergenic
1129230858 15:74196517-74196539 GGGTGTGGACCCGGGGCAGAGGG + Intronic
1132460864 16:53896-53918 AGGGGCGGCCCTGGAGGAGACGG + Exonic
1132516990 16:370454-370476 TGGGGGGGCGCCGGGGCAGAAGG - Intronic
1132587996 16:714645-714667 CGGTGGAGCCCCAGAGGAGAGGG - Intronic
1132793559 16:1706885-1706907 GGGTGGGGTCCCGGGGCAGGCGG - Intronic
1132871683 16:2118233-2118255 TGGCGGGGGGCCGGAGCAGAGGG + Exonic
1133072247 16:3254395-3254417 GGGGGGCGCCCCGGGGCAGAAGG - Exonic
1133605644 16:7385248-7385270 CAGTGGGGCCCAGGAGAAGAAGG + Intronic
1134550732 16:15137311-15137333 CGGCGGGGGGCCGGAGCAGAGGG + Intronic
1134708516 16:16317313-16317335 CGGCGGGGGGCCGGAGCAGAGGG - Intergenic
1134715731 16:16357346-16357368 CGGCGGGGGGCCGGAGCAGAGGG - Intergenic
1134951086 16:18351332-18351354 CGGCGGGGGGCCGGAGCAGAGGG + Intergenic
1134959026 16:18394813-18394835 CGGCGGGGGGCCGGAGCAGAGGG + Intergenic
1136682034 16:31973390-31973412 GGGTGGGACGCCTGAGCAGAGGG - Intergenic
1136782342 16:32914892-32914914 GGGTGGGACGCCTGAGCAGAGGG - Intergenic
1136887447 16:33938959-33938981 GGGTGGGACGCCTGAGCAGAGGG + Intergenic
1138503351 16:57462862-57462884 AGCCGGGGCCCCGGGGCAGGGGG + Intronic
1139475168 16:67199426-67199448 AGGTGGGGCAGTGGGGCAGATGG - Intronic
1140477952 16:75248453-75248475 AGGTGGGTCCCGGGTGCGGATGG - Intronic
1142227086 16:88882832-88882854 GGGTGGGGCCTGGGAGCAGAGGG - Intronic
1142382797 16:89743204-89743226 AGCTGGGGCCCAAGAGCACAGGG - Intronic
1203085006 16_KI270728v1_random:1178879-1178901 GGGTGGGACGCCTGAGCAGAGGG - Intergenic
1142762299 17:2049859-2049881 GGCTGGGGACGCGGAGCAGAAGG - Intergenic
1143012585 17:3874017-3874039 AGGTGGCGTTCCGGAGCAGAAGG - Intronic
1143289815 17:5820269-5820291 GGGTGGGGGCACGGAGCACATGG - Intronic
1143570603 17:7755622-7755644 AGCTGGGCCCCGGGAGCAGGAGG + Intronic
1143731459 17:8885124-8885146 AGGTGGGGCCCTGGAGAGGCAGG - Intronic
1144754319 17:17669932-17669954 AGGTCGAGACCAGGAGCAGATGG - Intergenic
1144776573 17:17787883-17787905 AGCTGGGTCCCTGGAGGAGATGG + Intronic
1146683727 17:34826553-34826575 AGCTGGGCCCCCGGGGCACAAGG - Intergenic
1147139990 17:38455436-38455458 AGGAGGGGACCCGGAGAGGAAGG + Intronic
1147889078 17:43704537-43704559 AGGGGGGGCCCTTGAGCAGTAGG + Intergenic
1148503182 17:48107446-48107468 CAGTGGGTCCCGGGAGCAGAGGG - Intronic
1149461726 17:56834343-56834365 GGGTGGGGCCCGGGAGGAGACGG + Intronic
1150108437 17:62478660-62478682 AGGCGGGGCGCCGGGGCAGCGGG + Intronic
1151437887 17:74109421-74109443 AGGTACTGCCCCGGAGCAGAGGG + Intergenic
1152538626 17:80963841-80963863 AGGTGGGGCCCGGCCGCACAGGG - Intronic
1152630999 17:81410656-81410678 AGGTGGGGCCCAGGTGCTGGGGG + Intronic
1152884584 17:82842140-82842162 AGGTGGGGCTTCCGGGCAGAGGG - Intronic
1153505337 18:5791019-5791041 AGCTGGGGCTCCGGATCAGTAGG + Intergenic
1154070270 18:11147278-11147300 AGGCGGGGTCCCGGGGCAGCAGG - Intronic
1154389559 18:13924662-13924684 AGGTGGGGTCAGGGAGGAGAAGG - Intergenic
1155570212 18:27184885-27184907 AGGTGGGGGGCGGGAGCAGGAGG - Intronic
1155928943 18:31685579-31685601 CGGTGGGGCCCCGGTGCGGCGGG - Intronic
1157359510 18:46964556-46964578 AGCTGGGTCCTCGGAGCAGCGGG + Intronic
1157361104 18:47024075-47024097 AGCTGGGTCCTCGGAGCAGCGGG + Intronic
1157362094 18:47029990-47030012 AGCTGGGTCCTCGGAGCAGCGGG + Exonic
1157362969 18:47035408-47035430 AGCTGGGTCCTCGGAGCAGCAGG + Exonic
1157595109 18:48859592-48859614 AGCTGGGGCCCTGGTGCACAGGG + Exonic
1158966323 18:62625247-62625269 AGGTGTGGCCCGAGAGCTGAGGG + Intergenic
1160780725 19:876883-876905 AGGTGGGGCCCCGTGGCAGGTGG - Intronic
1160780750 19:876936-876958 AGGTGGGGCCCCGTGGCAGGTGG - Intronic
1160780757 19:876953-876975 AGGTGGGGGCCCGTGGCAGGTGG - Exonic
1160942550 19:1627183-1627205 GGGTGTGGACCGGGAGCAGAGGG - Intronic
1161398917 19:4059115-4059137 AGATGGAGCTCCGGATCAGACGG + Intronic
1161592832 19:5136533-5136555 AGATGTGCCCCCGGGGCAGATGG + Intronic
1162043341 19:7983597-7983619 AGATGGGGCCCGGATGCAGAAGG - Intronic
1162421055 19:10566214-10566236 AGCTGGGTGCCCGGAGCACAGGG - Intergenic
1163029890 19:14537200-14537222 AGGTGGGGCTCAGGAGGAGGAGG + Intronic
1163126381 19:15246431-15246453 TGGAGGGGACCCGGGGCAGAAGG + Intronic
1163556109 19:17993595-17993617 AGGTGGGGCCCCGGAGCAGATGG + Intronic
1163783180 19:19261201-19261223 AGGAGGGGCCTAGGGGCAGAAGG + Intronic
1165477553 19:36039950-36039972 AGGTGGTCCCCGGGAGAAGATGG + Exonic
1165948458 19:39459093-39459115 AGGTGGGGGCAGGGAGCAGGTGG + Intronic
1167036037 19:46995512-46995534 AGGCGGGGACCCAGAGCAGATGG + Intronic
1167426600 19:49432790-49432812 AGGTAGAGCCCAGGAGGAGAGGG - Exonic
1167668445 19:50836384-50836406 AGGGGGCGCCCAGGAGCAGGTGG - Intronic
1167679889 19:50912688-50912710 AGTGGGGGGCCAGGAGCAGAGGG + Intergenic
1168172020 19:54595558-54595580 TGGTGAGGCCCCGGGGGAGAGGG + Intronic
925278905 2:2669446-2669468 AGGTGAGGACCCGGAGCCAAGGG + Intergenic
925278915 2:2669490-2669512 AGGTGAGGACCTGGAGCCGAGGG + Intergenic
927184602 2:20473262-20473284 AGCTGGGGCCCCTCAGTAGACGG - Intergenic
929119693 2:38474275-38474297 AGGTGGGGTCATGGAGCAGGAGG + Intergenic
929542020 2:42829905-42829927 AGGAGGGGCCCAGGTGCAGGAGG - Intergenic
930370659 2:50497213-50497235 AGGTGGTGGGCCGGAGCAGGTGG - Intronic
931869918 2:66446096-66446118 GGCTGCGACCCCGGAGCAGAGGG + Intronic
934567874 2:95350583-95350605 AGCAGGGGGCCCGGAGCAGCAGG + Intronic
935738455 2:106125635-106125657 ATGTGGAGGCCAGGAGCAGACGG + Exonic
935744383 2:106177924-106177946 AGGTGGGTGCCCAGAGCAGAGGG - Intronic
936033112 2:109087774-109087796 AGGTGGGGCCCTGGAGGAGTGGG + Intergenic
936250530 2:110864961-110864983 AGGTGGGGACCCGGGACAGTTGG + Intronic
936593247 2:113823549-113823571 AGGTGGGGCCCAGGAGGTCAAGG + Intergenic
937511268 2:122598154-122598176 AGGTGGGGCCTAGGGGCAGCAGG - Intergenic
938311160 2:130288828-130288850 AGGCGCGGCCCCGGAGCTGCAGG - Intergenic
944468623 2:200029580-200029602 GGGTGGGGCCCAGGAGAAAAAGG - Intergenic
946839696 2:223808186-223808208 AAGTAAGGCCCCAGAGCAGAAGG + Intronic
946855391 2:223945127-223945149 AGGTAGGGCCCGGGCGCAGCCGG - Exonic
948074671 2:235156631-235156653 AGGTGGGGCCCCGGAGTATGGGG - Intergenic
948481893 2:238255343-238255365 AGGTGGGGCCCCTGCCCACATGG + Intronic
948843807 2:240673233-240673255 CCGTAGGGCCCTGGAGCAGAAGG + Intergenic
948849956 2:240701071-240701093 CCGTAGGGCCCTGGAGCAGAAGG - Intergenic
948883414 2:240871531-240871553 GGGTGGGGACCAGGGGCAGAAGG - Intronic
1170247727 20:14241747-14241769 AGGAGGGGCCCTGTAGCAGAAGG + Intronic
1170692921 20:18631324-18631346 AGGTGGGGCCCCTCTGAAGATGG + Intronic
1170727969 20:18946891-18946913 AGATGGGGCCCAACAGCAGATGG + Intergenic
1171461318 20:25299696-25299718 ACGTGGGTCCCCGGCTCAGATGG + Intronic
1172105353 20:32514014-32514036 AGGTGGGGACCCGGAATAGCTGG + Intronic
1172240825 20:33411470-33411492 AGGTGGGTGGCAGGAGCAGATGG - Intronic
1172245740 20:33443831-33443853 GGGCGGGGCCCGGGAGCCGAGGG + Exonic
1172916926 20:38450305-38450327 AGGAGGGGCCACAGAGCAGAAGG - Intergenic
1172938809 20:38640654-38640676 AGGAGGGGCCCAGGAGGAAAGGG - Intronic
1175350311 20:58313394-58313416 AGGTGGGGCTCCAGAGCTCAGGG - Intronic
1175827420 20:61943662-61943684 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827450 20:61943812-61943834 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827459 20:61943862-61943884 AGGGGCGGCCACGGGGCAGACGG - Intergenic
1175827477 20:61943962-61943984 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827486 20:61944012-61944034 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827495 20:61944062-61944084 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827504 20:61944112-61944134 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827519 20:61944192-61944214 AGGGGCGGCCACGGGGCAGACGG - Intergenic
1175827538 20:61944292-61944314 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827547 20:61944342-61944364 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827563 20:61944442-61944464 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827572 20:61944492-61944514 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827581 20:61944542-61944564 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827590 20:61944592-61944614 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827599 20:61944642-61944664 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827624 20:61944789-61944811 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827633 20:61944839-61944861 AGGGGCGGCCACGGTGCAGATGG - Intergenic
1175827649 20:61944939-61944961 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827681 20:61945139-61945161 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827742 20:61945539-61945561 AGGGGCGGCCACGGTGCAGATGG - Intergenic
1175827782 20:61945789-61945811 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827829 20:61946089-61946111 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827907 20:61946589-61946611 AGGGGCGGCCACGGTGCAGATGG - Intergenic
1175827931 20:61946735-61946757 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827948 20:61946832-61946854 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175827987 20:61947079-61947101 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175828057 20:61947529-61947551 AGGGGTGGCCACGGTGCAGACGG - Intergenic
1175828106 20:61947825-61947847 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1175828157 20:61948122-61948144 AGGGGCGGCCACGGTGCAGACGG - Intergenic
1176010180 20:62889219-62889241 AGGTGCAGCCCCGGGGCAGAGGG - Intronic
1176177221 20:63734434-63734456 AGGAGGGGCCACGGTGCAGCAGG + Intronic
1176253592 20:64139215-64139237 AGCTGGGGCCCCCGTGGAGAGGG + Intergenic
1177094262 21:16811801-16811823 AGAAGGAGCCCCGGAGCATAGGG - Intergenic
1179919616 21:44500350-44500372 ACGTGGGGCCGCAGAGCAGCGGG - Intronic
1180082193 21:45492033-45492055 AGGTGGGGAGCTGGAGCACAAGG - Intronic
1180727342 22:17956198-17956220 CTGTGGGGCCCCGGAGGAGTGGG - Intronic
1181464941 22:23105925-23105947 AGGTGGGACCCAGGTGCTGAGGG + Intronic
1183029008 22:35087958-35087980 GAGTGGGACCCCAGAGCAGAGGG - Intergenic
1183341685 22:37285032-37285054 AGGAGGGACCCTGGGGCAGAGGG - Intronic
1183538643 22:38417279-38417301 AGGTGGGGCCGTGGAGAGGATGG - Intergenic
1183548898 22:38469609-38469631 AGTGGGGGACCCGGAGCAGCAGG + Intronic
1183588524 22:38767054-38767076 CAGTGGGACTCCGGAGCAGAGGG - Intronic
1184264388 22:43339269-43339291 AGGTGTGGCCCCAGGGCAGGTGG + Intronic
1184413783 22:44340460-44340482 AGCTGGGGACCTGGACCAGATGG + Intergenic
1184769011 22:46587237-46587259 ATCTGGGGCTCCGGAGTAGAAGG + Intronic
1184954565 22:47877131-47877153 CGGTGGTGGCCCGGACCAGATGG - Intergenic
1185094370 22:48798389-48798411 CTGTGGGGCCCCGGGGCTGAAGG + Intronic
1185273835 22:49941407-49941429 AGGTGGGGACTGGGAGCAGCAGG + Intergenic
1185280597 22:49968287-49968309 AGTTGGGGGCAAGGAGCAGAGGG + Intergenic
1185286847 22:50004992-50005014 AGGTGAAGCCACGGAGGAGAAGG + Intronic
950533453 3:13566445-13566467 AGGTGGGGGCATGGAGGAGATGG - Intronic
952878878 3:37970740-37970762 AGGAGGGGTCTCTGAGCAGAGGG - Intronic
952978124 3:38713612-38713634 AGGTGGGGCCCCGGAGCTCAGGG + Intronic
953686997 3:45085794-45085816 AGTTGGGGCCCTGGAGCATATGG + Exonic
953796826 3:45992328-45992350 AGGTGGGGCCATGCTGCAGATGG + Intronic
954447259 3:50553426-50553448 AGGTGGTGCCCAGGAGCATCAGG + Intergenic
955338971 3:58110176-58110198 TGGTGGGGCCTGGGAGGAGATGG + Intronic
956157821 3:66317402-66317424 GGGAGGGGCCCCGGAGAATAGGG - Intronic
960975950 3:123174189-123174211 AGGTGGAGCAGTGGAGCAGAGGG + Intronic
961463954 3:127070296-127070318 GGGTGGGGCCCCAGCGCACAGGG + Intergenic
961743274 3:129046959-129046981 CGGAGGGGCCCCGGAGCGGGAGG - Intergenic
966255716 3:177914516-177914538 TGGTGGGGCCGCCGGGCAGAGGG + Intergenic
966794183 3:183698124-183698146 CGGTGAGGCCCCGGGGCCGAGGG + Intronic
967178746 3:186885067-186885089 AGATGGGGCGGCGGGGCAGAGGG + Intergenic
967488051 3:190057056-190057078 AAGTGGGGAACTGGAGCAGAAGG + Intronic
967876977 3:194274071-194274093 AGGTGGGTCCCAGAAGCAGCAGG - Intergenic
968427379 4:532918-532940 AGGTGGGGCCTAGGAGTGGAAGG + Intronic
968444842 4:646795-646817 AGGCAGCGCACCGGAGCAGATGG - Intronic
968445111 4:648528-648550 AGGTGAGGGCCCGGGACAGAGGG - Intronic
968765230 4:2464858-2464880 AGGTTGGCCTCTGGAGCAGAGGG + Intronic
974678181 4:65123874-65123896 AGGTGGGCACCAGGAGCTGAGGG - Intergenic
981053209 4:140332134-140332156 AGGTGGGGCCTGGTAGCAGGCGG - Intronic
984807535 4:183765489-183765511 AGCTGGGGCACGGGAGCAGTCGG + Intergenic
985682174 5:1261800-1261822 AGCAAGGGCCCCGGAGCAGGAGG + Intronic
985966546 5:3342578-3342600 CGGTGTGGCCCAGGACCAGAGGG - Intergenic
985966575 5:3342726-3342748 CGGTGTGGCCCAGGACCAGAGGG - Intergenic
986258501 5:6122251-6122273 AGCTGGGGGCTCAGAGCAGAGGG + Intergenic
987373860 5:17217324-17217346 AGGTGGGGGCCCAGAGCTGGGGG + Intronic
990199040 5:53350501-53350523 ATGTGGGGCCTCGAAGCAAAGGG - Intergenic
996091423 5:119355768-119355790 AGGTGGGGCACAGGCCCAGACGG - Intronic
997832007 5:137158225-137158247 AGGAGGAGCCCCAGGGCAGAGGG + Intronic
997853206 5:137351193-137351215 AGGTGGGGATCCAGTGCAGAAGG - Intronic
998139262 5:139690648-139690670 AGGTGGGGGCCCGGAGCTCTGGG - Intergenic
998472688 5:142395631-142395653 AGGTGGGACCCTGAAGCACAGGG + Intergenic
999133167 5:149299821-149299843 AGGTGGGGCCCCAGTGGACAAGG - Intronic
1000046396 5:157525332-157525354 AGGTGGGAGCCTGGGGCAGAAGG - Intronic
1001584124 5:172821216-172821238 AGGTGGGGCTCAGGAAAAGAGGG + Intergenic
1002389187 5:178896081-178896103 AGGGGCGGGCCCGCAGCAGATGG + Intronic
1002603743 5:180370131-180370153 AGGTGGAGCCCGGGAGCCTAGGG + Intergenic
1002925691 6:1604719-1604741 AGGGGCGGCCTGGGAGCAGACGG + Intergenic
1003302143 6:4893333-4893355 GGTGGGGGCCCCTGAGCAGATGG - Intronic
1004511196 6:16285839-16285861 AGGCCGGGCCCTGGTGCAGAGGG + Intronic
1005033461 6:21533400-21533422 AGGTGGGGTCCAGGAGCCGTGGG - Intergenic
1006170305 6:32088220-32088242 GGGTGGGGCCCTGTAGCTGAAGG + Intronic
1006302133 6:33199338-33199360 AGGGGTGGCCCAGGAGGAGAAGG + Exonic
1006625199 6:35392766-35392788 TGGTGGGTCACCAGAGCAGAAGG - Intronic
1007321397 6:41031031-41031053 GGGTGGGGCCGTGGAGCAGTGGG + Intronic
1007418933 6:41707672-41707694 AGGTGGAGCCCAGGGGAAGAAGG + Intronic
1007495756 6:42259501-42259523 GGGTGGGGTCCAGGAGCAGGTGG + Exonic
1007519773 6:42442487-42442509 CTGTGGGGCCCCTCAGCAGAGGG - Intronic
1007581527 6:42963021-42963043 TGCTGGGGGCCCTGAGCAGATGG + Intronic
1014490215 6:122053382-122053404 AGGTGGGGCTGCGGGGCAGGAGG + Intergenic
1015190667 6:130468249-130468271 TGAGGGGGCACCGGAGCAGAGGG - Intergenic
1017408697 6:154147075-154147097 AGGTGGGGAAGGGGAGCAGAAGG + Intronic
1020078472 7:5274074-5274096 GTGTGGAGCCCAGGAGCAGAGGG + Intergenic
1021095128 7:16527083-16527105 AGGTGGGGCCCTGGGGCAGGGGG - Intronic
1022466397 7:30655559-30655581 AGGTGGGGCCTGTGACCAGATGG - Exonic
1023185346 7:37527284-37527306 AGGTGGGGCCCTGGAGGATGGGG + Intergenic
1025263438 7:57438006-57438028 AACTGGGGCCTCGGGGCAGAGGG - Intergenic
1025740150 7:64188327-64188349 AGGTGAGGCTCCTGGGCAGATGG - Intronic
1027137007 7:75631697-75631719 ATTTGGGGCTCCGGAGCAGGGGG + Intronic
1027270148 7:76514477-76514499 AGGTGAGGCCCGGGAGGAGAAGG - Intronic
1030005308 7:105112653-105112675 AGGTGCGGTCCTGGAGCAGGTGG - Exonic
1032037477 7:128531194-128531216 AGGCGGGGCGCCGGGGCAGCGGG + Intergenic
1032084019 7:128874295-128874317 AGGTGGGGACCCTGAGCAGCCGG - Intronic
1032696090 7:134337608-134337630 ATGTGGGGCCCAGGAGGAAATGG + Intergenic
1033527090 7:142226892-142226914 AGATGGGACCCTGAAGCAGACGG - Intergenic
1034455628 7:151168194-151168216 GGGCGGCGGCCCGGAGCAGAGGG - Intronic
1034535988 7:151726077-151726099 AGGTGGGACCCCTGTGGAGAGGG - Intronic
1034972023 7:155425132-155425154 AGGTGAGGTCCTGCAGCAGAAGG - Intergenic
1035203665 7:157281416-157281438 AGGTTGGGGCCCGGAGCCGCTGG - Intergenic
1035291889 7:157844507-157844529 AGGTGAGGGCCAGGAGGAGAGGG + Intronic
1037462797 8:19130260-19130282 AAGTGGTGTCCCGCAGCAGATGG - Intergenic
1037947534 8:22998976-22998998 AGGTGGGGACCCGCTGAAGAAGG + Intronic
1045436685 8:102171329-102171351 AGCAGGGGCCCAGAAGCAGAGGG - Intergenic
1048171598 8:132111895-132111917 ATGTGGGCCCTAGGAGCAGAAGG - Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049240841 8:141536733-141536755 AGTGGGTGCCCCGGAGCTGATGG - Intergenic
1049411476 8:142475703-142475725 GGGTGGGGCCCTGGAGAGGAGGG + Intronic
1049654672 8:143792353-143792375 AGGTGGCGCCCCGGTGCGGACGG - Exonic
1049661208 8:143820448-143820470 AGGTGGGCCCTCAGAGCAGATGG + Intronic
1049823107 8:144648150-144648172 AGCTGGGGCCGTGGAGCAGCTGG - Intergenic
1053076659 9:35139551-35139573 AGGTGAGGCCCTGGAACAGGTGG - Intergenic
1055538847 9:77279291-77279313 AGGTTGGGCCACCCAGCAGATGG + Intronic
1057600211 9:96450705-96450727 AGGAGGGGCCCGGGAACAGTAGG + Intronic
1057675257 9:97132406-97132428 AAGTGGGACCCAGGAGAAGAGGG + Intergenic
1060200694 9:121650434-121650456 AGGTGGGGCCCTGGAGTGGGCGG - Intronic
1060543687 9:124448341-124448363 ATTTGAGGCCCCGGAGCAGTTGG - Intergenic
1062190389 9:135245018-135245040 ATGTTGAGCCCAGGAGCAGATGG - Intergenic
1062467162 9:136686559-136686581 AGCTGGGCCCCCGGAGCTGTAGG + Intronic
1187098631 X:16170321-16170343 AGGTGGGCACCTGGAGCAGGAGG - Exonic
1191761479 X:64652363-64652385 AGGAGGGGCCACGAAGAAGAAGG - Intergenic
1196707423 X:118727927-118727949 AGGTGGGACCCGGGAGCTGCGGG + Intronic