ID: 1163557128

View in Genome Browser
Species Human (GRCh38)
Location 19:17999200-17999222
Sequence CTGGGACCACACTGCGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163557118_1163557128 28 Left 1163557118 19:17999149-17999171 CCATGGTGGGATGGGGGGGAAAC 0: 1
1: 0
2: 3
3: 18
4: 229
Right 1163557128 19:17999200-17999222 CTGGGACCACACTGCGAGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 147
1163557121_1163557128 0 Left 1163557121 19:17999177-17999199 CCCAGAGAGGTGAATCTACCTAC 0: 1
1: 0
2: 1
3: 11
4: 180
Right 1163557128 19:17999200-17999222 CTGGGACCACACTGCGAGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 147
1163557122_1163557128 -1 Left 1163557122 19:17999178-17999200 CCAGAGAGGTGAATCTACCTACC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1163557128 19:17999200-17999222 CTGGGACCACACTGCGAGGAAGG 0: 1
1: 0
2: 2
3: 15
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163557128 Original CRISPR CTGGGACCACACTGCGAGGA AGG Exonic
901005822 1:6171068-6171090 CTGGGACCACCCTGCCGGAAGGG - Intronic
901878321 1:12179611-12179633 CTGTGAACACACTGTGAGCAGGG - Intronic
903335659 1:22622617-22622639 TTGGTACCACACAGCCAGGAAGG + Intergenic
904326717 1:29731304-29731326 CCAGGACCACACTGAGAAGAGGG - Intergenic
907614943 1:55913791-55913813 CTGGGCCCACACTGCATGGAAGG - Intergenic
911104439 1:94118747-94118769 CTGGGAGCACACTGTGGAGAAGG + Intronic
922349291 1:224722565-224722587 CAGGGACCACACTTTGAGCAGGG + Intronic
922932746 1:229403118-229403140 CAGGGACCACCCTGGGAGCATGG - Intergenic
924472087 1:244351477-244351499 CTGGAACCACACTAAGAGAAAGG - Intergenic
924603875 1:245515676-245515698 ATGGGCCCACACTGCAAGGATGG - Intronic
1062809643 10:452930-452952 CTGAGGCCCCAGTGCGAGGAAGG + Intronic
1062823195 10:549886-549908 AGGGGCCCACACTGCTAGGAAGG + Intronic
1063716597 10:8533531-8533553 CTGAGGCCACAGTACGAGGAGGG + Intergenic
1067445118 10:46337080-46337102 CTGGGGCCGCACTGTGAGGTGGG + Intergenic
1070405398 10:76090171-76090193 CTGGGTCCTCACTGCTCGGAGGG - Intronic
1070649119 10:78222269-78222291 CTGGGAGGACACTGCCAGGCCGG + Intergenic
1073443036 10:103564140-103564162 CTGGGACCCCGCTGAGAGGCAGG + Intronic
1074967128 10:118501228-118501250 CTGTGACCACACTTCCAGGAGGG - Intergenic
1074967132 10:118501251-118501273 CTGTGACTACACTTCCAGGAGGG - Intergenic
1075438213 10:122460585-122460607 CTGGGTCCACACTGAGCAGATGG - Intergenic
1075673492 10:124280398-124280420 CTGAGGCCACACAGCCAGGAAGG + Intergenic
1076583900 10:131532497-131532519 CTGGGCCCCCACAGCGAGGCAGG + Intergenic
1077470774 11:2759531-2759553 GTGGGACCTCACTGCGCGGGAGG + Intronic
1083186741 11:61022033-61022055 CTGAGGCCACACTGCCAGGAGGG - Intergenic
1084115742 11:67042002-67042024 CTGTGAGCAGAGTGCGAGGAGGG + Intronic
1084792800 11:71485361-71485383 GTGGGACCACCCCGAGAGGAAGG + Intronic
1086276609 11:85137490-85137512 CTGGGTCCAAACTGAGAGTATGG + Intronic
1087640426 11:100749775-100749797 CTGGAACAACACTGCAAGTAGGG + Intronic
1088606764 11:111540649-111540671 CTGGGACGTCACTGCGAGGAGGG - Exonic
1096509874 12:52121805-52121827 CTGGAACCAGAATGCGAGAAGGG - Intergenic
1097996082 12:65888990-65889012 CTGTGTCCACACTAGGAGGAAGG + Intronic
1098767559 12:74509123-74509145 CTGAGATCAAACTGCGAGGCTGG - Intergenic
1103341047 12:120221349-120221371 CTGGGAGCACCCAGGGAGGAAGG + Intronic
1104928240 12:132324841-132324863 CTGGGACCCCACTGTGGCGAAGG + Intronic
1104984297 12:132587871-132587893 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1104984319 12:132587960-132587982 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1106184237 13:27394862-27394884 CTTGGACCACACTTTGAGAATGG + Intergenic
1106264791 13:28100399-28100421 CCGGGTCCACACTGCGGGGTGGG + Intronic
1109661014 13:65460342-65460364 CTTGGACCACACATTGAGGAAGG + Intergenic
1109839338 13:67902329-67902351 CCGGGACAACCCAGCGAGGACGG - Intergenic
1121825435 14:97006702-97006724 CTGGGATCACCCTGGTAGGAAGG + Intergenic
1122699592 14:103578985-103579007 CTGGGGCCACACAGCCAGGTGGG + Intronic
1122902109 14:104786259-104786281 CTGGGAACCCACTGGGTGGAGGG - Intronic
1126694416 15:51314022-51314044 CTAGGGTCACACAGCGAGGAAGG - Intronic
1129887328 15:79047805-79047827 CACGGTCCACACTGGGAGGAAGG + Intronic
1130098476 15:80873861-80873883 CAGGGAGCACACTGCCAGGATGG + Exonic
1132506796 16:314165-314187 CTGGGACCTCCCTATGAGGAAGG - Intronic
1132732249 16:1368144-1368166 CTGGGACCACACCATGAGGTGGG + Intronic
1134450566 16:14360823-14360845 CTGGGCTCACACAGCTAGGAGGG + Intergenic
1135177931 16:20247653-20247675 CTGGGTCCACACTGGAAGGTGGG - Intergenic
1136254402 16:29028738-29028760 CAGGGACCACCCTCTGAGGAAGG - Intergenic
1138086123 16:54135228-54135250 CTGAGACCACACAGCAATGATGG + Intergenic
1138541528 16:57690543-57690565 CAGGGACCACTCTGGGATGAGGG - Intergenic
1141379736 16:83565539-83565561 CTGGGAACTCCCTGAGAGGAAGG + Intronic
1141631972 16:85292822-85292844 CTGGGACCACACAGAGGTGACGG - Intergenic
1141783969 16:86185914-86185936 CAGGGACCACACTTTGAGTAGGG + Intergenic
1142670665 17:1486063-1486085 CTGGGACTACACTCCGCGGCGGG + Intronic
1143173071 17:4941079-4941101 CTCGGACCACAATGCCAGCATGG + Exonic
1143433018 17:6900691-6900713 CTGGGACAGGACTGAGAGGAAGG - Intronic
1143652997 17:8275838-8275860 CTGGGAGCACACTGCTAGCCAGG - Intergenic
1144575840 17:16428828-16428850 CTGGGACACCACTGTGAGCAGGG - Exonic
1146437236 17:32861598-32861620 CAGGGACCACACTTTGCGGAAGG - Intronic
1148746802 17:49922923-49922945 CTGGGATCACACTCCCAGGCCGG - Intergenic
1149604680 17:57916385-57916407 CTGGGATCAAAGTGGGAGGAGGG - Intronic
1152045627 17:77933296-77933318 CTGGAAGGAAACTGCGAGGAAGG - Intergenic
1152700235 17:81814993-81815015 CAGGGACCACACAGCGGGGGTGG + Intergenic
1153956589 18:10101619-10101641 CTGGGAGCGCATTTCGAGGAGGG + Intergenic
1155493644 18:26422625-26422647 GTGGGACCTCACAGGGAGGAGGG - Intergenic
1156987841 18:43370375-43370397 CTGGGACTACACTGAAAGGATGG + Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1162624593 19:11874511-11874533 CTGTGTCCACACTGTGGGGAGGG + Intronic
1162629687 19:11917345-11917367 CTGTGTCCACACTGTGGGGAGGG + Intergenic
1162634741 19:11958576-11958598 CTGTGTCCACACTGTGGGGAGGG + Intronic
1163018216 19:14469700-14469722 GTGGGGCCACCCTGCAAGGAGGG - Intronic
1163557128 19:17999200-17999222 CTGGGACCACACTGCGAGGAAGG + Exonic
1163990528 19:20995106-20995128 CTGGGTGCACACTGCGTGCAGGG - Intergenic
1164777092 19:30861434-30861456 CTGGGACCTGACTGTGAGAAGGG + Intergenic
1164979601 19:32603900-32603922 CTGTGTTCACACTGTGAGGATGG + Intronic
1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG + Intronic
1167027099 19:46928539-46928561 CTGGAGCCAAACAGCGAGGAGGG - Intronic
1168294966 19:55373837-55373859 CTGCAGCCACACTGCGGGGACGG - Intergenic
925652571 2:6107020-6107042 CTGGCATCCCACTGCTAGGATGG - Intergenic
927467438 2:23347950-23347972 CTGAGAGCACACAGTGAGGAAGG + Intergenic
928489325 2:31765049-31765071 CTGGGACCACACAGCTTGGTGGG + Intergenic
932426763 2:71642701-71642723 TTAGGACCACACTTCCAGGACGG + Intronic
933471926 2:82736337-82736359 CTGAGACCATACTGTAAGGAAGG - Intergenic
936077734 2:109412350-109412372 CTGGGGCCACACTGGGAGGGTGG - Intronic
1172009481 20:31838030-31838052 CTGGAACCCCAGTGGGAGGATGG + Intergenic
1172105602 20:32515520-32515542 GTGGGTGCACACTGAGAGGATGG + Intronic
1173182074 20:40813216-40813238 CTGGGACCCCACTGGGGGAAAGG + Intergenic
1173825204 20:46043750-46043772 CTGGGACCACCCTCGGGGGAGGG + Intronic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174842373 20:53912245-53912267 CTGTGGCAACACTGCGAGGTTGG - Intergenic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176165004 20:63668151-63668173 CCGGGCACACACTGGGAGGAGGG - Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179307638 21:40169517-40169539 CTTGGTCCTCAGTGCGAGGACGG - Intronic
1181430349 22:22877701-22877723 CTGGGACCAGCCTGCCAGGGAGG - Intronic
1184385678 22:44173149-44173171 CTGGGACCACAAGGAGAAGAGGG + Intronic
1184975483 22:48058611-48058633 ATGGGACCAGGCTGGGAGGAGGG - Intergenic
1185372952 22:50469361-50469383 CTGGGGCCCCACGGAGAGGAGGG - Intronic
1185388123 22:50545830-50545852 CTGGGCCCAGGCTGAGAGGAGGG + Intergenic
950427022 3:12929853-12929875 CTGGGAGCACACAGCAGGGATGG - Intronic
952362030 3:32640071-32640093 CTGGCACCACAAAGCAAGGAGGG + Intergenic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
954876346 3:53805454-53805476 CTGGGACCATCCTGAGAGGGAGG + Intronic
958574770 3:95934797-95934819 CTGAGACCACCATGCAAGGATGG - Intergenic
961560170 3:127723334-127723356 CTGGGACCACACAGCCAGAGGGG + Intronic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
968181888 3:196601465-196601487 CTGGCACCACACTGACAGGTTGG + Intergenic
968763934 4:2458494-2458516 CCAAGACCACACTGGGAGGAAGG + Intronic
969535855 4:7755713-7755735 CTGGCACCCCCCTGCCAGGACGG - Intergenic
969636674 4:8373561-8373583 CTGGGAACACAAAGCCAGGACGG + Exonic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
979373864 4:119921218-119921240 CTGAGAACATACTGCTAGGATGG - Intergenic
981843620 4:149141010-149141032 CTGGGAGCTCACTGAGAGAAGGG + Intergenic
985064287 4:186105433-186105455 CTGGGACCACCAGGCGAGCAGGG - Intronic
988375824 5:30434508-30434530 CTGGGACCACCATGCAATGAGGG - Intergenic
992494858 5:77282213-77282235 CTGGGACCACAGGGCCAGGCTGG - Intronic
993320540 5:86463842-86463864 CTGGCAGCACAATGCGAGGCAGG + Intergenic
995903303 5:117094205-117094227 CTGGGGGCACACTGCAGGGAAGG - Intergenic
997578911 5:135005047-135005069 CCAGGACCACACAGGGAGGAGGG + Intronic
998790610 5:145762923-145762945 CTGGGGCCACACTTTGAGAATGG - Intronic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1001961121 5:175880772-175880794 CTGGGCCCCCACTGCCAGGCTGG + Exonic
1002364120 5:178696894-178696916 CTGGGAAAACACCGCGAGAAAGG + Intergenic
1003613334 6:7632589-7632611 CTGAGACCACACAGAGAGAAAGG + Intergenic
1004251035 6:14023354-14023376 CTGGGGCCACACCCTGAGGACGG - Intergenic
1004269306 6:14179720-14179742 TTGGGACTCCACTGCCAGGAGGG - Intergenic
1004780077 6:18898425-18898447 CTGTCACCACTCTGGGAGGAGGG - Intergenic
1005873657 6:29995443-29995465 CTGGGACCAGGCTGAGAGGGAGG - Intergenic
1007500446 6:42293024-42293046 CTGGGGACACACTGCCTGGAAGG + Intronic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1010347143 6:74825033-74825055 CTGACACCACAGTGTGAGGATGG + Intergenic
1022102334 7:27175869-27175891 CTGGATTCACACTGGGAGGAAGG - Intronic
1022503323 7:30895954-30895976 CTGGGAGCACATTGAGGGGATGG + Intergenic
1023181883 7:37492739-37492761 CTGGGAACCCACTGGGAGGGAGG + Intergenic
1023498641 7:40825042-40825064 CTGGGACCACATAGTGAAGATGG - Intronic
1024479507 7:49849431-49849453 CTGGGAGCAGACTGTCAGGAAGG + Intronic
1027224337 7:76234540-76234562 CTGGGAGCAGACTGGGAGGTAGG + Intronic
1030004468 7:105103596-105103618 CTGGAGCCAGACTGCCAGGAGGG - Intronic
1031371850 7:120977704-120977726 CTGGGAGAACACTGGGAGGCAGG + Intergenic
1034840274 7:154389070-154389092 CTGGGTGCTCACTGCGGGGACGG - Intronic
1035553187 8:545134-545156 CGGGGACCACACTGGGAGGAGGG - Intronic
1035687843 8:1538744-1538766 CTGTGGCCACGCTGCGGGGAGGG - Intronic
1037460654 8:19105190-19105212 CTGAGACTAGACTGGGAGGATGG + Intergenic
1037489524 8:19385105-19385127 CTGGGACCAAAGCACGAGGAGGG - Intronic
1039756133 8:40525024-40525046 CTGGGAGCAGATGGCGAGGAGGG - Intergenic
1048996030 8:139794197-139794219 CTGGGACCACAGTGGGAGCCAGG - Intronic
1051798910 9:20908901-20908923 CTGGGAGCTCATTGTGAGGAAGG - Intronic
1055421285 9:76145672-76145694 CTGTGACCACACTGAGACCATGG + Intronic
1056774390 9:89500169-89500191 TTGGGAACACACTGCAGGGAGGG + Intergenic
1057212851 9:93210033-93210055 TTGGGGCCCCACTGTGAGGATGG + Intronic
1059571265 9:115438851-115438873 CTGGGACCCTACAGCTAGGAAGG - Intergenic
1060252471 9:121997366-121997388 CTGGGACTGCACTGTGGGGAAGG - Intronic
1061892792 9:133631541-133631563 AAGGGACCACACTGCCAGGATGG - Intergenic
1062095005 9:134698606-134698628 CAGGTACAACACTGGGAGGAAGG - Intronic
1062234262 9:135500558-135500580 CTGGGACCTCCCTGCGGGGGCGG - Exonic
1185926891 X:4157196-4157218 ATGGTACCACACTGATAGGAGGG + Intergenic
1186205107 X:7192201-7192223 CTGGGAACACACTGCCAGCATGG - Intergenic
1192331828 X:70181933-70181955 CATGGACCAGACTGAGAGGATGG - Intronic
1195426070 X:104731971-104731993 CTCTGACCACACTGCAAAGAAGG + Intronic
1198389471 X:136159782-136159804 CTGGGACTCCACTGCAAAGATGG - Intronic
1199032047 X:143012394-143012416 CTGGAATCACACTGCCAGAAAGG - Intergenic
1200243958 X:154512913-154512935 CTAGGACCACAATGCGGAGAGGG + Exonic