ID: 1163557320

View in Genome Browser
Species Human (GRCh38)
Location 19:18000127-18000149
Sequence GGGGAAACTAAGGCCTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 886
Summary {0: 1, 1: 3, 2: 23, 3: 177, 4: 682}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163557313_1163557320 0 Left 1163557313 19:18000104-18000126 CCTTTCTACCCTGTTGTCTGGCT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1163557320 19:18000127-18000149 GGGGAAACTAAGGCCTGAGAAGG 0: 1
1: 3
2: 23
3: 177
4: 682
1163557318_1163557320 -9 Left 1163557318 19:18000113-18000135 CCTGTTGTCTGGCTGGGGAAACT 0: 1
1: 0
2: 1
3: 28
4: 297
Right 1163557320 19:18000127-18000149 GGGGAAACTAAGGCCTGAGAAGG 0: 1
1: 3
2: 23
3: 177
4: 682
1163557317_1163557320 -8 Left 1163557317 19:18000112-18000134 CCCTGTTGTCTGGCTGGGGAAAC 0: 1
1: 0
2: 1
3: 33
4: 259
Right 1163557320 19:18000127-18000149 GGGGAAACTAAGGCCTGAGAAGG 0: 1
1: 3
2: 23
3: 177
4: 682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163557320 Original CRISPR GGGGAAACTAAGGCCTGAGA AGG Intergenic
900323556 1:2096414-2096436 GGGGAAACTCTGCCCAGAGAAGG - Intronic
900396864 1:2456682-2456704 GGGGAAACTGAGGCCCAAGGAGG - Intronic
900457166 1:2782778-2782800 GAGGAAACTGAGGCCTGGGGAGG + Intronic
900542478 1:3210347-3210369 GGGGAAACCAAGGCCCTGGAAGG + Intronic
900906969 1:5566045-5566067 GGGTAAACTGAGGCTCGAGAGGG + Intergenic
900939909 1:5792038-5792060 GGGGAAACAAAGACCACAGATGG - Intergenic
901395250 1:8976430-8976452 GAGGAAGCTAAGGCATGGGAAGG - Intergenic
901511095 1:9718415-9718437 GGGGAAACTGAGGCCTGGAGTGG + Intronic
901778932 1:11579847-11579869 GGGGAAACTGAGGCTTGAAGAGG - Intergenic
901869673 1:12130577-12130599 GGGGAATCACAGGCCAGAGAGGG + Intronic
901873723 1:12153799-12153821 GGGGAAACTGAGGCCTGAGAAGG + Intergenic
901879878 1:12187603-12187625 CAGGAAACCGAGGCCTGAGAGGG - Intronic
902184904 1:14717760-14717782 GGGGAAACTGAGGCCCAAGAGGG + Intronic
902399281 1:16149165-16149187 AAGGAAACTGAGGCCTGAGGCGG + Intronic
902449091 1:16485325-16485347 GGGGAAACTGAGGCCCAAGAGGG - Intergenic
902468482 1:16632032-16632054 TGGGAAACTGAGGCCCAAGAGGG - Intergenic
902505653 1:16937956-16937978 GGGGAAACTGAGGCCCAAGAGGG + Intronic
902633692 1:17720798-17720820 GAAGAAACTAAGGCCTGGTATGG - Intergenic
902662151 1:17912603-17912625 GGGGAAACTGAGGCCAGAGAGGG + Intergenic
902672335 1:17983469-17983491 GGGGAAACTGAGGCTTGGAAAGG + Intergenic
902778704 1:18690872-18690894 GGGGAAAGTGAGGCCCGAGGAGG + Intronic
902806431 1:18863940-18863962 AGGGAAACTGAGGCCTGGAAAGG + Intronic
902893536 1:19462516-19462538 GGGGAAACTGAGGCCCAAGGAGG + Intronic
903020074 1:20387404-20387426 GGGGAAACTAAGGCAGAAAATGG + Intergenic
903154638 1:21435616-21435638 GGGGAAACTGAGGCCCAAGAGGG + Intergenic
903280150 1:22245664-22245686 GGGGAGACTGAGGCCTGAAAAGG - Intergenic
903467011 1:23558824-23558846 AGGGAAACTGAGGCCAGAGAGGG - Intronic
903474175 1:23607961-23607983 AGGGAAACTGAGGCCTGAAGTGG - Intronic
903543340 1:24108782-24108804 AGGGAAACTGAGGTCTGAGAGGG + Intronic
903787162 1:25869019-25869041 CGGGAAGCTAAGGCAGGAGAAGG + Intronic
903788022 1:25874518-25874540 AGAGAAACTAAGGCTGGAGAGGG + Intergenic
903974999 1:27143690-27143712 AGGGAAACTAAGGCCCAGGAAGG + Intronic
904203662 1:28838431-28838453 GGGGAAACTGAGGCCTGGAAAGG - Intronic
904335007 1:29791311-29791333 GGGGAAACTAAGGCCCAGAAAGG - Intergenic
904360748 1:29970173-29970195 GAGGAAGCTGAGGACTGAGATGG - Intergenic
904430965 1:30463796-30463818 GGGGAAACTGAGGCCAGGGAAGG - Intergenic
904447913 1:30589388-30589410 GGGAAAACCAAGGCCTGGGAAGG - Intergenic
904468702 1:30722967-30722989 GGGGAAACTGAGGTCAGTGAGGG - Intronic
904489053 1:30847062-30847084 GGGGAAATTGAGGCTAGAGAGGG - Intergenic
904679155 1:32216742-32216764 GAGGAAGCTAAGGCCAGAGAGGG + Exonic
904710163 1:32424310-32424332 GGGGACATTAAGGACTGAGCTGG + Intergenic
904785709 1:32981165-32981187 GAGAAAATTAAGGCCAGAGAGGG + Intergenic
904843280 1:33388268-33388290 GAGGAAACAAAGGCCTGTGGAGG - Intronic
905191623 1:36239591-36239613 AGGGAAACAAAGGCCTTACAGGG - Intronic
905293044 1:36936165-36936187 GAGGAAACTGAAGCCTGAGATGG + Intronic
905340446 1:37274094-37274116 GGGGAAACTGAGGCCAAGGAGGG - Intergenic
905410040 1:37762259-37762281 GGGGAAACTGAGGCTCCAGAGGG + Intronic
905470060 1:38185113-38185135 GGGGAAACTGGGGCCTGATGAGG + Intergenic
905624457 1:39478452-39478474 GAGGAAACTGAGGCCAGAGCAGG + Intronic
905627421 1:39498134-39498156 GGGGAAACTGAGGCCAAGGAGGG - Intronic
905669007 1:39778977-39778999 GGGGAAACTGAGGCCAAGGAGGG + Intronic
905793587 1:40802854-40802876 GAAGAAACTGAGTCCTGAGAGGG + Intronic
905797042 1:40821591-40821613 GGGAATACTAAGGACTGAGAGGG - Intronic
905847189 1:41242441-41242463 GGGAAAACTGAGGCCTGAGAGGG + Intergenic
906060280 1:42943949-42943971 CAGGAAACTGAGCCCTGAGAGGG + Intronic
906061935 1:42954602-42954624 GGGGAAATTGAGTCCAGAGAAGG - Intronic
906702723 1:47871673-47871695 GGGAAAGCGAAGCCCTGAGAAGG + Intronic
907183019 1:52587373-52587395 GGGGAAAGTAAGGTCTAAGGGGG + Intergenic
907246128 1:53110216-53110238 GGGGAAACTGAGGCCTGGAGAGG + Intronic
907277154 1:53323121-53323143 AGGGAAATGAAGGCCTGGGAAGG + Intronic
907300438 1:53483450-53483472 GGGGAAACCAAGGCCTGGGGAGG + Intergenic
907405455 1:54251109-54251131 GGGGAAACTGAGGCCTGCTGGGG + Intronic
907482919 1:54757157-54757179 GGGGAAACTGAGGCCCCAGCAGG + Exonic
907661274 1:56394625-56394647 GGGGAAACTCTTGCCTGGGAGGG + Intergenic
908227558 1:62071438-62071460 GGGGAAATTAAGGCTTGAAGAGG + Intronic
908317715 1:62949605-62949627 GAGGAAACTAAAGCCTCAGAAGG - Intergenic
908668843 1:66523171-66523193 GGGGAAACTAAGGTTACAGATGG + Intergenic
910217571 1:84857818-84857840 GAGGAAACTGAGGCCCGAAAAGG - Intronic
911685729 1:100775102-100775124 GTGGTAACTAGAGCCTGAGAAGG + Intergenic
911833067 1:102579054-102579076 GGAGAAATTAAGGCATGAGAGGG + Intergenic
912691554 1:111808644-111808666 GAGGAGAGCAAGGCCTGAGAGGG - Intronic
912775374 1:112503303-112503325 GGGGAAACTGAGGCCTGAAGTGG + Intronic
912856767 1:113176144-113176166 AAGCAAACTATGGCCTGAGAAGG - Intergenic
913088769 1:115461910-115461932 AGGGAAACCAAGACCTTAGAGGG - Intergenic
914250541 1:145918421-145918443 GGGGAAACTGAGGCATGAGTGGG - Intronic
914904505 1:151732780-151732802 GGGGAAACTAAGTCTAGAAATGG + Intergenic
915126730 1:153670728-153670750 GGGGAAACTTGGGCCCGGGATGG - Intronic
915594764 1:156890157-156890179 TGGGAGACTGAGGCCTGAAAAGG - Intergenic
916743210 1:167663963-167663985 GGGGAAACTAAGGCTCAATAAGG + Intronic
917200246 1:172507070-172507092 GCAGAAAGTCAGGCCTGAGAAGG - Intergenic
917235431 1:172887008-172887030 AGGGAAACTGAGGCCTGAAAAGG - Intergenic
917509715 1:175660112-175660134 GTGGAAACTGAGTCCAGAGAGGG - Intronic
918094236 1:181321524-181321546 GGGGAAGCCAAGGAGTGAGAAGG - Intergenic
918106630 1:181421041-181421063 TGGGAAACTGAGGCTTGATAAGG + Intronic
918542983 1:185651513-185651535 AAGGAAACTAAGGCTTGACAAGG + Intergenic
919851478 1:201675944-201675966 GGGGAAACTGGGGCTTGGGATGG - Intronic
920107071 1:203561289-203561311 GGGGAGAGAAAGGACTGAGAGGG + Intergenic
920184227 1:204150641-204150663 AGGGAAACTGAGGCAGGAGAGGG + Intronic
920400238 1:205671534-205671556 GAGGAAACTGAGGCATGGGAAGG - Intronic
920433930 1:205936227-205936249 AGGGAAACTGAGGTCTGGGAAGG - Intronic
920525031 1:206660018-206660040 GGGGAAACTGAGGCCTAGAAAGG - Intronic
920706128 1:208251927-208251949 GGGGAAACCAAGGCCAGAGGAGG - Intergenic
920826503 1:209428139-209428161 GGGGAAATTAAGGAAAGAGAAGG - Intergenic
920961870 1:210670881-210670903 GGGGAAACTGAGGCCCTAGTAGG + Intronic
921728329 1:218549119-218549141 GAGGAAATTAAGGCATGAGTTGG + Intergenic
922088639 1:222374694-222374716 GGGCAAACTAAAGCCTGAAGAGG + Intergenic
922741022 1:228014261-228014283 GGGGAAACTGAGGCCCAGGAGGG + Intronic
922800739 1:228363732-228363754 GGGGAAACTGAGGCCTGGGTTGG + Intronic
923361607 1:233217499-233217521 AGGGAAACTGAGGCATGAAAAGG + Intronic
923469781 1:234280209-234280231 GGGGAAGCCATGGGCTGAGAAGG - Intronic
1063292613 10:4764955-4764977 GGAGAAACTGAGGCCTAAGATGG + Intergenic
1063455257 10:6178433-6178455 GGGGAAACGCAGGCAGGAGAGGG + Intronic
1063906977 10:10790955-10790977 GAGGAAACTAAGCACAGAGAGGG - Intergenic
1064285803 10:13990361-13990383 GGAGGAAGTAAGGACTGAGAAGG + Intronic
1064770634 10:18718846-18718868 GGGGAAATTAGGTTCTGAGAAGG + Intergenic
1065312914 10:24433600-24433622 AGGGAAACTAAGGCCCAAAAAGG + Intronic
1065759768 10:28971245-28971267 AGCAAAACTAAGGCCTGGGAAGG - Intergenic
1067695796 10:48534697-48534719 GGGGAAACTAAGGCTTGAAGTGG + Intronic
1067725981 10:48771401-48771423 GGGGAAGCTAAGCCCAGAGATGG - Intronic
1068388028 10:56358347-56358369 AGGGACACCAAGGCCTGAGTTGG + Intronic
1068528778 10:58161796-58161818 GAGGAAACTAAGGCCTAGGGAGG + Intergenic
1069583725 10:69582782-69582804 GAGGAAACTGAGGCTTCAGAGGG + Intergenic
1069624570 10:69859924-69859946 GGTAAAACAAAGCCCTGAGAAGG + Intronic
1069743148 10:70698465-70698487 AGGGAAACCAAGGTCTGAGGGGG + Intronic
1069788551 10:71005024-71005046 GGGGAAACTGAGGCCCCAGGAGG + Intergenic
1069918826 10:71803583-71803605 GGGAAAACTGAGGCCGGAGAAGG + Intronic
1070081970 10:73197818-73197840 GGGGAAACACAGGCCAGAAAAGG + Intronic
1070128700 10:73641750-73641772 GGAGAAACTGAAGACTGAGAGGG + Exonic
1070512385 10:77173388-77173410 GGGGAAACTGAGGCTTCAGAAGG - Intronic
1070741169 10:78904200-78904222 GGAGAAACTGAGGCCTAGGAGGG + Intergenic
1070751369 10:78965815-78965837 TGGGAAACTGAGGCCAGAGAGGG - Intergenic
1070836845 10:79452863-79452885 GTGAAAACTGAGGCCTGAAAGGG + Intergenic
1071205331 10:83269269-83269291 GTAGAAACAAAGGCATGAGAGGG + Intergenic
1071712512 10:88063446-88063468 GAGAGAACTAAGGCTTGAGAAGG + Intergenic
1072044563 10:91641937-91641959 GGGGAAACTGAGACCTGATAAGG + Intergenic
1072449916 10:95531715-95531737 GGGGAAACTGAGACCTGGGAAGG - Intronic
1073300492 10:102468289-102468311 GAGGAAGCTAAGGCCTGGGTTGG + Intronic
1073606711 10:104902816-104902838 GGGGAAACTGAGGCCTGGAAAGG + Intronic
1073820670 10:107260078-107260100 GTGGAAGCTAAGCCATGAGAAGG + Intergenic
1074136102 10:110627487-110627509 GAAGAAACTGAGGCCTGGGAAGG - Intergenic
1074159380 10:110824511-110824533 GAGGAAACTAAGGCTCAAGAAGG - Intronic
1074187846 10:111112672-111112694 GGGGAAACTAAGGCTGAAGAAGG + Intergenic
1074413621 10:113248356-113248378 GAGGACACCAAGACCTGAGAAGG + Intergenic
1075078209 10:119365667-119365689 GGGGAAACTGAGGCCGGGTAGGG - Intronic
1075199682 10:120392199-120392221 GGGCAAACTGAGGCCTGGGGAGG - Intergenic
1075437342 10:122454769-122454791 GGGGAAAGGAGGGCCTGAGATGG + Exonic
1075658068 10:124174799-124174821 GGGGAAACTGAGGCTGGAGGAGG - Intergenic
1075683365 10:124347917-124347939 GAGGAAACAGAGGCCTGAAAAGG + Intergenic
1075721925 10:124592539-124592561 GGGGAAACTGAGGACTGGAAGGG - Intronic
1075722124 10:124593379-124593401 GTGGAAACTGAGGCCCGGGAGGG - Intronic
1076122535 10:127947872-127947894 GGGGAAACTGAGGCCTGTTGTGG + Intronic
1076223453 10:128754205-128754227 GGGGAAGCTGAGGCAGGAGAAGG - Intergenic
1076743370 10:132499385-132499407 GGGGCAAGTAAGGCCTCTGAGGG - Intergenic
1076991930 11:279978-280000 GAGGAAACTGAGGCCTGAGCAGG + Intronic
1077303517 11:1857669-1857691 GGGGAAACTGAGGCTTCAGAGGG - Intronic
1077464335 11:2726464-2726486 GGGGAAACTGAGGCCCCAGGCGG + Intronic
1077465785 11:2733065-2733087 GGGGAAACTGAGGCTCCAGAAGG - Intronic
1077466178 11:2734800-2734822 GGGGAAACTGAGGCTGGAGGAGG - Intronic
1077942409 11:6856979-6857001 GGGGAGACTAAGGGCTGAATGGG - Intergenic
1079018642 11:16890670-16890692 GAGGAAACTGAGACCTGGGAAGG + Intronic
1079021098 11:16909639-16909661 GAGGAAACTGAGCCCAGAGAGGG - Intronic
1079088074 11:17461458-17461480 GGGGAAACTGAGGCTGGTGAGGG - Intronic
1079131844 11:17751391-17751413 GGGTAAACAAATGGCTGAGAAGG + Intronic
1080041011 11:27759478-27759500 GGGGAAAAAAAGGCCAGAGAAGG + Intergenic
1080270911 11:30449845-30449867 GGGGAAACTAATGGAAGAGAAGG - Intronic
1080418996 11:32093691-32093713 GGGGAAACCAAGGGCAGAGCAGG + Intronic
1080872926 11:36252571-36252593 GGGGAAACTGAGGCTTGAGGGGG - Intergenic
1080889377 11:36396235-36396257 TAGGAAACTGAGGCCTGAGCAGG - Intronic
1081394439 11:42569046-42569068 GAGGAAACTAAGCCTTGAAAAGG + Intergenic
1081675096 11:44964001-44964023 GGGAAAACTGAGGCCTGGGAAGG + Intergenic
1081744392 11:45462818-45462840 GGGGAAACTGAGGCCTAGGGAGG + Intergenic
1081866519 11:46363381-46363403 AGGGAAACTGAGGCCCGTGAGGG + Intronic
1081874310 11:46398152-46398174 GGGGAAACTGAGGCCTAGGATGG + Intronic
1082085075 11:48043642-48043664 GGGGAGACTCAGGGCAGAGAAGG - Intronic
1083198693 11:61106391-61106413 GGGGAAGGACAGGCCTGAGAGGG + Intronic
1083351648 11:62033685-62033707 GGGCAACACAAGGCCTGAGAAGG - Intergenic
1083780881 11:64916726-64916748 GGAGAAACTGAGGCTGGAGAGGG - Intronic
1083822347 11:65180656-65180678 AGGAAAACTGAGGCCTGAGAGGG - Exonic
1084118019 11:67053150-67053172 GGGGAAACTGAGGCCTGAGAAGG - Intergenic
1084273592 11:68041121-68041143 GTGGAAACTGAGGCCTGGGCAGG - Intronic
1084466835 11:69328200-69328222 GAGGAAACTGAGGCATGGGAAGG + Intronic
1084475328 11:69385573-69385595 GGGGAAACTGAGGCCCAAGCCGG + Intergenic
1084684786 11:70687200-70687222 GGGGAAACTAAGGCCCGTGCAGG + Intronic
1084697730 11:70765769-70765791 GGGGAAACTGAAGCCTGAGCTGG - Intronic
1084941780 11:72616965-72616987 GGGTAGACTAAGGCCAGAGGAGG + Intronic
1085041841 11:73331338-73331360 GGGGAAACTGAGGCCATGGAGGG + Intronic
1085050514 11:73377699-73377721 GGGGAGACTGAGGCCTGCGCGGG - Intronic
1085130847 11:74037176-74037198 GGGGAAACTGAAGTCTAAGAAGG + Intronic
1085301260 11:75460083-75460105 TGGGAAACTGAGGCCTGAAGAGG + Intronic
1085395077 11:76203097-76203119 GGGGAAACTGAGGCCCGGAAAGG + Intronic
1085475267 11:76784940-76784962 AGGGAAACTGAGGCCGGAGAGGG - Intronic
1085620826 11:78036983-78037005 GAGGAAACCAAGGCCAAAGAAGG + Intronic
1085624364 11:78060691-78060713 GAGGAAACTGAGACCTGAGACGG - Intronic
1085742459 11:79088925-79088947 GAGGAAAGTGAGGCCTGGGATGG - Intronic
1085781864 11:79416683-79416705 GGGGAAACTGAGGCTTAACAAGG + Intronic
1085823467 11:79817852-79817874 GGGGAAACTGAGGCCTCAGTTGG + Intergenic
1086044321 11:82514839-82514861 GAGGAAACTGAGGCATAAGAAGG - Intergenic
1086099981 11:83089151-83089173 GAGGAGATTAGGGCCTGAGATGG + Intergenic
1086126614 11:83355364-83355386 GGGAAAACTAAGGCCAAAAAAGG - Intergenic
1087064081 11:94011136-94011158 GAGGAAACTAAGGTTTGGGAAGG - Intergenic
1087527891 11:99340436-99340458 GGGGAAAAAAAAGCCTGAGAAGG + Intronic
1087692786 11:101340974-101340996 GAGGAAACTGAAGCCTAAGATGG - Intergenic
1088464321 11:110117596-110117618 GAGGAAACTAAGGCATGGGGAGG + Intronic
1088748093 11:112821383-112821405 GGGAAAACTAAAGCAAGAGAAGG - Intergenic
1088910006 11:114183591-114183613 GGGGAAGCAAAGGCCCGAGGAGG - Intronic
1089046271 11:115504117-115504139 GAGGAAACTCAGGGCTGAGAGGG - Intronic
1089166572 11:116482123-116482145 GAAGAAACTGAGGCCTGAAAAGG + Intergenic
1089609321 11:119660701-119660723 TAAGAAAGTAAGGCCTGAGAGGG - Intronic
1090870100 11:130736958-130736980 GAGGAAACTAAGGCATGAACAGG - Intergenic
1091066503 11:132518443-132518465 GGTGAGACAATGGCCTGAGATGG - Intronic
1091382989 12:74816-74838 GAGAAAACTAAGGCCTGAGGAGG + Intronic
1091683983 12:2548476-2548498 GAGGAAAGTGAGGCCAGAGAAGG - Intronic
1091704140 12:2682235-2682257 AGGGAAACTGAGGCATGAGGTGG + Intronic
1092937183 12:13375017-13375039 GGGGAGATTGAGGCCTGAGAAGG + Intronic
1092960395 12:13591491-13591513 TAGGAAACTGAGGCATGAGAAGG + Intronic
1093100197 12:15018799-15018821 GGGGAAATTAAGGGGTGGGAGGG + Intergenic
1094201288 12:27797086-27797108 GGGGAAACTAAGGCTAGGCATGG + Intronic
1094624977 12:32114838-32114860 GGGGACAGTAAGGTCTAAGAAGG + Intronic
1094827773 12:34286189-34286211 GGGGAAGATAAGGCTTGAAAGGG + Intergenic
1094830183 12:34296571-34296593 AGGGAAGCTAAGGCTTGAAAGGG + Intergenic
1094831956 12:34304391-34304413 AGGGAACATAAGGCCTGAAAGGG + Intergenic
1095206886 12:39448376-39448398 AAGTAAACTATGGCCTGAGAAGG + Intergenic
1095220767 12:39611309-39611331 GGGGAAACTATGGGGGGAGAGGG + Intronic
1095375379 12:41521623-41521645 GAGGAAACTGAAGCCTGTGAAGG + Intronic
1095716278 12:45350253-45350275 GGGGAAACCAAGGCCTTGGCTGG - Intronic
1095796992 12:46230596-46230618 GGGGAAAATAGGACTTGAGATGG + Intronic
1095898332 12:47302939-47302961 GGGGAAACTAATGCAAGATATGG - Intergenic
1096074821 12:48796608-48796630 GGGGAAACTAAGGCCCAGAAAGG - Intergenic
1096600193 12:52723597-52723619 GAGGAAACTGAGGCCTGGCAAGG - Intergenic
1097151298 12:56981737-56981759 GAGGAAACTAAAGCCAGAGAGGG - Intergenic
1097332787 12:58350507-58350529 GTGGTAACTAAAGGCTGAGAAGG - Intergenic
1098947925 12:76608906-76608928 GGGGAAGCTGAGGCCTGCGAAGG + Intergenic
1100687308 12:97001224-97001246 AGGGAAACAAAGACATGAGACGG - Intergenic
1101399374 12:104374750-104374772 TGGGAAATAAAGGCCTGAAAAGG - Intergenic
1101727904 12:107403213-107403235 GAGGAAACCAAGGCCTGGTAAGG + Intronic
1101752272 12:107591658-107591680 GGGGAAACTGAGGCATGTCATGG + Intronic
1101877200 12:108603646-108603668 GGGGAAACTGAGGCCCAAGGAGG - Intergenic
1101952201 12:109185859-109185881 GGGGAAACTGAGGCATGGGAAGG + Intronic
1102036351 12:109772453-109772475 GGGGAAACTGAGGCCCAAGGAGG - Intergenic
1102042625 12:109810414-109810436 GGGGAAACTGAGGCCAGGGCAGG + Intronic
1102148438 12:110671880-110671902 GGGCAAACTGAGGCCTGGGGAGG + Intronic
1102405000 12:112665474-112665496 GAGGAAACTGAGGCATAAGAAGG - Intronic
1102456706 12:113075395-113075417 GGGGCCACTAAGGCCTGAGGAGG + Intronic
1102534271 12:113569246-113569268 GTGAAAACTGAGGCCGGAGAGGG - Intergenic
1102548786 12:113675632-113675654 GGGGAAAATGAGGCCCGAGGAGG - Intergenic
1102617770 12:114169528-114169550 GGGGAAACTGAGGCCTGTCTAGG - Intergenic
1102910607 12:116710903-116710925 GAGGAAACCAAAGCCGGAGAGGG + Exonic
1103167242 12:118780619-118780641 GGGGAAACTAAGTCAGCAGAGGG - Intergenic
1103371460 12:120422708-120422730 GGGGAAACTGAGTCCAGAGAGGG - Intergenic
1103513810 12:121493658-121493680 GAGGAAACTGAGGCTTGAAAAGG - Intronic
1103561229 12:121794150-121794172 GGGGAAGCTGAGGCCAGAGGCGG - Exonic
1103573436 12:121859613-121859635 GGGGAAACTGAGGCCTGGAGAGG + Intronic
1103794698 12:123495238-123495260 GAGGAAAGCAGGGCCTGAGAAGG + Intronic
1103943065 12:124511403-124511425 GGAGAAACTAGGCCCAGAGAGGG - Intronic
1103981020 12:124736950-124736972 GGGAAAACTGAGGCCTGGGGTGG - Intergenic
1104003520 12:124875637-124875659 GGGGATACTGTGGGCTGAGAAGG - Intronic
1104242371 12:127002447-127002469 TGGGAAGCTAAGGCATGAGATGG - Intergenic
1104754048 12:131258028-131258050 GGGGAAACTGAGGCCTGGAAAGG - Intergenic
1105211077 13:18257480-18257502 GGGGAAACTGAGGCTGGACATGG + Intergenic
1105674393 13:22654763-22654785 GAGGAAACTGAGGCCAGAAAAGG + Intergenic
1106036602 13:26050458-26050480 GGAGAAACTGAGGCCCGTGAGGG + Intronic
1106134407 13:26963188-26963210 GGGGAAACTGAGGCCTAGGAAGG - Intergenic
1107431361 13:40343402-40343424 GGGGAAAGAAGGGGCTGAGAAGG - Intergenic
1108742432 13:53352036-53352058 GGGGAAGCAAAAGCCTGAAAAGG + Intergenic
1111907425 13:94271557-94271579 GGGGAAACTAAGACCCTAGAAGG - Intronic
1113034068 13:106029255-106029277 GGAGAAACTTAGGCTGGAGAAGG - Intergenic
1113250380 13:108446032-108446054 GGGGAACTTGGGGCCTGAGAAGG + Intergenic
1113944991 13:114039055-114039077 GGGAAAACTGAGGCCTGCAAAGG + Intronic
1113955040 13:114095755-114095777 GGGGAAACTGAGGCCTGGAGAGG - Intronic
1114668669 14:24397651-24397673 GGTGGAAAGAAGGCCTGAGATGG + Intergenic
1114837387 14:26219215-26219237 GGGATAACCAAGGCTTGAGATGG + Intergenic
1115428603 14:33289941-33289963 GGGGAAACTGAAGCCTGAGATGG - Intronic
1117201865 14:53398607-53398629 GGGGACACCAATCCCTGAGATGG + Intergenic
1118696437 14:68390730-68390752 GGGGAAACTGAGGCTTAAGGAGG + Intronic
1118741500 14:68742563-68742585 GAGGAAACTGAGACCAGAGAAGG - Intergenic
1118909812 14:70051843-70051865 GGGGAAACTGAGACCTGGGGTGG + Intronic
1119418811 14:74493904-74493926 TGGGAAACTAAGGCCTGTGGGGG + Intronic
1119443368 14:74644552-74644574 GGGGAAACTGAGGCATGAGGTGG - Intergenic
1119480208 14:74954136-74954158 AGGAAAACTGAGGCCAGAGAGGG - Intronic
1119602702 14:75987541-75987563 GAGGAAACTGAGGCCTAGGAAGG - Intronic
1119928341 14:78518850-78518872 GGTGAAGATAAGGCCTGTGATGG + Intronic
1119986922 14:79148666-79148688 GGGGAAATTAAGGCCTGCCTAGG + Intronic
1120781953 14:88493480-88493502 GGGGCAGCTAAGTCCAGAGAAGG + Intronic
1120999429 14:90440790-90440812 GGGCAAACTGAGGCCTAAGAAGG - Intergenic
1121260632 14:92563528-92563550 GAGGAAACTCAGCTCTGAGACGG + Intronic
1121454063 14:94027216-94027238 GGGGAAACTGAGGCCAGACAGGG + Intronic
1121518597 14:94570345-94570367 GGGGAAACTGAGGCCCAAGAGGG - Intronic
1122031418 14:98915314-98915336 GGGGAAACTGAGGCTTGAGAGGG - Intergenic
1122135207 14:99628799-99628821 AGGGAAACTGAGGCCCGAGAGGG - Intergenic
1122208765 14:100161310-100161332 GAGGAAACTGAGGCCAGAGAGGG + Intergenic
1122235216 14:100327446-100327468 GGGGAAACTGAGGCTTGATGAGG + Intronic
1122272847 14:100576066-100576088 GGGGAAACTGAGGCATGATGAGG + Intronic
1122297169 14:100712162-100712184 GGGGAAACCGAGGCCTGGGCGGG + Intergenic
1122314381 14:100817231-100817253 GGGGAAACCGAGGCCTGGCAGGG + Intergenic
1122517703 14:102320075-102320097 GGGGAAACTGAGGCCCGAAGGGG + Intronic
1122861683 14:104585302-104585324 CGGGAAACTGAGGCCAGAGGGGG - Intronic
1122865355 14:104601474-104601496 GGGGGACCCATGGCCTGAGATGG + Intronic
1122904625 14:104795970-104795992 GGGGAAACTGAGGCCAGAGAGGG - Intergenic
1123025453 14:105421655-105421677 GGGGAAACCGAGGCATGGGAAGG - Intronic
1123058653 14:105584448-105584470 GGGGAGTCTCAGGCCTTAGATGG - Intergenic
1123082982 14:105704674-105704696 GGGGAGTCTCAGGCCTTAGATGG - Intergenic
1123467627 15:20528433-20528455 GAGGAAACTGAGACCAGAGAGGG - Intergenic
1123650487 15:22472609-22472631 GAGGAAACTGAGACCAGAGAGGG + Intergenic
1123740895 15:23281451-23281473 GAGGAAACTGAGACCAGAGAGGG + Intergenic
1123746103 15:23321107-23321129 GAGGAAACTGAGACCAGAGAGGG - Intergenic
1124278371 15:28344424-28344446 GAGGAAACTGAGACCAGAGAGGG - Intergenic
1124304330 15:28567184-28567206 GAGGAAACTGAGACCAGAGAGGG + Intergenic
1125475668 15:40046617-40046639 GGGGAAACTGAGGCCAGGAAAGG + Intergenic
1125479186 15:40069111-40069133 GGGGAGGCTTAGGCCTGAGGAGG - Intergenic
1125855201 15:42941767-42941789 GGAGAAACGTAGGCCCGAGAGGG - Intergenic
1125954074 15:43777228-43777250 GGGGAAACTAAGGCAGGACTGGG - Exonic
1126311921 15:47327103-47327125 GGGGATGCCAAGGCCTGAGCAGG - Intronic
1126796865 15:52266629-52266651 GAGGAAACTAAGGCATAGGAAGG + Intronic
1127396848 15:58550061-58550083 GGGGAAACCAAGGCCTAGGCAGG + Intronic
1128159724 15:65415627-65415649 GGGGAAACTGAGGCCTGGGGAGG + Intronic
1128161213 15:65423621-65423643 GGGGAAACTGAGGCTGGAGAAGG + Intergenic
1128209122 15:65880775-65880797 GGAGAAATTAAGGCCTAAAAGGG - Intronic
1128559920 15:68658099-68658121 GGGGAAACTGAGGCCTAGAAAGG - Intronic
1128763965 15:70239693-70239715 GGGGAAACTGAGTCCAGAGAGGG - Intergenic
1129262204 15:74374731-74374753 GGGGAAACTGAGTTCTGGGAGGG - Intergenic
1129329726 15:74820853-74820875 AGGGAAACTGAGGCCTGAGGAGG + Intronic
1129604046 15:77016184-77016206 CAGGAAACTGAGGCCAGAGAAGG - Intronic
1129718127 15:77863586-77863608 GGGCAAACTAGTGACTGAGATGG - Intergenic
1129823315 15:78619076-78619098 TGGGAAACTGAGGCCCAAGAGGG + Intronic
1129826547 15:78638386-78638408 GGGGAAACTGAGACCAAAGAGGG + Intronic
1130559447 15:84946853-84946875 GGGGAAAATGAGAACTGAGATGG - Intergenic
1130648516 15:85748882-85748904 GGGGAAGCTCAGGCCGGGGAAGG - Intronic
1130827295 15:87562500-87562522 GGGGAAACTCAGACATTAGAAGG - Intergenic
1130907134 15:88248671-88248693 GGGGAAACTGAGTGCAGAGAAGG - Intronic
1131020076 15:89089989-89090011 GAGGAAACTGAGGCCTGGGGTGG + Intronic
1131028269 15:89163832-89163854 GAGGAAACTGAGGCCCGACAAGG + Intronic
1132243671 15:100278820-100278842 GGGGAAAGAAAGGCTTGACATGG + Intronic
1133210748 16:4262171-4262193 GGGGAAACTGAGGCCGGGGCAGG + Intronic
1133222667 16:4325490-4325512 GGGGAAACTGAGGGCTGAAGGGG - Intronic
1133226656 16:4344153-4344175 GGGAAAACTCAAGACTGAGATGG + Intronic
1133624349 16:7556700-7556722 GAGGAAATTAAAGCCTAAGAAGG - Intronic
1133760765 16:8796802-8796824 AGGGAAACTAAGCCCAGAGAGGG + Intronic
1134009232 16:10838948-10838970 GGGAAAACTGAGGCCTGTGGGGG + Intergenic
1134014370 16:10878349-10878371 GAGGAAATTCAGGCCTGAAAAGG + Intronic
1134287160 16:12871922-12871944 AGGGAAACTCAGTCCTGACATGG + Intergenic
1134560397 16:15204129-15204151 GAGAAAACAAAAGCCTGAGATGG + Intergenic
1134920936 16:18115743-18115765 GAGAAAACAAAAGCCTGAGATGG + Intergenic
1135037367 16:19089506-19089528 GGGAAAAGTAAGGCTAGAGATGG - Intergenic
1135738292 16:24951293-24951315 GAGGAAACTGAGGCTTGGGAGGG - Intronic
1136783919 16:32923698-32923720 GGGAAAAATATGGCCAGAGAAGG + Intergenic
1136885864 16:33930108-33930130 GGGAAAAATATGGCCAGAGAAGG - Intergenic
1137573154 16:49579630-49579652 GGGGAAACTGAGGCTTGCGTAGG + Intronic
1137775538 16:51051152-51051174 GAGGAAACTGAGGCATGGGAAGG + Intergenic
1138328263 16:56192490-56192512 GGGGGGACTAAGGCATGCGAGGG - Intronic
1138511980 16:57514005-57514027 GAGGAAACTAAGGCCCAAGAGGG - Intronic
1138532715 16:57643530-57643552 GGGGACAGTGAGGCCTGAGCTGG + Intronic
1138574379 16:57898076-57898098 GGGGTGACTGAGGCCTGAGAGGG - Intronic
1138589723 16:57993249-57993271 TGGGGAACTGAGGCCTGAGAGGG + Intergenic
1139056165 16:63187614-63187636 GAGGAAACTAAGCCCAAAGAGGG - Intergenic
1139070797 16:63380024-63380046 GGGAAAACTGAGGCCTGGGGAGG - Intergenic
1139405935 16:66717718-66717740 TGGGAAAAGGAGGCCTGAGAGGG + Intergenic
1140609267 16:76578609-76578631 AGGGAAACTAAGGCCAAAGAGGG + Intronic
1140834673 16:78782124-78782146 GGGGAAATTAAAGCCAGTGAAGG - Intronic
1140976397 16:80063803-80063825 GGGGAAAGAAAGGCCTGTCAGGG - Intergenic
1141184182 16:81775334-81775356 GGGGAAATTAAGTCCAAAGAGGG + Intronic
1141657910 16:85425886-85425908 GGGGAAACTAAGGCATGGAGCGG + Intergenic
1141826157 16:86481798-86481820 GAGGAAACTAAGGCCTCCAAAGG - Intergenic
1141909104 16:87046452-87046474 GGGGAAACTGAGGCCTGGGGAGG - Intergenic
1142150539 16:88510689-88510711 GGGGAAACTGAGGTCAGAGCAGG + Intronic
1142154235 16:88525983-88526005 GAGGAAACTGAGGCCTGGGAAGG - Intronic
1142243641 16:88958588-88958610 GGGGAGACTGAGGCCTGGGTGGG + Intronic
1142292622 16:89199942-89199964 GGGGAAACTGAGGCATGAGAGGG + Intronic
1142593307 17:1017220-1017242 CGGGAAAGTAAGGCCAGAGCTGG - Intronic
1142757206 17:2023646-2023668 GGGGAAGCGAAGCCCTAAGATGG - Intronic
1143033706 17:3982481-3982503 AGGGTCACTAAGGCCAGAGAGGG - Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1143619127 17:8071268-8071290 GGGGAAACTGAGGCCAAGGAAGG - Intergenic
1143874026 17:9978295-9978317 GGGGAAAATGAGGCCTGGCAAGG + Intronic
1143926547 17:10376443-10376465 GGGGAAACTGAGGCCTAAAAGGG + Intergenic
1143934506 17:10468746-10468768 GAGGAAACTAAGGCCTAGAAAGG + Intronic
1144387458 17:14762514-14762536 GAGGATACTAAAGACTGAGAAGG + Intergenic
1144585247 17:16483642-16483664 GGGGAAACTGAGGCCAAAGAAGG + Intronic
1144643513 17:16952774-16952796 GGGGAAACTGAGGCTGGAGAGGG - Intronic
1144782250 17:17814043-17814065 GGGGAAACTGAGGCCAGATAGGG + Intronic
1144830568 17:18128762-18128784 GGGAACACTGAGGCCTAAGAAGG + Intronic
1144833456 17:18144348-18144370 GGGGAAACTGAGGCTGGTGAGGG - Intronic
1144843780 17:18205227-18205249 GGGGAAACTGAGGCCCGAGGAGG + Intronic
1144848270 17:18231221-18231243 TGGGAAACTGAGGCTGGAGAGGG + Intronic
1144958239 17:19030419-19030441 GGGCAAACTGAGGCCAGAGAGGG - Intronic
1144976919 17:19144105-19144127 GGGCAAACTGAGGCCAGAGAGGG + Intronic
1145205238 17:20981302-20981324 AGGGAAACTGAGGCTGGAGAGGG + Intergenic
1145749155 17:27342815-27342837 GGGGAAACCAAGGCTTAATAAGG + Intergenic
1145870676 17:28270768-28270790 GGGGACACTAAGGGCTGACCTGG + Intergenic
1146223812 17:31049139-31049161 GGGGACATTAAGGGCTGAGCTGG + Intergenic
1146464193 17:33073459-33073481 GGGGAAACTAAGGCTTGGTAAGG - Intronic
1146476320 17:33165371-33165393 GAGAAAACCAAGGCCTGAGCTGG + Intronic
1146554920 17:33815144-33815166 ATGGGAACTGAGGCCTGAGATGG - Intronic
1146936099 17:36813530-36813552 TGGGAAGCTACAGCCTGAGAAGG + Intergenic
1147144195 17:38475854-38475876 GGGAAAAATATGGCCAGAGAAGG + Intronic
1147260867 17:39209316-39209338 GGGGAAACTGAGGCCTGGAGTGG - Intergenic
1147328376 17:39681334-39681356 GAGGAAACCAAGGACTGAAAAGG - Intronic
1147482822 17:40783115-40783137 GTGGAAACTGAGGCCCGAGGAGG - Intergenic
1147596668 17:41722439-41722461 GGAGAAACTCAGGCCAGAGTAGG - Intronic
1147685911 17:42286861-42286883 GGAAAAACAAAGGCCAGAGAGGG - Intergenic
1147950489 17:44104988-44105010 GAGGAAAGTGAGGCCAGAGAAGG + Intronic
1148408220 17:47439465-47439487 GAGGAAACTCAGGCCAGACATGG - Intronic
1148686713 17:49505206-49505228 GGGGAAACTGAGGCCTGTAGGGG - Intronic
1148862227 17:50610438-50610460 TGGGAATCAAAGGCCTGAGTTGG + Intronic
1149297035 17:55270535-55270557 GAGGAAAATAAGTCCTCAGAAGG + Intronic
1149442617 17:56687612-56687634 GGGCAAACTAAGACCCCAGATGG + Intergenic
1149514531 17:57270287-57270309 GGGTAAACTGGGGCCTGAGAGGG + Intronic
1150651896 17:67015958-67015980 GGGGACACAAAGGCCAGAGTGGG - Intronic
1151009291 17:70474708-70474730 AAGTAAACTATGGCCTGAGAAGG + Intergenic
1151423893 17:74017153-74017175 GGGGCCACTAAGGCCTGAGATGG - Intergenic
1152130401 17:78472730-78472752 GGGGAAACCAGGGCCAGCGAGGG - Intronic
1152310816 17:79548606-79548628 GGAGAAACTGAGGCCTGAGCTGG - Intergenic
1152314428 17:79572092-79572114 GGGGAAACTAAGGCATCAAGAGG + Intergenic
1154298461 18:13172070-13172092 GAGGAAACAAAGGCATTAGAAGG + Intergenic
1155508556 18:26553804-26553826 AAGAAAACTAAGGCCAGAGAGGG + Intronic
1155528420 18:26741281-26741303 GGTGAAAGTAAAGCCTGAGTAGG - Intergenic
1157165292 18:45353205-45353227 AAGCAAACTATGGCCTGAGAAGG - Intronic
1157322999 18:46648368-46648390 GGGGAAACCAAAGCCTGGAAAGG - Intronic
1157409311 18:47450456-47450478 GGGGAAACTGAGGCCTCAGAAGG - Intergenic
1157484760 18:48079148-48079170 TGGTAAACTGAGGCCTCAGATGG + Intronic
1157516978 18:48318094-48318116 GGGGAAACTGAGGGCTGAGGTGG + Intronic
1157621744 18:49020966-49020988 GGGGAAACTGAGGCCTCAGGAGG - Intergenic
1159015518 18:63099089-63099111 GAGGAAACTGAGTCCAGAGAGGG + Intergenic
1160022065 18:75188828-75188850 GGGGAAACTGAGGCCCGAGGAGG - Intergenic
1160699719 19:500056-500078 GGGGAGACTGAGGCCCGTGAGGG - Intronic
1160730282 19:638962-638984 GGGGAAACCGAGGCCTGAGAGGG - Intergenic
1160747732 19:719805-719827 GGGGAAACTGAGGCCGGGCAGGG - Intronic
1160771693 19:834989-835011 GGGGAAACTAAGCCTAGAGAGGG + Intergenic
1160793755 19:934508-934530 GGGGAAACTGAGGCCAGTGCAGG + Intronic
1160820343 19:1054908-1054930 GGGAAAACTGAGGCCAGAGAGGG - Intronic
1160829325 19:1095650-1095672 GGGGAAACTGAGGCCTGGATGGG + Intergenic
1160847928 19:1174468-1174490 GAGGAAACTGAGGCTTGAGGAGG - Intergenic
1160865401 19:1253865-1253887 GGGGAAACTGAGGCCAGAGGGGG - Intronic
1160875528 19:1294747-1294769 GGGGAAACTGAGGCCAGGGTGGG + Intronic
1160879031 19:1311209-1311231 GGGGAAACTGAGGCCGGGGAAGG + Intergenic
1160880072 19:1315742-1315764 GGGGAAACTGAGGCACGGGAGGG - Intergenic
1160917435 19:1503936-1503958 CGGGAAACTGAGGCTGGAGAGGG + Intergenic
1160918172 19:1507466-1507488 GGGGAGACTGAGGCCTGAGGAGG - Intronic
1160919725 19:1513784-1513806 GGGGAAACTGAGGCCGGAGAGGG - Intergenic
1160965362 19:1744916-1744938 GGGGAAACTGAGGCTCCAGAAGG + Intergenic
1161162463 19:2768837-2768859 GTGGAAGCTAAGCCCAGAGAGGG - Intronic
1161201037 19:3014882-3014904 GGGTAAACTGAGGCCTGAGAGGG - Intronic
1161258191 19:3321325-3321347 GGGGAAACTGAGGCTTGGCAAGG + Intergenic
1161339968 19:3736059-3736081 GGGGAAACTGAGGCCTGGAGGGG + Intronic
1161442907 19:4302530-4302552 GGGGAAACTGAGGCACGAGGTGG - Intergenic
1161604703 19:5208177-5208199 GGGGAAACTGAGGCCTGGTGGGG - Intronic
1161681106 19:5680296-5680318 AGGGAAACTGAGGCTTCAGAGGG - Intronic
1161681356 19:5681250-5681272 GGGGAAACTGAGGCCTGAGCGGG + Exonic
1161798955 19:6404674-6404696 GGGGAAACCAAGGCCCAAGGAGG + Intergenic
1162016860 19:7850884-7850906 GGGGAAACTGAGGCCGGAGAAGG - Intronic
1162154181 19:8665390-8665412 GGGGGTACTAAGGCCAGAAAAGG + Intergenic
1162446791 19:10728300-10728322 AGAGAAACTGAGGCCAGAGAGGG + Intronic
1162535907 19:11262618-11262640 GGGGAAACTGAGGCTGGGGACGG + Intergenic
1162940287 19:14005558-14005580 TGGAAAACTGAGGCCTCAGATGG + Intronic
1163091550 19:15023428-15023450 GGAGAGACCAAGGCCAGAGAGGG - Intergenic
1163257383 19:16165001-16165023 GGGGAAACTAAGGTCGGGCACGG + Intronic
1163287383 19:16357229-16357251 GGGGACACTGAGGCCAGGGAAGG + Intronic
1163500375 19:17672658-17672680 GGGGAAACTGAGGCCAGTGGGGG + Intronic
1163534852 19:17871346-17871368 GGGGAAACTAAGGCCCAGGGAGG + Intergenic
1163557320 19:18000127-18000149 GGGGAAACTAAGGCCTGAGAAGG + Intergenic
1163568353 19:18065262-18065284 GAGGAAACTAAGGCCTGGAGGGG - Intronic
1163572480 19:18090625-18090647 GGGAAAGATGAGGCCTGAGAGGG - Intronic
1163612694 19:18309425-18309447 GGGGAAACTGAGGCTTGGGGAGG + Intronic
1164632264 19:29769392-29769414 GAGGAAACTGAGGCTGGAGAGGG - Intergenic
1165324716 19:35107784-35107806 GGGGAAACTGAGGCCCGGGAAGG + Intergenic
1165326889 19:35119159-35119181 GGTGAAACTCGGGCCTGAGGCGG - Exonic
1165486852 19:36101574-36101596 GGGGAAACTGAGCCCAGGGAAGG + Intronic
1165750500 19:38256470-38256492 GGGGAAACTGAGGCCTGAGGCGG - Exonic
1165931304 19:39361037-39361059 GGGGATCCTGAGGCCCGAGAGGG - Intronic
1166293120 19:41876042-41876064 GGGGAAACCGAGGCCAGAGAGGG - Intergenic
1166400632 19:42476964-42476986 GGCATATCTAAGGCCTGAGAAGG + Intergenic
1166540205 19:43600056-43600078 GGGGGAACTCAGGCCAGAGTTGG + Exonic
1166685222 19:44792607-44792629 GGGAAACCGAAGGCCAGAGAGGG + Intronic
1166734952 19:45078761-45078783 GGGGAAACTGAGGCCTTGAATGG - Intergenic
1166752421 19:45170664-45170686 GGGGAAACTGAGGCACGGGATGG - Intronic
1166802516 19:45467378-45467400 GGGGAAACTGAGTCCCGAGCGGG - Intronic
1167113023 19:47472979-47473001 AGGGAAACCAAGGCATGAGGTGG + Intergenic
1167739319 19:51314587-51314609 GGGGAACCTAAGACCAGAGATGG - Intronic
925802736 2:7617591-7617613 GTGGCAACTGAGGCCTGAGGAGG - Intergenic
925803354 2:7624606-7624628 GGGGAGAATAAGGACTGGGAAGG - Intergenic
925858887 2:8156235-8156257 GGGGAAACTGAGGCACGGGAAGG - Intergenic
926269879 2:11357381-11357403 GGGGAAACTGAGGCCCAAGAAGG - Intergenic
926387285 2:12349128-12349150 GTGGTAACTAAAGGCTGAGAAGG + Intergenic
926416014 2:12650489-12650511 GGGGAAACTGAGGCTGGAGGAGG + Intergenic
926857278 2:17270846-17270868 GTGGAAACTAAGGCTTGGGAAGG + Intergenic
927872737 2:26633884-26633906 AGGGAAACTGAGGCCCGAGAGGG - Intronic
927890212 2:26743429-26743451 AGGGAAACTGAGGCCTGATAAGG + Intergenic
928205810 2:29282593-29282615 GGGGAAACCAAGGCAGGAGGTGG - Intronic
928332562 2:30368808-30368830 GAAGAAACCAGGGCCTGAGAAGG - Intergenic
928627567 2:33156153-33156175 GAGGAAACTAAGGCCCGAAGAGG + Intronic
929919333 2:46161299-46161321 GGAGAAACTAAAGGCTCAGATGG + Intronic
930257429 2:49108462-49108484 GGGAAAAATAAGGAGTGAGAGGG - Intronic
930667230 2:54111345-54111367 GGGGAAACTAAGGCAAGGGCGGG + Intronic
931449049 2:62352260-62352282 GGGGAAACTAATGGCAGATAAGG + Intergenic
932340864 2:70961834-70961856 AGGGAAACTGAGGCCTGGGAAGG + Intronic
933352252 2:81168918-81168940 GGCTAGACTAAGGCATGAGATGG - Intergenic
934054508 2:88240660-88240682 GGAGAAACGGAGTCCTGAGAAGG + Intergenic
934768109 2:96891929-96891951 GGGGAAACTGAGGCCAGAGTAGG - Intronic
935230258 2:101089951-101089973 GGGGAAAGCAAGGGTTGAGAGGG + Intronic
936344538 2:111665240-111665262 GGGGAACCTGAGGCAGGAGAGGG - Intergenic
937102287 2:119281024-119281046 GGGGAAACTGAGGCAAGAGGAGG - Intergenic
937305270 2:120867080-120867102 GGGGAAATTGAGGCCCGGGAAGG - Intronic
938118815 2:128619873-128619895 GGGGGAACTGAGGCCTGGGGCGG + Intergenic
938306209 2:130256838-130256860 GTGGAAACTGAGGCCTGATTAGG - Intergenic
939015134 2:136893930-136893952 AAGGAAACAAAAGCCTGAGATGG - Intronic
939616599 2:144368320-144368342 GAGGATACTAAGGCCCAAGAAGG + Intergenic
940161188 2:150715242-150715264 GGAGAAATTAAGTCCTGATATGG - Intergenic
944539975 2:200745570-200745592 AGGGAAACCAAGGCCTGGGGAGG - Intergenic
945038422 2:205724206-205724228 GAGGAAACTGAGGTATGAGATGG - Intronic
946145145 2:217725027-217725049 GGGGAAAGTCTGGCCTGAGGGGG + Intronic
946867089 2:224051523-224051545 AAGGAAACTAAGGCCTGGGGAGG - Intergenic
948134657 2:235627705-235627727 TGGGAGACTAAGGGCTGAGCCGG - Intronic
1168758940 20:335405-335427 GGGGAAACTGAGGCCTCGAAAGG - Intergenic
1169263937 20:4156424-4156446 GAAGAAACTGAGGCCTCAGAGGG - Intronic
1170232497 20:14065684-14065706 GGGGAAACTGAGGCCTAGAAGGG + Intronic
1170288045 20:14733912-14733934 GGGGAAACTAAGGCATTAAGAGG - Intronic
1171311094 20:24145115-24145137 GGGTAAACTGAGGCCTGGGTTGG + Intergenic
1171977684 20:31605855-31605877 GGGGAAACGGAGGCCAGAGAGGG + Intronic
1172012919 20:31856862-31856884 TGAGAAACAAAGGCCTGGGAGGG + Intronic
1172053019 20:32133731-32133753 GGGGAAACCGAGGCCTGGGAAGG + Intronic
1172057596 20:32165186-32165208 GGGGAAACTGAGGCCTGGCCAGG - Intronic
1172296145 20:33812244-33812266 GGGGAAACTGAGGCCTCAAAGGG - Intronic
1172484732 20:35291357-35291379 GAAGAAACTGAGGCCAGAGAGGG - Intronic
1172589818 20:36109735-36109757 GAGGAAGCTGAGGCCTGTGAAGG + Intronic
1172591607 20:36121944-36121966 GGTGAAACCAAAGCCCGAGAAGG + Intronic
1172608608 20:36232384-36232406 CGGGAAACTGAGGCCCAAGAGGG - Exonic
1172624852 20:36341068-36341090 AGGGAAACTGAGGCCAGAGAGGG + Intronic
1172773182 20:37393206-37393228 GGGGAAACTGAGGCCAGAGGGGG - Intronic
1172837571 20:37882932-37882954 GGGCAAACTGAGGCCCCAGAAGG + Intergenic
1173470069 20:43316610-43316632 GGAGAAACTGAGGGCTGGGAAGG - Intergenic
1173614266 20:44392729-44392751 TGGGAAACCAAGGCCAGGGAGGG + Intronic
1173701090 20:45072257-45072279 GGGGAAATTAAGGTCTGAGGAGG + Intronic
1173706154 20:45111752-45111774 GAGGAAATCAAGGCCTGAAAAGG + Intronic
1173722602 20:45272718-45272740 GGGAAAATTAAGGCTTGGGAAGG - Intergenic
1173792282 20:45835237-45835259 GGGGAAACTGAGGTCAGAAAGGG + Intronic
1174089543 20:48036137-48036159 GGTACAACTCAGGCCTGAGAAGG + Intergenic
1174130495 20:48340652-48340674 GAGGAGACTGAGGCCAGAGAGGG - Intergenic
1174140447 20:48409591-48409613 GAGGAAACTAGAGCCAGAGAGGG - Intergenic
1174189983 20:48733651-48733673 GGGGAGTTTAAGACCTGAGAGGG - Intronic
1174385534 20:50186697-50186719 GGGGAAACTGAGGCCCGAAGAGG - Intergenic
1174799108 20:53548159-53548181 TAGGAAACTGAGGCCTGAGGGGG - Intergenic
1175284871 20:57831270-57831292 GTGGAAACTGAGGCCTAGGATGG - Intergenic
1175754048 20:61518042-61518064 GGGGAAAATAGCGCCTGAAAAGG - Intronic
1175924878 20:62466739-62466761 GGGGAAACTGAGGCCCAGGAAGG - Intronic
1175930435 20:62491390-62491412 GGGGAAACTGAGTCCTGAGGTGG + Intergenic
1175934021 20:62506853-62506875 GGGGAAACTGAGGCCTGGGGAGG - Intergenic
1175954779 20:62603708-62603730 GGGGAAACGTGGGCCTGAGCAGG - Intergenic
1175985362 20:62761727-62761749 GGGGAAACTGAGTCCAGAGAAGG - Exonic
1176221257 20:63970165-63970187 GGGTAAACTGAGGCCCGATAGGG + Intronic
1176282192 20:64319943-64319965 GAGAAAACTAAGGCCTGAGGAGG - Intergenic
1178584235 21:33859365-33859387 GGGGAAACTAAGGCTCAAAAAGG - Intronic
1179273239 21:39867534-39867556 AGGGAAACTTAGGAGTGAGAAGG + Intronic
1179632628 21:42688252-42688274 GGGGAAACTGAGGCCCAGGAGGG + Intronic
1180765167 22:18341956-18341978 GGGGAAACTGAGGCTGGACATGG - Intergenic
1180813863 22:18777728-18777750 GGGGAAACTGAGGCTGGACATGG + Intergenic
1180876913 22:19178855-19178877 CGGGAAACTGAGGCCTGGGCGGG + Intergenic
1181000016 22:19983636-19983658 GGGGAAACTGAGGCCTGGCAGGG + Intronic
1181033770 22:20160327-20160349 GGGAAGACTGAGGCCAGAGAGGG - Intergenic
1181200048 22:21212063-21212085 GGGGAAACTGAGGCTGGACATGG + Intronic
1181701687 22:24624896-24624918 GGGGAAACTGAGGCTGGACATGG - Intronic
1181782489 22:25203164-25203186 GGGGAAACTGAGGCCAAAGTTGG + Intronic
1181927540 22:26372073-26372095 AGGGAAACCAAGGTCAGAGAGGG - Intronic
1181991415 22:26839666-26839688 GGAGAAACTGAGTCCTGAGATGG - Intergenic
1182114998 22:27751311-27751333 GGGGAAACTGAGGCCCAACAGGG - Intronic
1182117712 22:27766726-27766748 AGGGAAACCAAGGCCACAGAGGG + Intronic
1182280182 22:29213959-29213981 GGGGAAACTGAGGCTTGGGGAGG - Intronic
1182310098 22:29398240-29398262 TGGGAAACTGAGGCCTGAACTGG - Intronic
1182424418 22:30264583-30264605 CCGGAAACTGAGGCCCGAGAGGG + Intronic
1182428669 22:30288019-30288041 AGGGAAACTAAGGCCTGCAGTGG + Intronic
1182534811 22:30992969-30992991 AAGGAAACTGAGGCCAGAGAGGG + Intergenic
1182796257 22:32993780-32993802 GGAGAAACAGAGGCCAGAGAAGG + Intronic
1183026488 22:35069425-35069447 GGGGAGATTGAGGCCAGAGAGGG - Intronic
1183039034 22:35162310-35162332 GGGGGAAAAAAGGCCAGAGAAGG - Intergenic
1183060954 22:35336153-35336175 GGAGAACCAATGGCCTGAGAAGG - Intronic
1183098191 22:35567136-35567158 GGGGAAACTGAGGCTTCAGGAGG - Intergenic
1183102191 22:35590980-35591002 GGGGGAAGTAAGGCAGGAGAGGG - Intergenic
1183281622 22:36935537-36935559 GGGGAAACTGAGGCCCAGGAAGG - Intronic
1183333915 22:37235996-37236018 GAGGAAACTGAGGCCTGAAGAGG + Intronic
1183377642 22:37474355-37474377 GGGGAAACTGAGGCCTAGGGTGG - Intronic
1183394093 22:37561542-37561564 GGGGAAACTGAGGCCAGAACGGG - Intronic
1183395281 22:37567977-37567999 GGAGAAACCGAGGCCAGAGAGGG + Intronic
1183545199 22:38451734-38451756 GTGGAAACTGAGGCCTGAGGGGG - Intronic
1183545219 22:38451830-38451852 GTGGAAACTGAGGCCTGAGGGGG - Intronic
1183724189 22:39579286-39579308 GGGGAGACTGAGGCCCGGGAAGG + Intronic
1183743030 22:39678812-39678834 CGGGACAGTCAGGCCTGAGAAGG - Intronic
1184059615 22:42074133-42074155 CGGGAAACTGAGGCCCGAGAGGG - Intergenic
1184279718 22:43430051-43430073 GGGGAAACTGAGGCCTGGGGAGG - Intronic
1184284915 22:43465102-43465124 GGGGAAACTGAGGCACGAGGAGG + Intronic
1184606850 22:45579288-45579310 GGGGAAACTGAGGCCCGGAAGGG + Intronic
1184692197 22:46122509-46122531 GGGGAAACTGAGGCCAGGGAGGG - Intergenic
1184729470 22:46364869-46364891 GGGGAAACTGAGGCCCAGGAGGG + Intronic
1185025252 22:48405202-48405224 AGGGAAGTTGAGGCCTGAGAGGG - Intergenic
1185105481 22:48867187-48867209 GGGGAAACTGAGGCCTGCAACGG + Intergenic
1203226788 22_KI270731v1_random:82861-82883 GGGGAAACTGAGGCTGGACATGG - Intergenic
1203263962 22_KI270734v1_random:3415-3437 GGGGAAACTGAGGCTGGACATGG + Intergenic
949500180 3:4672799-4672821 GGGAATGCTAAGGCCTAAGATGG - Intronic
949637791 3:6002978-6003000 GTGCAAATTAAGGCCTGAGGAGG + Intergenic
949805762 3:7953717-7953739 AGAGAAACTGAGGCCTAAGATGG - Intergenic
950077765 3:10199378-10199400 GAGGAAACTGAGGCCTGAGCAGG - Intronic
950101464 3:10359421-10359443 GGGGAAACTGAGGCCAGAGAGGG + Intronic
950187549 3:10954400-10954422 GAGGAAACCAAGGCCTGGGGAGG - Intergenic
950272035 3:11624577-11624599 GGGGAAACTGAGGCATGGGAGGG - Intronic
950348661 3:12324536-12324558 GGGAAAACTGAGGCCTGAAGAGG - Intronic
950361623 3:12453397-12453419 GAGGAAACTGAGGCCAGAGAGGG + Intergenic
950443443 3:13022910-13022932 GGTGAAACTAAGGCCGGAGGGGG - Intronic
950577799 3:13843398-13843420 GAGGAAACTGAGGCTTGAGAAGG + Intronic
950716477 3:14851057-14851079 GGGGAAACTAAGGCCCTTGGAGG + Intronic
950964575 3:17137437-17137459 GGGGAAACTAAGGCTCAAGGGGG - Intergenic
951656848 3:25018741-25018763 GAGCAAACTTAAGCCTGAGAAGG - Intergenic
951752204 3:26049057-26049079 GGAGAAACTAAGGCTTGGCAAGG + Intergenic
952095476 3:29946756-29946778 TGGAAAACTATGGCATGAGAAGG + Intronic
952224831 3:31364920-31364942 GTGGAACCTAAAGCCTGAGAAGG - Intergenic
952887398 3:38020070-38020092 GGGGAAACTGAGGCCTGGCCTGG - Intronic
953392476 3:42541409-42541431 GGGTAACCAAAGGCCAGAGAAGG + Intergenic
953974519 3:47371892-47371914 GGGGAAACTGAGGTGTGCGATGG - Intergenic
954326792 3:49868431-49868453 GGGGAAACTGAGGCATGGGGAGG - Intronic
956142500 3:66159893-66159915 GAGGAAACTGAGGCTTGAGAAGG + Intronic
956436201 3:69236760-69236782 GGGTATACTAAGGCCTGGGATGG + Intronic
956571251 3:70698266-70698288 GGGGAGACAAATACCTGAGAAGG + Intergenic
956659986 3:71587865-71587887 GGAGAAACTGAGGCCACAGAGGG + Intergenic
956894933 3:73649890-73649912 GAGGAAACTGAGGCCCTAGACGG + Intergenic
958977662 3:100685314-100685336 TGTGAAAATAAAGCCTGAGAAGG + Intronic
959111864 3:102132321-102132343 GAGAAAACTCAGGTCTGAGAAGG - Intronic
960326447 3:116301708-116301730 TGGGAAATTAAGGCTTCAGAAGG + Intronic
960657866 3:120025894-120025916 AGGGAAACTAAGGCCTAAAAAGG - Intronic
960829813 3:121834788-121834810 GTGGAAACTGAGGCCTGGGGAGG - Intronic
961037128 3:123650183-123650205 GGGGAAACCAAGGCCCAGGAAGG - Intronic
961133675 3:124491254-124491276 GGGGAAACTTAGGGCTGGGGTGG - Intronic
961358679 3:126354449-126354471 GAGGAAACTAAGGTTTGGGAAGG - Intronic
961469394 3:127101753-127101775 GGGGAAACTGAGGGCCGGGAAGG + Intergenic
961556396 3:127699090-127699112 GGGGAAACTGAGGCCCAGGAAGG - Intronic
961650806 3:128415863-128415885 GGGGAAACTGAGGCAGGGGAGGG + Intergenic
962405228 3:135094603-135094625 GGGGAAACTGAGGCTGGAGAAGG - Intronic
964417901 3:156468831-156468853 TGGGACACTAAGGCCTGAGCAGG - Intronic
965661732 3:171049333-171049355 GAGGAAACTCAGGCCTGTGATGG + Intergenic
966391001 3:179451984-179452006 GACGAAACTTAGGCCCGAGACGG - Intergenic
966500131 3:180630058-180630080 GAGGAAACTTAGGCCTCACATGG + Intronic
966660663 3:182411089-182411111 GTGGAAACCTTGGCCTGAGATGG + Intergenic
966739785 3:183221921-183221943 AGGAAAACTAAGGCCCAAGAGGG + Intronic
967118999 3:186365976-186365998 GGGAAAAGTGAGGCCTAAGAAGG - Intergenic
967234723 3:187373109-187373131 GGAGAAACTAAGGCCCCGGAAGG - Intergenic
967348685 3:188488043-188488065 GGGGAAACTGAGACCCAAGAAGG + Intronic
967877436 3:194276834-194276856 TGGGAAACTGAGGCCTGGCAAGG - Intergenic
967894267 3:194383987-194384009 GGGGACACTAAGGCCCAAGACGG + Intergenic
967976878 3:195040488-195040510 GAGGACACTGAGGCCTCAGAGGG + Intergenic
968873817 4:3254884-3254906 GGGGAAACTGAGGTCCCAGAAGG - Intronic
968902443 4:3438055-3438077 GGTGAATCGAAGGCCTGGGAAGG - Intronic
969226735 4:5803495-5803517 GGGGAAACCAAGGCCTACCAAGG - Intronic
969227740 4:5810161-5810183 GAGGAAACTGAGGCCTGGGAAGG - Intronic
969295783 4:6270095-6270117 GGGGAAACTGAGGCCCGAAGAGG - Intronic
969444007 4:7233896-7233918 GCGGAAACTGAGACCAGAGAAGG - Intronic
969671460 4:8592551-8592573 GGGGAAACTGAGGCCCAAGGAGG + Intronic
969717007 4:8872623-8872645 GGGGAAGCCAGGGCCTTAGAAGG + Intergenic
969717256 4:8873705-8873727 AAGGAAACTGAGGCCAGAGAGGG + Intergenic
969817432 4:9696921-9696943 AGGGAAACTGAGGCCAAAGAAGG - Intergenic
969839758 4:9872164-9872186 GGTGAAACTGAGGCCAGAGAGGG + Intronic
970310883 4:14781159-14781181 GAGGAAACTCAGGCCTAAGAGGG - Intergenic
970370793 4:15404391-15404413 GGTGAAAATCAGGACTGAGAAGG - Intronic
970582986 4:17490373-17490395 GGGGAAACTGAGGCCTCAGCAGG + Intronic
970826579 4:20283610-20283632 GGGGGAACTAAGAGATGAGATGG - Intronic
970913721 4:21308446-21308468 GAGGAAACAAAGGCTTGTGAAGG + Intronic
971275071 4:25188526-25188548 CGGGAGGCTAAGGCCAGAGAAGG - Intronic
971777908 4:30992061-30992083 AAGGAAACTGAGGCCTCAGAAGG - Intronic
972293743 4:37716677-37716699 AGGGAAACTCAGCTCTGAGATGG + Intergenic
972694211 4:41428933-41428955 GGGGAATCAAATGCTTGAGATGG - Intronic
973185302 4:47320439-47320461 GGAGAAACTACGTTCTGAGAAGG - Intronic
975146024 4:70968088-70968110 GGGGATACCAAGGCCTGGGGAGG - Intronic
976105540 4:81613292-81613314 GGGGAGATGAAGGCATGAGAAGG - Intronic
976384891 4:84445401-84445423 AGGTGAAGTAAGGCCTGAGAGGG - Intergenic
976460112 4:85301707-85301729 GGGGAAACCAAGGTCTGAGGAGG - Intergenic
977000683 4:91497171-91497193 GAGGAACCTAAGGCCTCAAAGGG - Intronic
977311139 4:95388760-95388782 GAGGAAACTAAGGCTTGGAATGG + Intronic
977547694 4:98403685-98403707 GGTGAGAATAAGGACTGAGAAGG + Intronic
977576029 4:98674976-98674998 GGAGAAACTAAGGCAGGAAAGGG - Intergenic
981490593 4:145335411-145335433 GGGGAAACTGAGGCTTAAAATGG + Intergenic
982526308 4:156483760-156483782 GAGGAAACTGAGTCTTGAGAAGG - Intergenic
984238617 4:177192169-177192191 AGGGAAGCTTCGGCCTGAGACGG - Intergenic
984580309 4:181503000-181503022 GAAGAAACAAAGGCCAGAGAAGG - Intergenic
986269676 5:6219872-6219894 GAGTAAACTAAGGCCTGGTAAGG + Intergenic
986314552 5:6577804-6577826 TGGGAAACGGAGGCCTGAGCGGG + Intergenic
987290782 5:16506039-16506061 GGTGAACCAACGGCCTGAGAGGG - Intronic
987527444 5:19071323-19071345 GGAAAAACTAAGGTCTGAGGAGG + Intergenic
988784215 5:34551022-34551044 GGGGAAACTGAGGCAGCAGATGG - Intergenic
989171346 5:38472677-38472699 GGGGACACACAGGCCTGGGAAGG + Intergenic
989191447 5:38673580-38673602 GGGAAAAGTAGGGCCTCAGATGG + Intergenic
990042585 5:51390952-51390974 TGGGAAGCTATGGTCTGAGAAGG + Intronic
990513951 5:56514989-56515011 GGGGAAACTAGGCCCAGAGTGGG + Intronic
990759914 5:59117527-59117549 GGGGGAAGTAAGGCTTGAGTTGG - Intronic
991724162 5:69519446-69519468 GGGGAAAAAAAGCCCTAAGAAGG - Intronic
997272876 5:132556753-132556775 GGGGAGACCAAGACCTGTGACGG - Intronic
997586034 5:135044136-135044158 GGGTAAACTGAGGCCTTCGAGGG - Intronic
997716406 5:136046411-136046433 GGAGAAGCTGAGGCCTGAGATGG + Exonic
998389439 5:141778179-141778201 GGGGAAACTGAGACCTGGAAGGG - Intergenic
998416902 5:141952693-141952715 GAGGAAACTGAGGTCTGAGGAGG - Intronic
999188384 5:149729910-149729932 GGGGAAACTGAGGCTCGAGAAGG - Intergenic
999238160 5:150112449-150112471 GGGGAAACTGAGGCCTGATGTGG + Intronic
999245340 5:150151296-150151318 GGGAAAACTGAGGCCCCAGAAGG + Intronic
999249069 5:150171102-150171124 GGGGAAACTGAGGCCCATGAAGG + Intronic
999308391 5:150535542-150535564 TGGGAAGCTGAGGCCTGGGAGGG - Intronic
999645273 5:153711573-153711595 GAGGAAACTGAGGCCAGAGAGGG + Intronic
999972374 5:156877951-156877973 GATGAAACTAAGTCCAGAGAAGG + Intergenic
1000213569 5:159133090-159133112 GTGGAAACCAAGTCCAGAGACGG + Intergenic
1000673012 5:164085951-164085973 GGGGAAACTGAGGCCTAGGGAGG + Intergenic
1000880735 5:166693963-166693985 GGGGAACATAAAGCCTGAAAGGG - Intergenic
1001297779 5:170510885-170510907 GAGGAAACTGAGGCCTGGAAAGG - Intronic
1001431597 5:171666876-171666898 GGGGTAACTGAGGTCTGAGGGGG + Intergenic
1001929910 5:175665467-175665489 GGGGAAACTGAGGCTGGAGTGGG + Intronic
1001932869 5:175685651-175685673 GAGGAAACTGAGGCCTGAGATGG - Exonic
1002047519 5:176550229-176550251 GGGGAAACTGAGGCCTGGAGAGG + Intronic
1002085937 5:176775452-176775474 GAGGAAACTGAGGCCTTAGAAGG - Intergenic
1002101586 5:176860606-176860628 GGGGAACCTGAGGCCCGAGGGGG - Intronic
1002277906 5:178115065-178115087 CGGGAAACTGAGGCCTCGGAAGG - Intronic
1002330021 5:178434741-178434763 GAGGAAACTGAGGCCTGGGATGG + Intronic
1002793079 6:449572-449594 GGGGAAGCTGAGGCTGGAGACGG + Intergenic
1003127084 6:3363905-3363927 GAGGAAACTCATGCCTGTGAGGG - Intronic
1003152234 6:3562761-3562783 AGGGAATCTGAGGCCTGGGAAGG + Intergenic
1003511969 6:6789301-6789323 GTAAAAACTAAGGCCAGAGAGGG - Intergenic
1003620293 6:7693506-7693528 GGGGAAACTGAGGCCTGGAGAGG + Intergenic
1003960572 6:11205192-11205214 GAGGGAACTGAGGTCTGAGAAGG - Intronic
1004164237 6:13241568-13241590 GTGGAAACTAAGGCTTGACAGGG - Intronic
1005710347 6:28498350-28498372 GGGGCACCTAAGGACTGAGTGGG + Intergenic
1006376237 6:33673159-33673181 GGGGAAACTGAGGCCTGTGAGGG - Intronic
1006439963 6:34047767-34047789 AAGGAAACTGAGGCCTGAGGAGG + Intronic
1006459576 6:34150613-34150635 GGGGAAACTGAGGCTGGGGAAGG - Intronic
1006459592 6:34150678-34150700 GGGGAAACTGAGGCTGGGGAAGG - Intronic
1006468260 6:34209363-34209385 GAGGAAACTAAGGCCAGAGTAGG - Intergenic
1006923880 6:37643701-37643723 GGGGAAGCTGAGGCCTCACATGG + Intronic
1007267414 6:40607531-40607553 GTGGAAACTGAGGCCCAAGAAGG + Intergenic
1007269279 6:40623944-40623966 GGGGAAACTAAGGTCTGAAAAGG - Intergenic
1007516958 6:42420167-42420189 GAGGAAACTAAGTCCTGGGAAGG - Intronic
1007769291 6:44180274-44180296 AGGGAAACTGAGGCATGAGAAGG + Intronic
1007938111 6:45751929-45751951 GAGGAAACTAAGGTCAAAGATGG + Intergenic
1008285696 6:49646729-49646751 GGGAAAACTAAGACATGAAATGG + Intergenic
1008524888 6:52397968-52397990 GGTGAAAGTGAGGCCTAAGAGGG + Intronic
1010748224 6:79588353-79588375 GGGGAAACTAATGGAAGAGAAGG + Intergenic
1012054914 6:94393918-94393940 GGAGAAAAGAAGGCCTGAGATGG + Intergenic
1012868399 6:104644916-104644938 GGGGATGGTAAGGACTGAGAAGG - Intergenic
1013089984 6:106891697-106891719 GGGGAAACTAATGGATGATAAGG + Intergenic
1013314268 6:108925990-108926012 GGTGAGAATAAGGCCTGAGAAGG + Intronic
1013814040 6:114076270-114076292 CTAGAAACAAAGGCCTGAGAAGG + Intronic
1014283170 6:119464655-119464677 GAGGAAAATGAGGCCTGAGGAGG - Intergenic
1016024956 6:139277638-139277660 GGGGAAAGGAAGGCCAGAGAAGG - Intronic
1018160662 6:161039039-161039061 GCGGAAGCTAAGGCCTAAGAAGG - Intronic
1018249812 6:161858055-161858077 TGGGAAACTTAGGTGTGAGAAGG - Intronic
1018443712 6:163835821-163835843 GGGGAAACTGAGGCCTAGGAAGG - Intergenic
1018970772 6:168527300-168527322 GGGGAAACTGAGGCCCGGGAAGG - Intronic
1019275747 7:174632-174654 GGGTAAACTGAGGCCAGAGAGGG - Intergenic
1019283461 7:211755-211777 GGGGAAACTGAGGCCCGGAAAGG + Intronic
1019300458 7:300533-300555 GGGGAAACTGAGGCTTGAGAGGG + Intergenic
1019411156 7:907349-907371 GTGGAAACTGAGGCCAGAGGGGG + Intronic
1019647712 7:2139941-2139963 AGGGAAACTGAGGCCTGTGGGGG - Intronic
1019818345 7:3218053-3218075 GGGGGAACTGAGGCTTGGGAAGG - Intergenic
1020097298 7:5376289-5376311 GGGGAAGCTGAAGCCAGAGAGGG + Intronic
1020100155 7:5389904-5389926 GAGGAAACTGAGGCTTGGGAAGG - Intronic
1020259592 7:6523444-6523466 GGGGAAACTGAGGCCTGGAGAGG - Intronic
1021153388 7:17179450-17179472 AGGGAAACTGAGGCCTGGAATGG + Intergenic
1022177543 7:27886217-27886239 GAGGAAACTGAGGCTTGAGAAGG + Intronic
1022456776 7:30564681-30564703 GCGGATACTGAGGCCAGAGAGGG + Intergenic
1022494970 7:30847103-30847125 AGGGAAACAAAGGCCAGGGAGGG + Intronic
1022529599 7:31058569-31058591 AGGGAAACTGAGGCCAGAGAAGG - Intronic
1022873104 7:34500119-34500141 AGGGAAACCAAGGCATGAGGAGG + Intergenic
1023168991 7:37372352-37372374 GGGGAAACTGAGGCCTGTCAAGG - Intronic
1023295231 7:38708072-38708094 GAGGAAACTAAGGCCAGAGTGGG - Intergenic
1023347609 7:39287448-39287470 TGAGAAGCTAAGGCCTGGGAGGG - Intronic
1023743592 7:43302350-43302372 CGGGAAGCTGAAGCCTGAGAAGG - Intronic
1023850299 7:44146334-44146356 TGGGAAACTAGGGCCTGGGGCGG - Intronic
1024209031 7:47188075-47188097 GGGGGCTCTAAGGCCAGAGAGGG - Intergenic
1026287064 7:68972562-68972584 GAGGAAACTGAGACCTGGGAGGG + Intergenic
1026416347 7:70184791-70184813 GAGGAAACTATGCCCTGGGAAGG + Intronic
1026776134 7:73232039-73232061 ATGGAAACTAAGCCCAGAGAGGG - Intergenic
1026840832 7:73669202-73669224 GAGGAAACTGAGGCCAGAGAGGG + Intronic
1027016991 7:74785410-74785432 ATGGAAACTAAGCCCAGAGAGGG - Intronic
1027071036 7:75160526-75160548 ATGGAAACTAAGCCCAGAGAGGG + Intergenic
1029151100 7:98481034-98481056 GGGGAAACTGAGGCCTCACAAGG - Intergenic
1032076028 7:128836625-128836647 GGGGAAACTGAGGCATTAAAGGG - Intronic
1032470434 7:132174674-132174696 GAGAAAACTAAGGCCAGGGAGGG - Intronic
1033025548 7:137768693-137768715 GGGGAAACAGGGGCCAGAGAAGG - Intronic
1033661854 7:143408205-143408227 GGGGGGAGTAAGGCCGGAGAGGG + Intronic
1033790395 7:144786194-144786216 GGAAGAACTAAGGCTTGAGAAGG + Intronic
1034060360 7:148081761-148081783 CAGGAAACTGAGGCCTGAGGGGG + Intronic
1034105482 7:148486314-148486336 GGGGAAACTGAGTCCTGAAGAGG + Intergenic
1034139270 7:148801381-148801403 GGGGAAACTGAGGCCAGATGAGG + Intergenic
1034461850 7:151202065-151202087 GGGGAACCTTAGGGCAGAGAAGG + Intronic
1034554163 7:151839405-151839427 GGGGAAACTGAGGCCTAAAGAGG - Intronic
1035374391 7:158397697-158397719 GAGGAGACTCAGCCCTGAGAGGG - Intronic
1036133668 8:6139472-6139494 GGGGAAACTGAGACCAGAGAGGG - Intergenic
1036561229 8:9901999-9902021 GGGGAAACTGAGGCCGGGGAGGG + Intergenic
1037917638 8:22782109-22782131 TGGGAAACTGAGACTTGAGACGG + Intronic
1038021964 8:23558395-23558417 TGGGAAACTGAGGCCCAAGAAGG - Intronic
1038156079 8:24991841-24991863 GTGGAACCTAAGGGCTTAGACGG - Intergenic
1038351395 8:26779406-26779428 GAGGAAACTGAGGCCCAAGAAGG - Intronic
1038415189 8:27389820-27389842 GCGGGAACTGAGGGCTGAGAGGG + Intronic
1038693503 8:29784096-29784118 GAAGAGACAAAGGCCTGAGAAGG - Intergenic
1039489443 8:37936486-37936508 GAGGAAACAGAGGCCTGAGGGGG + Intronic
1039551295 8:38445017-38445039 GAGGAAGCTGAGGCTTGAGAGGG - Intronic
1039917907 8:41873336-41873358 GAGGAAAGTGAGGCCTGGGAAGG - Intronic
1040550866 8:48436465-48436487 GAGGAAACTGAAGCCTGAGGAGG - Intergenic
1040823403 8:51590413-51590435 GTGGAAACTCCGGCCTGGGAAGG + Intronic
1041343359 8:56869563-56869585 GGTGACACTAAGGACTGAAAAGG - Intergenic
1042707920 8:71681168-71681190 TGAGAAACTAATGCCTGAGGTGG + Intergenic
1042960001 8:74293462-74293484 GGGGAAACTAAGGCTTGGAGAGG + Intronic
1043315848 8:78920781-78920803 GAGGAAGCTAAGGTCTGAGGGGG - Intergenic
1043516968 8:81003636-81003658 GGGGAAACTGAGGCATGGGGCGG - Intronic
1044758788 8:95494731-95494753 GTGGTCACTAAGGCCTGGGATGG + Intergenic
1045017893 8:98014708-98014730 AGGGAAACTAAGGGTTGGGAAGG - Intronic
1046405217 8:113764067-113764089 GGGGAAAATAATGCCTGCAAAGG - Intergenic
1046788164 8:118290738-118290760 AGGGAAACTAAGTTCTGAGTGGG + Intronic
1046931497 8:119846045-119846067 GAGGAAACTAGGGCCTAGGAAGG - Intronic
1047205741 8:122802007-122802029 GGGGAAACTGAGGCCAGAGAGGG - Intronic
1047970449 8:130079874-130079896 GGGGAAATGAAGCGCTGAGATGG + Intronic
1048409411 8:134156561-134156583 AGGGATCCTAAGGCCTGAGTGGG - Intergenic
1048866452 8:138765127-138765149 GAGGAAACTGAGGCCGGAGGAGG + Intronic
1049019174 8:139942041-139942063 AAGGACACTAAGGCTTGAGAAGG - Intronic
1049287748 8:141785703-141785725 GAGGAAACGGAGGCCTGAGGAGG - Intergenic
1049443654 8:142620265-142620287 GAGGAAACTGAGGCCAGAGAGGG - Intergenic
1049462489 8:142736553-142736575 GGGGAAACTGAGGCCTGGAATGG + Exonic
1049472409 8:142782409-142782431 GGGGAAACTAAGGCTGGGCAAGG - Intergenic
1049541853 8:143212256-143212278 GGGGAAACTGAGGCCTCAGTAGG + Intergenic
1049651858 8:143773512-143773534 GGGGAACATAATGACTGAGATGG - Intergenic
1050014182 9:1216326-1216348 AGGGAAACCAAGGCATGTGATGG - Intergenic
1050423621 9:5491995-5492017 GAGGAAACTGAGGCTTTAGAGGG - Intergenic
1051187004 9:14470851-14470873 GAGGAAACTGAGGCCTATGAGGG - Intergenic
1051538608 9:18188927-18188949 GAGGAAACTGAGGCTTGGGAAGG + Intergenic
1052603785 9:30672261-30672283 GTGGATACTCAGGCCTGAGGAGG - Intergenic
1052816225 9:33104335-33104357 GTGGAAACTAGGGGCTGAGCTGG - Intronic
1053173002 9:35904418-35904440 GGAGAAACTGAAGCCAGAGAAGG - Intergenic
1053179989 9:35960644-35960666 GGGGAAACTGAGGCCTAGGGGGG - Intergenic
1053199385 9:36142393-36142415 TAGGAAACTGAGGCTTGAGAAGG - Intronic
1053279171 9:36806205-36806227 TGAGAAACTGAGGCCAGAGAAGG - Intergenic
1053381105 9:37650563-37650585 GGGGAAAAGGAGGCGTGAGAAGG + Intronic
1053413786 9:37933331-37933353 GGGGAAACCAAGGCCTGAGAAGG - Intronic
1054733637 9:68728038-68728060 GGGGAAAATAAGGCAAGATAAGG + Intronic
1054911701 9:70460927-70460949 TGGGAAACTGAGGCAGGAGAGGG + Intergenic
1055323522 9:75104911-75104933 GGGGAAACTGAGGTTAGAGAGGG - Intronic
1055603890 9:77948427-77948449 AGGGAGACTGAGGCCTGACACGG + Intronic
1056297914 9:85211407-85211429 GAGGAAACTGAGGCCATAGAGGG - Intergenic
1056316866 9:85398613-85398635 GGGCAAACTAAGGCTGGAGAGGG - Intergenic
1056676658 9:88682055-88682077 GGGGAAACTGAGGCCAGGGCTGG + Intergenic
1057290186 9:93801474-93801496 GGGGAGACTAAGGTCAGAGTGGG - Intergenic
1057498976 9:95581860-95581882 GGGGAAACTGAGGAATGAAAAGG - Intergenic
1057738987 9:97695264-97695286 GGAGAAATTGAGGCCAGAGAAGG - Intronic
1057743818 9:97735588-97735610 TAGGAAACTGAGGCCAGAGAGGG - Intergenic
1057757474 9:97849421-97849443 AGAGAAACTGAGGCCTAAGAAGG + Intergenic
1057801181 9:98192367-98192389 GGGGAAACTGAGGCCTGGAGAGG + Intronic
1057801720 9:98195169-98195191 GGGGAAACTGAGGCCACAGTGGG + Intergenic
1057914536 9:99045657-99045679 GAGGAAACTAAGGCCCAAGGAGG + Intronic
1058467430 9:105244048-105244070 GTGGAAACTGAGGCTTGAAAGGG - Intergenic
1059426282 9:114222809-114222831 GAGGAAACTAGGCCCAGAGAAGG - Intronic
1059433782 9:114264766-114264788 GGGAAAACTAAGGCCTGACAAGG - Intronic
1059723085 9:116980525-116980547 GGAGAAACTAAGGCCCCAAAAGG - Intronic
1059782829 9:117547867-117547889 GGGGAAACTAAGGCATAGAAAGG + Intergenic
1060028173 9:120190688-120190710 GGGAAAACCAAGCCCAGAGAAGG + Intergenic
1060205850 9:121682437-121682459 ATGGAAACTGAGGCCTGGGAAGG + Intronic
1060206329 9:121684796-121684818 GGGGAAACTGAGGCCTGGAGAGG + Intronic
1060218621 9:121752979-121753001 GGAGAAACTGAGGCCTGCCAGGG - Intronic
1060516972 9:124271994-124272016 GGGAAAACAGAGGCCTGAGTGGG - Intronic
1060523865 9:124309493-124309515 GGGGAAACTGAGGCCCAAGAGGG + Intronic
1060729953 9:126030916-126030938 GGGGCCAGCAAGGCCTGAGAGGG - Intergenic
1061003662 9:127916555-127916577 GGGAAAACTGAGGCAGGAGAGGG + Intronic
1061036184 9:128115562-128115584 GGGTAAACTGAGGCCAGGGAGGG + Intergenic
1061045202 9:128161004-128161026 GGGGAAACTGAGGCTGAAGAAGG - Intronic
1061045362 9:128162123-128162145 AGGGAAACCGAGGCCTCAGAAGG - Intronic
1061293787 9:129666429-129666451 GGGGAAACAGAGACCTGAGTCGG + Intronic
1061493324 9:130958067-130958089 AGGGAAACTAAGGCTGGAGAGGG - Intergenic
1061610315 9:131741130-131741152 GGGGACATTTAGGCCTGAGTAGG - Intergenic
1061724547 9:132574985-132575007 GGGGAAAAGCAGGCCTGGGAGGG - Intergenic
1061898957 9:133663181-133663203 GGGGAAACTGAGGCAGGAGCTGG + Intergenic
1061925208 9:133802885-133802907 GGGGAAACGGAGGCCAGAGCTGG - Intronic
1062046721 9:134427767-134427789 GGGGAAACTGAGGCATGAGGGGG - Intronic
1062182405 9:135197606-135197628 GGGGAAACCGAGGCATGAAAAGG - Intergenic
1062287118 9:135778224-135778246 GGGGAAACCAAGGCCCGGGAGGG - Intronic
1062352926 9:136148001-136148023 GAGGAAACTGAGGCCTGAGGAGG + Intergenic
1062439417 9:136563077-136563099 TGGGAAACTGAGGCCTGAGAGGG + Intergenic
1062460190 9:136659726-136659748 GGGGAAACTGAGGCCTGTGTGGG + Intronic
1186797906 X:13064369-13064391 GGAGAAACTAAGACCCAAGAAGG - Intergenic
1188647427 X:32587936-32587958 GGGGAAACTAAAGCCAAGGATGG + Intronic
1190054150 X:47172151-47172173 GAGGAAACCAAGCCCTGAGTGGG + Intronic
1190244463 X:48682020-48682042 GGGGAAACTGAGGCCTGGGGAGG + Intronic
1190309510 X:49106810-49106832 GGGGAAACTGAGGCCTGGGGAGG + Intergenic
1190640656 X:52480968-52480990 AGGGAAAGTCAGTCCTGAGAGGG + Intergenic
1190647016 X:52531897-52531919 AGGGAAAGTCAGTCCTGAGAGGG - Intergenic
1191054711 X:56229960-56229982 GGGAAAACTTAGACCTTAGATGG - Intergenic
1191673153 X:63767902-63767924 GGGGAAACTAAGGCTGGAAGAGG - Intronic
1191706666 X:64101247-64101269 GAGGTACCTAAGGCCTGAGCAGG - Intergenic
1191721024 X:64228926-64228948 GAGGAAACTGAGTCCAGAGAGGG + Intronic
1192168227 X:68839237-68839259 GGGGAAACCAAGGCCCCAAAAGG + Intronic
1192172077 X:68862199-68862221 GGGGATAATAAGGCCTGAGAAGG + Intergenic
1192173693 X:68873053-68873075 GGGGAGACTGAGGCCCCAGAGGG - Intergenic
1192225473 X:69224328-69224350 GGAGAAACTAAGGCCTAAAAAGG + Intergenic
1193121622 X:77828826-77828848 GGGGAAAGTAAGTCCTGACCAGG - Exonic
1195047405 X:101066661-101066683 GGTGATACTAATGCCAGAGAAGG + Intergenic
1195675345 X:107503398-107503420 GGGGAAACTGAGGCCTAGGAAGG + Intergenic
1195904119 X:109827279-109827301 GGGGAAACTGAAGCCCAAGAGGG - Intergenic
1196335946 X:114534563-114534585 GGGAAAAGTAAAGCCTGGGAAGG - Intergenic
1197680078 X:129373359-129373381 GGGGAAAGTAAAGTCTGAGCTGG + Intergenic
1197723843 X:129762498-129762520 GGGGGATCTGAGGCCTGACAGGG + Intronic
1198121024 X:133592674-133592696 GAGGTAACTATGGACTGAGATGG + Intronic