ID: 1163565544

View in Genome Browser
Species Human (GRCh38)
Location 19:18049034-18049056
Sequence GGCCAATGGTCTCGGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 5, 3: 6, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163565544_1163565550 1 Left 1163565544 19:18049034-18049056 CCAGCACACCGAGACCATTGGCC 0: 1
1: 0
2: 5
3: 6
4: 70
Right 1163565550 19:18049058-18049080 CCATGGCCGTACCTGTACCGTGG 0: 1
1: 0
2: 1
3: 9
4: 253
1163565544_1163565556 30 Left 1163565544 19:18049034-18049056 CCAGCACACCGAGACCATTGGCC 0: 1
1: 0
2: 5
3: 6
4: 70
Right 1163565556 19:18049087-18049109 CCAAGAAGAAATAAGTCTGTAGG No data
1163565544_1163565551 2 Left 1163565544 19:18049034-18049056 CCAGCACACCGAGACCATTGGCC 0: 1
1: 0
2: 5
3: 6
4: 70
Right 1163565551 19:18049059-18049081 CATGGCCGTACCTGTACCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163565544 Original CRISPR GGCCAATGGTCTCGGTGTGC TGG (reversed) Intergenic
904434397 1:30484900-30484922 GGCCTATGGTCTGGGTCTCCAGG + Intergenic
906116938 1:43363472-43363494 GGCCAAAGGTCAGGGTGGGCGGG - Exonic
908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG + Intronic
916318145 1:163473207-163473229 GGAAAATGGTCTCTGTGTGCTGG - Intergenic
919981808 1:202646488-202646510 GGCCAGTAGGCTCGGTGAGCAGG - Intronic
922661098 1:227430921-227430943 AGCCAGTGGTCTTGCTGTGCTGG - Intergenic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
1062834737 10:628306-628328 GGCCAATGGTCTCGTTCTTCAGG - Intronic
1064606698 10:17049310-17049332 GGCCAAAGCTCTCTGTGTGTGGG - Intronic
1067792656 10:49299617-49299639 GGCTAAGGTTCTTGGTGTGCTGG + Intronic
1070808832 10:79287044-79287066 GGCCCATGTCCTAGGTGTGCTGG - Intronic
1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG + Intergenic
1072044059 10:91637252-91637274 AGACAATGGTCTAGGTGTGGTGG + Intergenic
1078019067 11:7640375-7640397 GGGCAAGGGTGTCGGTCTGCAGG + Intronic
1085399297 11:76225994-76226016 GGCCTTTGGGCTGGGTGTGCAGG - Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1095523495 12:43096348-43096370 GGGCAATGGTCCCGTTGTCCTGG + Intergenic
1121024625 14:90606263-90606285 GGCCTATGGTTGGGGTGTGCTGG + Intronic
1123405900 15:20019269-20019291 GGGCCAAGGTCTAGGTGTGCTGG + Intergenic
1123515230 15:21025917-21025939 GGGCCAAGGTCTAGGTGTGCTGG + Intergenic
1126487930 15:49203336-49203358 GGCAAATGGTCTCGGTGTGGTGG - Intronic
1132762847 16:1519412-1519434 AGCCGATGGTCTCGGTTTTCAGG - Intronic
1140846958 16:78899581-78899603 GGCCAATGTTCCCGTTGTTCAGG - Intronic
1141595763 16:85095921-85095943 GACCAATGGTCCCGGAGTACAGG - Intergenic
1142012234 16:87721459-87721481 GGCCACAGGTCTGCGTGTGCTGG + Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1148899710 17:50866520-50866542 GGCCAATGGCGTCGGGGGGCAGG - Intronic
1150703758 17:67469549-67469571 GGCCGCTGGTCTGAGTGTGCTGG - Intronic
1150790625 17:68198283-68198305 GTCCAAGGGCCTCGGTGTGAGGG - Intergenic
1161473671 19:4473243-4473265 CGCCAATGGTCTGGGGGTCCTGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG + Intronic
926146474 2:10399641-10399663 GGCCAATGGTGTGAATGTGCTGG - Intronic
926715590 2:15921423-15921445 GGCCAATGGTGTGGGTGGGGTGG + Intergenic
929685850 2:44033538-44033560 GGAGAATGGTCACGGTGTGAGGG - Intergenic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
931557294 2:63519219-63519241 GGCTACTGGTCTCTGTGCGCAGG - Intronic
932666464 2:73702401-73702423 GGCCAATGGTGACTGAGTGCAGG - Intergenic
936084294 2:109456009-109456031 GGCCAAGGGGCTCCGTGAGCAGG - Intronic
937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG + Intronic
937960453 2:127454054-127454076 GGCCAAAGGTCTTGGTCAGCTGG + Intronic
938593308 2:132761373-132761395 GACCAGTGGTCCCAGTGTGCTGG - Intronic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1180835738 22:18928639-18928661 GGGCATTGGTCTGGCTGTGCAGG - Intronic
1181029291 22:20142211-20142233 GGCCAAGGGTCTGAGTCTGCAGG + Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1203285827 22_KI270734v1_random:153938-153960 GGGCATTGGTCTGGCTGTGCAGG - Intergenic
954795197 3:53157830-53157852 GGCCAGTGCTCTGGGTGTGATGG + Intronic
955358710 3:58253745-58253767 GGCCAATGATTTCAGTGTGCTGG + Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
961150419 3:124632903-124632925 GGCAAATGGTTTCTGTCTGCTGG - Intronic
961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG + Intergenic
967094220 3:186163410-186163432 GGCCTCTGGTCTGGGTGAGCAGG + Intronic
968655247 4:1775762-1775784 GGCCAATGGGCTTTGTGGGCTGG - Intergenic
969395901 4:6921111-6921133 TGCCAGTGTTCTCAGTGTGCTGG + Intronic
971361633 4:25943380-25943402 GGCCAATGGGCTGGGAGTGAAGG + Intergenic
972918759 4:43911127-43911149 GGCCAGTGATCTAGGTGTGGGGG - Intergenic
984386422 4:179065538-179065560 GGCAAATGGTAGCAGTGTGCAGG + Intergenic
985553470 5:544678-544700 GGCCAATGCTCTTGGGGTGTGGG + Intergenic
1001114830 5:168930824-168930846 GGCCAAGGGACTCAGTGTCCTGG - Intronic
1002762132 6:210328-210350 GGCCAATGGTCTGAGGGTGTGGG - Intergenic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1014341554 6:120214044-120214066 GGCAAATGTTTTTGGTGTGCTGG - Intergenic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1017693876 6:156994794-156994816 GACCAGTGGTCTCTGTGTCCCGG + Intronic
1027188581 7:75985530-75985552 GGGCAAGGGCCTCGGTGTGGCGG + Intronic
1030096659 7:105906639-105906661 GGCCATTGGTCATGGTGTCCTGG + Intronic
1036701703 8:11017568-11017590 GGCCCAGGGTCTCTGAGTGCCGG - Intronic
1039470432 8:37809983-37810005 GGGCACTGGTGTCAGTGTGCAGG - Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1042111324 8:65384147-65384169 GTCAAATGGTCTCTGTTTGCAGG + Intergenic
1042356576 8:67835018-67835040 GGCACACGGTCTCTGTGTGCAGG - Intergenic
1042461004 8:69068456-69068478 GGTAATTGGTTTCGGTGTGCTGG - Intergenic
1042560870 8:70071363-70071385 GGCCAATGGCTGCGGTGGGCGGG - Intronic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1046751156 8:117928146-117928168 GGCCAATGGACTCATTTTGCAGG + Intronic
1053345405 9:37374531-37374553 TGCCATTGGTCTGGGGGTGCAGG - Intergenic
1062678463 9:137762679-137762701 GGCCAACGGTCCAGATGTGCTGG + Exonic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1192458043 X:71293926-71293948 GGCCAATGGTCTTTGTTTTCTGG + Intronic