ID: 1163565550

View in Genome Browser
Species Human (GRCh38)
Location 19:18049058-18049080
Sequence CCATGGCCGTACCTGTACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 253}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163565540_1163565550 28 Left 1163565540 19:18049007-18049029 CCACTTCTGGGGCCTTCATGTCT No data
Right 1163565550 19:18049058-18049080 CCATGGCCGTACCTGTACCGTGG 0: 1
1: 0
2: 1
3: 9
4: 253
1163565542_1163565550 16 Left 1163565542 19:18049019-18049041 CCTTCATGTCTGAGGCCAGCACA 0: 1
1: 0
2: 9
3: 29
4: 199
Right 1163565550 19:18049058-18049080 CCATGGCCGTACCTGTACCGTGG 0: 1
1: 0
2: 1
3: 9
4: 253
1163565544_1163565550 1 Left 1163565544 19:18049034-18049056 CCAGCACACCGAGACCATTGGCC 0: 1
1: 0
2: 5
3: 6
4: 70
Right 1163565550 19:18049058-18049080 CCATGGCCGTACCTGTACCGTGG 0: 1
1: 0
2: 1
3: 9
4: 253
1163565546_1163565550 -7 Left 1163565546 19:18049042-18049064 CCGAGACCATTGGCCGCCATGGC 0: 1
1: 1
2: 6
3: 5
4: 68
Right 1163565550 19:18049058-18049080 CCATGGCCGTACCTGTACCGTGG 0: 1
1: 0
2: 1
3: 9
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163565550 Original CRISPR CCATGGCCGTACCTGTACCG TGG Intergenic
900492151 1:2955765-2955787 CCATGGCCTGAGCTGTACCTTGG + Intergenic
908627250 1:66058661-66058683 CCATGGCCTGAGCTGTACCTTGG + Intronic
910103065 1:83599131-83599153 CCATGGCCCAAGCTGTACCTTGG + Intergenic
910715525 1:90225513-90225535 CCATGGCCTGAGCTGTACCTTGG - Intergenic
911082825 1:93950209-93950231 CCATGGCCTGAGCTGTACCTTGG + Intergenic
912147335 1:106809657-106809679 CCATGGCCCCAGCTGTACCTTGG + Intergenic
912267583 1:108174300-108174322 CCATGGCCTGAGCTGTACCTTGG - Intronic
912890419 1:113524020-113524042 CCATGGCCCGAGCTGTACCTTGG - Intronic
914489097 1:148138801-148138823 CCATGGCCTGACCTGAACTGTGG - Intronic
915195036 1:154182976-154182998 CCATCTCCGTACCTGTTCCCGGG + Intronic
916035848 1:160921954-160921976 CCATGGCCTGAGCTGTACCTTGG - Intergenic
917002501 1:170375154-170375176 CCATGGCCCAAGCTGTACCTGGG + Intergenic
921343099 1:214154066-214154088 CCATTGGAGTCCCTGTACCGTGG + Intergenic
921452390 1:215324074-215324096 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1062859235 10:797134-797156 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1063335685 10:5210996-5211018 CCATGGCCTGAGCTGTACCTTGG + Intronic
1063391126 10:5650446-5650468 CCATGGCCCTGCCAGCACCGTGG + Intronic
1071035483 10:81239216-81239238 CAATGGCCGGAGCTGTACCTTGG + Intergenic
1071159288 10:82727433-82727455 CCATGGCCTGAGCTGTACCTTGG - Intronic
1071981039 10:91004498-91004520 CCATGGCCCGAGCTGTACCTTGG + Intergenic
1073864576 10:107787204-107787226 CCATGGCCTAAGCTGTACCTTGG - Intergenic
1074042904 10:109810032-109810054 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1074223616 10:111462159-111462181 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1074640232 10:115371005-115371027 CCATGGCCCAAGCTGTACCTTGG - Intronic
1075281672 10:121144073-121144095 CCATGGCCCAAGCTGTACCTTGG + Intergenic
1077302818 11:1855012-1855034 CCAGGGCTGCACCTGTGCCGGGG + Intronic
1079972993 11:27059191-27059213 CTATGGCCCAACCTGTACCTGGG - Intronic
1080973337 11:37304219-37304241 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1081080486 11:38733797-38733819 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1081595004 11:44453026-44453048 CCATGGCCCTACCTACACCCGGG + Intergenic
1088048365 11:105480493-105480515 CCATGGCCTGAACTGTACCTTGG - Intergenic
1093981112 12:25476930-25476952 CCATGGCAGTAGCTGCACCTCGG - Intronic
1096904911 12:54926567-54926589 CCATGGCCCAACCTGTACCTTGG - Intergenic
1096969150 12:55651577-55651599 CCATGGCCTGAGCTGTACCTCGG - Intergenic
1097141958 12:56909408-56909430 CCATGGCCTAAGCTGTACCTTGG - Intergenic
1099076324 12:78113540-78113562 CCATGGCCTTAGCTGTACCTTGG + Intronic
1099780063 12:87183050-87183072 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1099858923 12:88204970-88204992 CCATGGCCCGAGCTGTACCTTGG - Intergenic
1100147763 12:91698554-91698576 CCATGGCCCGAGCTGTACCCTGG + Intergenic
1100674897 12:96856085-96856107 CCATGGCCTGAGCTGTACCGTGG + Intronic
1104808067 12:131602097-131602119 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1105644574 13:22303370-22303392 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1105650547 13:22372357-22372379 CCATGGCCCAAGCTGTACCTTGG + Intergenic
1108936804 13:55891573-55891595 CCATGGCCCGAGCTGTACCTTGG + Intergenic
1109189549 13:59308219-59308241 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1109416839 13:62051595-62051617 CCATGGCCCGAGCTGTACCTTGG - Intergenic
1110566252 13:76960029-76960051 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1111189542 13:84790151-84790173 AAATGGCCCTAGCTGTACCGTGG - Intergenic
1111527628 13:89492573-89492595 CCATGGCCCGAGCTGTACCTTGG + Intergenic
1112769685 13:102781877-102781899 CCATGGCCCAAGCTGTACCTTGG - Intergenic
1112861522 13:103833658-103833680 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1113212594 13:108001122-108001144 CCATGGCCAGAGCTGTACCTTGG - Intergenic
1114618628 14:24081792-24081814 CCGTGGCCGGCCCTGCACCGTGG - Intronic
1115134782 14:30095579-30095601 CCATGGCCCAAGCTGTACCTTGG - Intronic
1115199135 14:30834477-30834499 CCATGGCCCAAGCTGTACCTTGG + Intergenic
1115878766 14:37891798-37891820 CCATGGCCCAAGCTGTACCTTGG - Intronic
1116694048 14:48149957-48149979 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1117084122 14:52181424-52181446 CCATGGCCCCAGCTGTACCTTGG + Intergenic
1120636965 14:86965014-86965036 CCATGGCCCAAGCTGTACCTTGG - Intergenic
1120808923 14:88782648-88782670 CCATGGCCTGAGCTGTACCTTGG - Intronic
1121166501 14:91807008-91807030 CCATGGCCCAAGCTGTACCTTGG - Intronic
1122917523 14:104865772-104865794 CCATGGCCGAGCCGGTGCCGGGG - Intronic
1124879308 15:33626737-33626759 CCATGGCCTGAGCTGTACCTTGG - Intronic
1126647988 15:50894272-50894294 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1128813968 15:70592255-70592277 CCATGGCCCAAGCTGTACCTTGG - Intergenic
1132303817 15:100794056-100794078 CAATGGCCTGACCTGTACTGTGG + Intergenic
1135919051 16:26631892-26631914 CCATGGCCGAAGCTGAACCTTGG + Intergenic
1138091314 16:54177006-54177028 CCACGGCTTTACCTGTGCCGGGG + Intergenic
1140402473 16:74682863-74682885 CCAAGTCTGTATCTGTACCGAGG - Intronic
1147597603 17:41726997-41727019 CCATGGCCTTTCCTGTAGTGGGG - Intronic
1149216216 17:54357625-54357647 CCATGGCCTGACTTGTACCTTGG + Intergenic
1149568122 17:57653585-57653607 CCTTGGCCCTACCTGTGCCTGGG + Intronic
1152064068 17:78100477-78100499 CCATGGCCCAAACTGTACCTTGG + Intronic
1152274788 17:79349865-79349887 TCATGGCCGTGCCTGCCCCGGGG - Intronic
1152552855 17:81038504-81038526 CCATGGCCTTCCTTGTGCCGAGG + Intronic
1152631892 17:81414199-81414221 CCATGGCAGGACCTGTGCTGGGG + Intronic
1154504375 18:15020868-15020890 CCATGGCCCAAGCTGTACCTTGG + Intergenic
1155707856 18:28838368-28838390 CCATGGCCCAAGCTGTACCTTGG + Intergenic
1155716694 18:28952687-28952709 CAATGGCCCAACCTGTACCTTGG + Intergenic
1155809065 18:30208567-30208589 CCATGGCCCAAGCTGTACCTTGG + Intergenic
1158335790 18:56414155-56414177 CCATGGCCGGAGCTGTGCCTTGG - Intergenic
1159617519 18:70598626-70598648 CCATGGGCTGACCTGTACCTTGG - Intergenic
1163565550 19:18049058-18049080 CCATGGCCGTACCTGTACCGTGG + Intergenic
1164541476 19:29124588-29124610 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1166252750 19:41582670-41582692 CCATGGCCCCAGCTGTACCTTGG + Intronic
1166900603 19:46058771-46058793 CCATGGCCCCAGCTGTACCTTGG + Intronic
1167758704 19:51429464-51429486 CTATGGACGTCCCTTTACCGTGG - Intergenic
1168473662 19:56660888-56660910 CCATGGGCGTCCCTGCTCCGCGG + Intergenic
925411556 2:3642754-3642776 CCATGGCAGCACCTGTCCTGTGG + Intronic
926919508 2:17926622-17926644 CCATGGCCCAAGCTGTACCATGG + Intronic
926929624 2:18023883-18023905 CCATGGCCCAAGCTGTACCTTGG + Intronic
928804367 2:35132661-35132683 CCATGGCCCGAGCTGTACCTTGG + Intergenic
929689189 2:44060403-44060425 CCATGGCCTGAGCTGTACCTTGG + Intergenic
930507724 2:52305294-52305316 CCATGGCCCTAGCTGTACCTTGG - Intergenic
930812900 2:55561149-55561171 CCATGGCCCAAGCTGTACCTTGG - Intronic
933085094 2:78046013-78046035 CCATGGCCCGAGCTGTACCTTGG - Intergenic
934960468 2:98668347-98668369 CCATGGCCTGAGCTGTACCTTGG - Intronic
935724042 2:106007631-106007653 CCATGGCCTGAGCTGTACCTTGG - Intergenic
936890703 2:117366507-117366529 CCATGGCCTGAGCTGTACCTTGG + Intergenic
936897577 2:117445752-117445774 CCATGGCCTGAGCTGTACCTTGG - Intergenic
937142455 2:119613567-119613589 CCATGGCCTGAGCTGTACCTTGG + Intronic
938503563 2:131851074-131851096 CCATGGCCCAAGCTGTACCTTGG + Intergenic
941967261 2:171312476-171312498 CCATGGCCCCAGCTGTACCTTGG - Intergenic
942123776 2:172803401-172803423 CCATGGCCCGAGCTGTACCATGG + Intronic
942733373 2:179082877-179082899 CCATGGCCCAAGCTGTACCTTGG + Intergenic
943017276 2:182528787-182528809 CCATGGCCTGAGCTGTACCTTGG - Intergenic
944272231 2:197796488-197796510 CCATGGCCTGAGCTGTACCATGG + Intergenic
944467475 2:200017657-200017679 CCATGGCCTGAGCTGTACCTTGG + Intergenic
945166659 2:206953940-206953962 CCATGGCCTGAGCTGTACCTTGG + Intronic
945330759 2:208536774-208536796 CCATGGCTGGAGCTGTACCTTGG + Intronic
945495301 2:210501069-210501091 CCATGGCCAGAGCTGTACCTTGG + Intronic
1176592395 21:8657714-8657736 CCATGGCCCTGCCTCTGCCGTGG + Intergenic
1176657721 21:9602710-9602732 CCATGGCCCAAGCTGTACCTTGG + Intergenic
1177339789 21:19784012-19784034 CCATGGCCCGAGCTGTACCTTGG + Intergenic
1177628767 21:23700296-23700318 CAATGGCCTTAGCTGTACCTTGG - Intergenic
1177741125 21:25154810-25154832 CCATGGCCCAAACTGTACCTTGG - Intergenic
1177992857 21:28059062-28059084 CCATGGCCGAAGCTGTACCTTGG - Intergenic
1178173974 21:30075813-30075835 CCATGGCCTGATCTGTACCTTGG - Intergenic
1178634241 21:34288395-34288417 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1179527915 21:41995863-41995885 CCATGGCCCAAGCTGTACCTTGG - Intronic
1179655648 21:42842614-42842636 CCTTGGCCTTACCTATACCAGGG - Intergenic
1180275254 22:10634861-10634883 CCATGGCCCTGCCTCTGCCGTGG + Intergenic
1181491492 22:23263117-23263139 CCATGGCCGCCCCTGTCCCCGGG - Intronic
1184695563 22:46137119-46137141 CCATGTCCCCACCTGCACCGTGG + Intergenic
949721837 3:6998759-6998781 CCATGGCCTGAGCTGTACCTTGG + Intronic
949770373 3:7570984-7571006 CCATGGCCTGAACTGTACCTTGG + Intronic
951446165 3:22782722-22782744 CCATGGCCCAAGCTGTACCTTGG + Intergenic
952029098 3:29119808-29119830 CCATGGCCTGAGCTGTACCTTGG - Intergenic
957873098 3:86112627-86112649 CCATGGCCTGAGCTGTACCTTGG - Intergenic
958018392 3:87968946-87968968 CCATGGCCCAAGCTGTACCTTGG - Intergenic
958050306 3:88335893-88335915 CCATGGCCTGAGCTGTACCTTGG + Intergenic
958157326 3:89771519-89771541 CCATGGCCCAAGCTGTACCTTGG + Intergenic
958474910 3:94568728-94568750 CCATGGCTGGAGCTGTACCTTGG - Intergenic
958836221 3:99148206-99148228 CCATGGCCTGAGCTGTACCTTGG - Intergenic
959756516 3:109906057-109906079 CCATGGCCTGAGCTGTACCTTGG + Intergenic
959788384 3:110328884-110328906 CAATGGCCCTAGCTGTACCTTGG - Intergenic
960473196 3:118093218-118093240 CCATGGCCTGAGCTGTACCTTGG - Intergenic
960849453 3:122036931-122036953 CCATGGCCTGAGCTGTACCTTGG - Intergenic
962847740 3:139286391-139286413 CCATGGCCACACCTGTACCCCGG - Intronic
964562268 3:158010621-158010643 CAATGGCCCTAGCTGTACCATGG + Intergenic
965028740 3:163335811-163335833 CCATGGCCATGGCTGTACCTTGG + Intergenic
965092845 3:164183771-164183793 CCATGGGCTAACCTGTACCTTGG + Intergenic
965198831 3:165631225-165631247 CCATGGCCTGAGCTGTACCTTGG - Intergenic
965838803 3:172880474-172880496 CCATGGCCCAAGCTGTACCTTGG - Intergenic
970307977 4:14752694-14752716 CCATGGCCCAAGCTGTACCTTGG + Intergenic
970721854 4:18997409-18997431 CCATGGCCTGAACTGTACCTTGG + Intergenic
971069972 4:23080246-23080268 CCATGGCCCGAGCTGTACCTTGG + Intergenic
971939775 4:33199864-33199886 CCATGGCCTGAGCTGTACCTTGG - Intergenic
972242093 4:37204191-37204213 CCATGGCCAGAGCTGTACCTTGG + Intergenic
972748852 4:41968847-41968869 CCATGGCCTGAGCTGTACCTAGG - Intergenic
972872120 4:43313031-43313053 CCATGGCCCAAGCTGTACCAAGG - Intergenic
974317949 4:60306567-60306589 CCATGGCCTGAGCTGTACCTTGG + Intergenic
975729244 4:77321360-77321382 CCATGGCCCAAGCTGTACCTTGG + Intronic
976678107 4:87725568-87725590 CCATGGCCTGAGCTGTACCTTGG - Intergenic
978083421 4:104621472-104621494 CCATGGCCTGAGCTGTACCTTGG + Intergenic
979093663 4:116518194-116518216 CCATGGCCTGAGCTGTACCTTGG + Intergenic
979721446 4:123905125-123905147 CCATGGCCAGAGCTGTACCTTGG - Intergenic
980350695 4:131680364-131680386 CCATGGCCCAAGCTGTACCTTGG - Intergenic
981121015 4:141051119-141051141 CCATGGCCCAAGCTGTACCTTGG + Intronic
981795362 4:148589473-148589495 CCATGGCCTGAGCTGTACCTTGG - Intergenic
982524988 4:156466912-156466934 CCATGGCCCAAGCTGTACCTTGG + Intergenic
982923395 4:161304690-161304712 CCATGGGCTGAGCTGTACCGTGG - Intergenic
983320620 4:166191748-166191770 CCATGGCCTGAGCTGTACCTTGG - Intergenic
983812321 4:172077971-172077993 CCATGGCCCAAGCTGTACCTTGG - Intronic
984553317 4:181185565-181185587 CCATGGCCCAAGCTGTACCTTGG + Intergenic
985394293 4:189525587-189525609 CCATGGCCTGAGCTGTACCTCGG - Intergenic
985724831 5:1510680-1510702 CCAGGGCCGTCCCTGTATCCTGG - Intronic
986014665 5:3747530-3747552 CCATGGCCCAAGCTGTACCCTGG - Intergenic
987252260 5:16111902-16111924 CCATGGCCCAAGCTGTACCTTGG - Intronic
987461980 5:18223253-18223275 CCATGGCCTGAGCTGTACTGTGG - Intergenic
987680759 5:21133431-21133453 CCATGGCCTGAACTGTACCTTGG - Intergenic
987773572 5:22336567-22336589 CCATGGCCCAAGCTGTACCTTGG - Intronic
988858557 5:35253026-35253048 CCATGGCCTGAGCTGTACCTTGG + Intergenic
989523658 5:42428275-42428297 CCATGGCCTGAGCTGTACCTTGG + Intronic
989626820 5:43437659-43437681 CCAAGGCCCTACCGGTACAGTGG - Intergenic
990788976 5:59455345-59455367 CCATGGCCTGAGCTGTACCTTGG - Intronic
991409366 5:66331432-66331454 CCATGGCCCAAGCTGTACCTTGG - Intergenic
992969641 5:82043241-82043263 CCGTGGCCCTAGCTGTACCATGG + Intronic
993015678 5:82532168-82532190 CCATGGCCCAAGCTGTACCTTGG + Intergenic
993215417 5:85016609-85016631 CCAGGGCTGTACCTGCACAGAGG - Intergenic
993413209 5:87596721-87596743 CCATGGCCTGAACTGTACCTTGG + Intergenic
993761312 5:91800393-91800415 CCATGGCCTGAGCTGTACCTTGG + Intergenic
995703603 5:114962118-114962140 CCATGGCCCAAGCTGTACCTTGG + Intergenic
995925533 5:117369303-117369325 CCATGGCCCAAGCTGTACCTTGG - Intergenic
996149996 5:120023395-120023417 CCATGGCCTGAGCTGTACCTTGG - Intergenic
996257799 5:121426712-121426734 CCATGGCCCAAGCTGTACCGTGG + Intergenic
999368364 5:151037746-151037768 CCATGGGCCTCCCTGGACCGAGG + Intronic
1000492010 5:161925892-161925914 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1000751393 5:165099994-165100016 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1001035225 5:168292261-168292283 CCAGGGTCCTACCTGTCCCGCGG - Exonic
1006815790 6:36848933-36848955 CCCTGGCTGTACCTGTACCGGGG + Intergenic
1010055114 6:71556139-71556161 CCATGGCCGGAACTGTATCTTGG - Intergenic
1011347688 6:86389756-86389778 CCATGGCCAAAGCTGTACCTTGG - Intergenic
1011382710 6:86759972-86759994 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1012097189 6:94977435-94977457 CCATGGCCAGAGCTGTACCTTGG + Intergenic
1012967126 6:105687066-105687088 CCATGGCCTCAGCTGTACCTTGG - Intergenic
1013947218 6:115735864-115735886 CCATGGCCGGAGCTGTACCTTGG - Intergenic
1014067693 6:117146032-117146054 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1014670724 6:124301183-124301205 CCATGGCCCGAGCTGTACCTTGG - Intronic
1015351536 6:132225511-132225533 CCATGGCCCAAGCTGTACCTTGG - Intergenic
1018086302 6:160303888-160303910 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1021750563 7:23795262-23795284 CCATGGCCTGAGCTGTACCTTGG - Intronic
1022444233 7:30456694-30456716 CCATGCCCGTCCCTGTCCCCGGG + Intronic
1023516795 7:41009413-41009435 TCATGGCTTTACCTGTCCCGTGG - Intergenic
1024983891 7:55179597-55179619 CCCTGGCCGTCCCTGTTCCTGGG - Intronic
1028048377 7:86152203-86152225 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1028296412 7:89137969-89137991 CCATGGCCTGAGCTGTACCTTGG - Intronic
1028957762 7:96713066-96713088 CCATGGCCTGAACTGTACCTTGG - Intergenic
1028961060 7:96750141-96750163 CCATGGCCCAAGCTGTACCTTGG + Intergenic
1030904299 7:115163188-115163210 CCATGGACTTAGCTGTACCTTGG + Intergenic
1031778994 7:125939267-125939289 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1031791967 7:126118054-126118076 CCATGGCCCAAGCTGTACCTTGG - Intergenic
1034751305 7:153571453-153571475 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1035022518 7:155807912-155807934 CCAGGGCCCTAACTGTAGCGTGG + Intronic
1035120756 7:156564657-156564679 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1039298245 8:36181382-36181404 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1039511359 8:38094657-38094679 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1044087216 8:87955926-87955948 CCATGGCCCTAGCTGTACATTGG + Intergenic
1044205772 8:89490688-89490710 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1044228240 8:89744007-89744029 CCATGGCCAGAGCTGTACCTTGG + Intergenic
1045067217 8:98459732-98459754 CCATGGCCCGAGCTGTACCTTGG - Intronic
1045736041 8:105297091-105297113 CCATGGCCTGAGCTGTACCTTGG + Intronic
1046358346 8:113117286-113117308 CCATGGCCCAAGCTGTACCTTGG - Intronic
1046368642 8:113271461-113271483 CCATGGCCCGAGCTGTACCTTGG - Intronic
1046689599 8:117267787-117267809 CCATGGCCCGAGCTGTACCTTGG + Intergenic
1047578682 8:126187832-126187854 CCATGGCTCTACCTGTATCATGG + Intergenic
1048669070 8:136695983-136696005 CCATGGCCCAAGCTGTACCTTGG - Intergenic
1050086545 9:1972156-1972178 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1050897294 9:10899571-10899593 CCATGGCAGGAGCTGTACCTTGG + Intergenic
1051644192 9:19251264-19251286 CCATGGCCTGAGCTGTACCTTGG + Intronic
1051767465 9:20540522-20540544 CCATGGCCCAAGCTGTACCTTGG + Intronic
1052156813 9:25202724-25202746 CCATGGCCTGAACTGTACCTTGG + Intergenic
1052267435 9:26590688-26590710 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1054288647 9:63259127-63259149 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1055432480 9:76258052-76258074 CCAGGGCCCTCCCTGTACCTGGG - Intronic
1057542434 9:95987992-95988014 CCATGGCCCAAGCTGTACCTTGG + Intronic
1061996032 9:134186509-134186531 CCATGACCGCACCTGGCCCGGGG - Intergenic
1203635449 Un_KI270750v1:106284-106306 CCATGGCCCAAGCTGTACCTTGG + Intergenic
1187070133 X:15879686-15879708 CCATGGCCCAAGCTGTACCGTGG + Intergenic
1187619157 X:21030840-21030862 CCATGGCCAAAGCTGTACCTTGG + Intergenic
1187663224 X:21573622-21573644 CCATGGCCCAACCTATACCTTGG + Intronic
1188056060 X:25542181-25542203 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1188755178 X:33953129-33953151 CCATGGCCAAAACTGTACCTTGG + Intergenic
1191084063 X:56545751-56545773 CCATGGCCCAAGCTGTACCTTGG + Intergenic
1191211470 X:57889492-57889514 CCATGGCCCGAGCTGTACCTTGG + Intergenic
1192676589 X:73203005-73203027 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1192713596 X:73616711-73616733 CCATGGCCCAAGCTGTACCTTGG + Intronic
1192920048 X:75696817-75696839 CCATGGCCTGAGCTGTACCATGG + Intergenic
1193682678 X:84541377-84541399 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1193950251 X:87788448-87788470 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1195815286 X:108878365-108878387 CCATGGCCCAAGCTGTACCTTGG + Intergenic
1195816763 X:108896643-108896665 CCATGGCTGAAGCTGTACCTTGG - Intergenic
1196478278 X:116113716-116113738 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1196565196 X:117196788-117196810 CCATGGCCTGAACTGTACCTTGG - Intergenic
1197057074 X:122134597-122134619 CCATGGCCTGAGCTGTACCTTGG - Intergenic
1197089625 X:122521296-122521318 CCATGGCCTGAGCTGTACCTTGG + Intergenic
1197202323 X:123759039-123759061 CCATGGCCCAAGCTGTACCTTGG - Intergenic
1197510233 X:127361808-127361830 CCATGGCCTAAGCTGTACCTTGG + Intergenic
1197534232 X:127667118-127667140 CCATGGCCCAACCTGTACTTTGG - Intergenic
1197560546 X:128015097-128015119 CCATGGCCCGAGCTGTACCTTGG + Intergenic
1198304661 X:135368637-135368659 CAATGGCCCTAGCTGTACCTTGG + Intergenic
1199580760 X:149357858-149357880 CCATGGCCCAAGCTGTACCTTGG - Intergenic
1199908772 X:152262067-152262089 CCATGGCCTGAGCTGTACCTTGG + Intronic
1200628711 Y:5554646-5554668 CCATGGCCCAACCTCTACCTTGG - Intronic