ID: 1163565551

View in Genome Browser
Species Human (GRCh38)
Location 19:18049059-18049081
Sequence CATGGCCGTACCTGTACCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163565546_1163565551 -6 Left 1163565546 19:18049042-18049064 CCGAGACCATTGGCCGCCATGGC 0: 1
1: 1
2: 6
3: 5
4: 68
Right 1163565551 19:18049059-18049081 CATGGCCGTACCTGTACCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 25
1163565544_1163565551 2 Left 1163565544 19:18049034-18049056 CCAGCACACCGAGACCATTGGCC 0: 1
1: 0
2: 5
3: 6
4: 70
Right 1163565551 19:18049059-18049081 CATGGCCGTACCTGTACCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 25
1163565542_1163565551 17 Left 1163565542 19:18049019-18049041 CCTTCATGTCTGAGGCCAGCACA 0: 1
1: 0
2: 9
3: 29
4: 199
Right 1163565551 19:18049059-18049081 CATGGCCGTACCTGTACCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 25
1163565540_1163565551 29 Left 1163565540 19:18049007-18049029 CCACTTCTGGGGCCTTCATGTCT No data
Right 1163565551 19:18049059-18049081 CATGGCCGTACCTGTACCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163565551 Original CRISPR CATGGCCGTACCTGTACCGT GGG Intergenic
914489096 1:148138800-148138822 CATGGCCTGACCTGAACTGTGGG - Intronic
921343100 1:214154067-214154089 CATTGGAGTCCCTGTACCGTGGG + Intergenic
921934919 1:220787208-220787230 CTTGGCCGTACCTGTCCCGCAGG - Exonic
1073426849 10:103460128-103460150 GATGGCAGTACCTGTCCCATAGG - Intergenic
1073429764 10:103478604-103478626 CCTGGCAGTACCTGTAGGGTGGG + Intronic
1081080487 11:38733798-38733820 CATGGCCTGAGCTGTACCTTGGG + Intergenic
1081967646 11:47179177-47179199 CATGGCCATGCCTGGCCCGTGGG + Exonic
1114618627 14:24081791-24081813 CGTGGCCGGCCCTGCACCGTGGG - Intronic
1129362838 15:75035117-75035139 AACGGCCCTACCTGTGCCGTAGG - Intronic
1131167365 15:90152132-90152154 CATTTCAGTACCAGTACCGTAGG - Intergenic
1139431036 16:66911171-66911193 CCTGGCCATACCTGTATCCTGGG + Exonic
1152274787 17:79349864-79349886 CATGGCCGTGCCTGCCCCGGGGG - Intronic
1160412450 18:78684158-78684180 CATGGCCGGACCTGTGGCCTCGG - Intergenic
1163565551 19:18049059-18049081 CATGGCCGTACCTGTACCGTGGG + Intergenic
1164853795 19:31505136-31505158 CATGGCCCTAGATGTACAGTGGG - Intergenic
1167758703 19:51429463-51429485 TATGGACGTCCCTTTACCGTGGG - Intergenic
925411557 2:3642755-3642777 CATGGCAGCACCTGTCCTGTGGG + Intronic
925866750 2:8234798-8234820 CATGGCCGCACCTGACCCTTGGG - Intergenic
927556683 2:24039403-24039425 CATGGCCTTGCCTGGACCGATGG - Exonic
945495302 2:210501070-210501092 CATGGCCAGAGCTGTACCTTGGG + Intronic
1180244477 21:46537834-46537856 CATGGCCACACCTGCACAGTTGG + Intronic
962847739 3:139286390-139286412 CATGGCCACACCTGTACCCCGGG - Intronic
1018086303 6:160303889-160303911 CATGGCCTGAGCTGTACCTTGGG + Intergenic
1034996177 7:155578454-155578476 CATGGCCTGAGCTGTGCCGTGGG + Intergenic
1035022519 7:155807913-155807935 CAGGGCCCTAACTGTAGCGTGGG + Intronic
1047578683 8:126187833-126187855 CATGGCTCTACCTGTATCATGGG + Intergenic
1057929987 9:99184964-99184986 GATGGCCGTCCTTGTACCGAAGG - Intergenic