ID: 1163565556

View in Genome Browser
Species Human (GRCh38)
Location 19:18049087-18049109
Sequence CCAAGAAGAAATAAGTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163565544_1163565556 30 Left 1163565544 19:18049034-18049056 CCAGCACACCGAGACCATTGGCC 0: 1
1: 0
2: 5
3: 6
4: 70
Right 1163565556 19:18049087-18049109 CCAAGAAGAAATAAGTCTGTAGG No data
1163565552_1163565556 0 Left 1163565552 19:18049064-18049086 CCGTACCTGTACCGTGGGTGTAT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1163565556 19:18049087-18049109 CCAAGAAGAAATAAGTCTGTAGG No data
1163565548_1163565556 9 Left 1163565548 19:18049055-18049077 CCGCCATGGCCGTACCTGTACCG 0: 1
1: 0
2: 1
3: 1
4: 36
Right 1163565556 19:18049087-18049109 CCAAGAAGAAATAAGTCTGTAGG No data
1163565547_1163565556 16 Left 1163565547 19:18049048-18049070 CCATTGGCCGCCATGGCCGTACC 0: 1
1: 0
2: 0
3: 6
4: 38
Right 1163565556 19:18049087-18049109 CCAAGAAGAAATAAGTCTGTAGG No data
1163565546_1163565556 22 Left 1163565546 19:18049042-18049064 CCGAGACCATTGGCCGCCATGGC 0: 1
1: 1
2: 6
3: 5
4: 68
Right 1163565556 19:18049087-18049109 CCAAGAAGAAATAAGTCTGTAGG No data
1163565549_1163565556 6 Left 1163565549 19:18049058-18049080 CCATGGCCGTACCTGTACCGTGG 0: 1
1: 0
2: 1
3: 10
4: 265
Right 1163565556 19:18049087-18049109 CCAAGAAGAAATAAGTCTGTAGG No data
1163565553_1163565556 -5 Left 1163565553 19:18049069-18049091 CCTGTACCGTGGGTGTATCCAAG 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1163565556 19:18049087-18049109 CCAAGAAGAAATAAGTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163565556 Original CRISPR CCAAGAAGAAATAAGTCTGT AGG Intergenic
No off target data available for this crispr