ID: 1163565628

View in Genome Browser
Species Human (GRCh38)
Location 19:18049535-18049557
Sequence AACACCACGGGGAAGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163565619_1163565628 6 Left 1163565619 19:18049506-18049528 CCATTCCCGGCTTGCACCGGGCA No data
Right 1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG No data
1163565613_1163565628 16 Left 1163565613 19:18049496-18049518 CCTCCGGTCCCCATTCCCGGCTT No data
Right 1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG No data
1163565616_1163565628 8 Left 1163565616 19:18049504-18049526 CCCCATTCCCGGCTTGCACCGGG No data
Right 1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG No data
1163565618_1163565628 7 Left 1163565618 19:18049505-18049527 CCCATTCCCGGCTTGCACCGGGC No data
Right 1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG No data
1163565614_1163565628 13 Left 1163565614 19:18049499-18049521 CCGGTCCCCATTCCCGGCTTGCA No data
Right 1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG No data
1163565611_1163565628 27 Left 1163565611 19:18049485-18049507 CCTAAACGTCACCTCCGGTCCCC No data
Right 1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG No data
1163565620_1163565628 1 Left 1163565620 19:18049511-18049533 CCCGGCTTGCACCGGGCAGCAGC No data
Right 1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG No data
1163565622_1163565628 -10 Left 1163565622 19:18049522-18049544 CCGGGCAGCAGCCAACACCACGG No data
Right 1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG No data
1163565621_1163565628 0 Left 1163565621 19:18049512-18049534 CCGGCTTGCACCGGGCAGCAGCC No data
Right 1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG No data
1163565610_1163565628 28 Left 1163565610 19:18049484-18049506 CCCTAAACGTCACCTCCGGTCCC No data
Right 1163565628 19:18049535-18049557 AACACCACGGGGAAGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163565628 Original CRISPR AACACCACGGGGAAGTGGCC TGG Intergenic
No off target data available for this crispr