ID: 1163572635

View in Genome Browser
Species Human (GRCh38)
Location 19:18091303-18091325
Sequence TTATCTCAGACGAGCTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 240}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163572635_1163572648 21 Left 1163572635 19:18091303-18091325 CCCCAGAAGCTCGTCTGAGATAA 0: 1
1: 0
2: 0
3: 4
4: 240
Right 1163572648 19:18091347-18091369 TCAGGTGCCCCACAGACTCGGGG 0: 1
1: 0
2: 1
3: 8
4: 100
1163572635_1163572641 3 Left 1163572635 19:18091303-18091325 CCCCAGAAGCTCGTCTGAGATAA 0: 1
1: 0
2: 0
3: 4
4: 240
Right 1163572641 19:18091329-18091351 CCCAGGGCTGCCCCACTTTCAGG 0: 1
1: 0
2: 3
3: 34
4: 318
1163572635_1163572646 19 Left 1163572635 19:18091303-18091325 CCCCAGAAGCTCGTCTGAGATAA 0: 1
1: 0
2: 0
3: 4
4: 240
Right 1163572646 19:18091345-18091367 TTTCAGGTGCCCCACAGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 124
1163572635_1163572651 26 Left 1163572635 19:18091303-18091325 CCCCAGAAGCTCGTCTGAGATAA 0: 1
1: 0
2: 0
3: 4
4: 240
Right 1163572651 19:18091352-18091374 TGCCCCACAGACTCGGGGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 165
1163572635_1163572650 25 Left 1163572635 19:18091303-18091325 CCCCAGAAGCTCGTCTGAGATAA 0: 1
1: 0
2: 0
3: 4
4: 240
Right 1163572650 19:18091351-18091373 GTGCCCCACAGACTCGGGGGCGG 0: 1
1: 0
2: 1
3: 9
4: 101
1163572635_1163572649 22 Left 1163572635 19:18091303-18091325 CCCCAGAAGCTCGTCTGAGATAA 0: 1
1: 0
2: 0
3: 4
4: 240
Right 1163572649 19:18091348-18091370 CAGGTGCCCCACAGACTCGGGGG 0: 1
1: 0
2: 1
3: 13
4: 125
1163572635_1163572647 20 Left 1163572635 19:18091303-18091325 CCCCAGAAGCTCGTCTGAGATAA 0: 1
1: 0
2: 0
3: 4
4: 240
Right 1163572647 19:18091346-18091368 TTCAGGTGCCCCACAGACTCGGG 0: 1
1: 0
2: 1
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163572635 Original CRISPR TTATCTCAGACGAGCTTCTG GGG (reversed) Intronic
902767225 1:18625375-18625397 TTATCACAGTGGAGCATCTGTGG - Intergenic
917084081 1:171288165-171288187 TTAAACCAGAAGAGCTTCTGAGG + Intergenic
917084084 1:171288212-171288234 TTAAATCAGAAGAGCTTCTGAGG + Intergenic
918485188 1:185021572-185021594 CTATCTCAGACTGGTTTCTGTGG - Intergenic
921032806 1:211348907-211348929 TTATCTTAGACCAGGTGCTGTGG + Intronic
1063759715 10:9058974-9058996 TTAACTCAGATTGGCTTCTGTGG - Intergenic
1065181404 10:23129725-23129747 TTATCTAAGATGTGGTTCTGGGG + Intergenic
1071991398 10:91103884-91103906 TTATCTCACAAGAGCAGCTGTGG + Intergenic
1074238615 10:111612309-111612331 TTATCTCAAAAAAGCATCTGAGG - Intergenic
1075975520 10:126690775-126690797 TTGTCTCAGATGAGCCTCAGAGG + Intergenic
1077680385 11:4235034-4235056 TTATTTCAAAGCAGCTTCTGTGG - Intergenic
1077684666 11:4280452-4280474 TTATTTCAAAGCAGCTTCTGTGG - Intergenic
1077690528 11:4337478-4337500 TTATTTCAAAGCAGCTTCTGTGG + Intergenic
1078257715 11:9674210-9674232 TTTTCTGAGACCTGCTTCTGAGG + Intronic
1081366138 11:42237788-42237810 TTCTCACAGAAGAGCTTCTAGGG + Intergenic
1084380805 11:68811521-68811543 TTGTCTCACAGAAGCTTCTGGGG + Intronic
1084486303 11:69450271-69450293 TGCTCTCAGAGGAGCTTCCGAGG + Intergenic
1085215428 11:74826574-74826596 TTATCTCAGATGAGACTTTGGGG - Intronic
1087026831 11:93658433-93658455 TTCTTTCAGACCAGCTTGTGGGG + Intergenic
1087585613 11:100116891-100116913 TTATCCCAAAAGAGCTTCTTGGG - Intronic
1094282381 12:28754406-28754428 TTATCTCAGATGAGACTTTGGGG - Intergenic
1104055644 12:125228074-125228096 TTGTCTCAGATCTGCTTCTGGGG + Intronic
1109124333 13:58501007-58501029 TTATCTCAGGCATGCCTCTGTGG + Intergenic
1111859330 13:93682152-93682174 TTATCTCAGAAGAGTTTCCCAGG + Intronic
1115344083 14:32323548-32323570 TTATCTCAAACTAGCTACTAAGG - Intergenic
1116048255 14:39771198-39771220 TTATCCCTGACGAGCTTCCAGGG - Intergenic
1117926871 14:60790329-60790351 TTGTCTCAGATGAGCCTCAGAGG - Intronic
1120843273 14:89105363-89105385 GTAACTCAGAAGAGCATCTGTGG + Intergenic
1125349485 15:38752446-38752468 TAATCTCATTTGAGCTTCTGAGG - Intergenic
1126482641 15:49143118-49143140 TTATCAGAGAAGAGCTTCTGAGG + Intronic
1127284321 15:57519229-57519251 GTATCTCAGGTGAGTTTCTGAGG + Intronic
1132172727 15:99677934-99677956 TGATCTCATACGTGCTTTTGTGG + Intronic
1141161252 16:81630558-81630580 TTTTCTCACAGAAGCTTCTGTGG + Intronic
1141215536 16:82019926-82019948 TTATTCCAGAATAGCTTCTGTGG + Intergenic
1141348527 16:83271181-83271203 TTTTCTTTGAGGAGCTTCTGGGG - Intronic
1145448064 17:23203688-23203710 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145448417 17:23208954-23208976 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145449772 17:23228986-23229008 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145450792 17:23243914-23243936 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145453347 17:23281232-23281254 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145453893 17:23289214-23289236 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145455714 17:23315683-23315705 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145455897 17:23318398-23318420 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145459041 17:23364389-23364411 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145460549 17:23386262-23386284 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145461434 17:23399157-23399179 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145462640 17:23416631-23416653 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145462828 17:23419349-23419371 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145463171 17:23424269-23424291 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145463625 17:23430883-23430905 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145466972 17:23479400-23479422 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145467157 17:23482117-23482139 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145467527 17:23487550-23487572 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145468547 17:23502304-23502326 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145470122 17:23525198-23525220 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145475878 17:23608673-23608695 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145476711 17:23620888-23620910 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145478642 17:23649059-23649081 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145479168 17:23656695-23656717 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145481257 17:23686717-23686739 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145485467 17:23747945-23747967 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145488089 17:23786119-23786141 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145489873 17:23812067-23812089 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145491429 17:23834641-23834663 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145492562 17:23851090-23851112 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145493632 17:23866871-23866893 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145493817 17:23869586-23869608 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145494345 17:23877220-23877242 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145496024 17:23901653-23901675 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145496738 17:23912180-23912202 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145499549 17:23953233-23953255 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145499922 17:23958664-23958686 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145500104 17:23961380-23961402 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145500967 17:23973932-23973954 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145501153 17:23976648-23976670 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145501824 17:23986483-23986505 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145502872 17:24001751-24001773 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145503519 17:24011076-24011098 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145505465 17:24039411-24039433 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145508017 17:24076551-24076573 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145508201 17:24079266-24079288 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145511458 17:24126592-24126614 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145512327 17:24139144-24139166 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145514331 17:24168149-24168171 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145515324 17:24182575-24182597 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145515498 17:24185124-24185146 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145517315 17:24211434-24211456 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145517687 17:24216865-24216887 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145518387 17:24227050-24227072 TAATCACAGAGAAGCTTCTGAGG - Intergenic
1145519334 17:24240785-24240807 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145519993 17:24250456-24250478 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145520179 17:24253171-24253193 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145522266 17:24283548-24283570 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145523464 17:24300856-24300878 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145523829 17:24306287-24306309 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145524511 17:24316132-24316154 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145528886 17:24380080-24380102 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145536882 17:24496276-24496298 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145538310 17:24517128-24517150 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145539454 17:24533746-24533768 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145539641 17:24536460-24536482 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145540316 17:24546297-24546319 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145540502 17:24549012-24549034 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145540838 17:24553932-24553954 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145543297 17:24589551-24589573 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145544423 17:24605997-24606019 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145546217 17:24631947-24631969 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145547855 17:24656043-24656065 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145548704 17:24668428-24668450 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145549688 17:24682846-24682868 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145550479 17:24694382-24694404 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145556611 17:24783272-24783294 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145558374 17:24808879-24808901 TAATCACAGAGAAGCTTCTGAGG - Intergenic
1145558839 17:24815669-24815691 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145561858 17:24859605-24859627 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145562398 17:24867406-24867428 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145562887 17:24874526-24874548 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145564772 17:24902008-24902030 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145571223 17:24995619-24995641 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145571781 17:25003765-25003787 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145571965 17:25006480-25006502 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145574909 17:25049391-25049413 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145575732 17:25061433-25061455 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145575916 17:25064147-25064169 TAATCACAGAGAAGCTTCTGAGG - Intergenic
1145578264 17:25098231-25098253 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145580611 17:25132176-25132198 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145583207 17:25169841-25169863 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145588394 17:25245020-25245042 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145588548 17:25247223-25247245 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145588861 17:25251794-25251816 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145593357 17:25317277-25317299 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145595085 17:25342732-25342754 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145601163 17:25431817-25431839 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145601653 17:25438939-25438961 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145604681 17:25483053-25483075 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145604858 17:25485600-25485622 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145606048 17:25502908-25502930 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145608183 17:25533963-25533985 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145610499 17:25567382-25567404 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145611315 17:25579268-25579290 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145614518 17:25626099-25626121 TCATCACAGAAAAGCTTCTGAGG - Intergenic
1145615583 17:25641714-25641736 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145617715 17:25672942-25672964 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145617876 17:25675314-25675336 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145619874 17:25704388-25704410 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145621641 17:25730184-25730206 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145629646 17:25846359-25846381 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145632368 17:25886073-25886095 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145634018 17:25910172-25910194 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145634194 17:25912722-25912744 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145637204 17:25955514-25955536 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145639067 17:25982500-25982522 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145647507 17:26105518-26105540 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145650365 17:26146908-26146930 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145650937 17:26155223-26155245 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145651129 17:26157937-26157959 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145653004 17:26184923-26184945 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145653754 17:26195779-26195801 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145654311 17:26203926-26203948 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145655248 17:26217501-26217523 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145656925 17:26241761-26241783 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145658217 17:26260597-26260619 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145658401 17:26263314-26263336 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145661014 17:26301350-26301372 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145661392 17:26306778-26306800 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145662318 17:26320180-26320202 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145669119 17:26419297-26419319 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145670029 17:26432373-26432395 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145673922 17:26489229-26489251 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145674299 17:26494662-26494684 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145676884 17:26532349-26532371 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145678559 17:26556627-26556649 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1145679115 17:26564775-26564797 TCATCACAGAGAAGCTTCTGAGG - Intergenic
1146466114 17:33088090-33088112 TCATCTAAGACAAGTTTCTGGGG - Intronic
1147508220 17:41041369-41041391 TGCTGTCAGACCAGCTTCTGTGG - Exonic
1148319384 17:46737471-46737493 TTAGCTCATACGAGGTGCTGGGG + Intronic
1150258884 17:63772691-63772713 TTATCTCAGAAGTGTTTCTATGG - Intronic
1152527937 17:80900186-80900208 TTCTCTCAGCCGGGCATCTGTGG + Intronic
1155986480 18:32235937-32235959 TTATTTCAGACTAGCTTGGGAGG + Intronic
1156495437 18:37522663-37522685 TTGTTTGAGACGAGCTTCAGTGG + Intronic
1157194353 18:45608666-45608688 TTACCTCAGTCAAGCTTCAGAGG + Intronic
1159119170 18:64149418-64149440 TTTTCTCAGGAGAGATTCTGGGG + Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1163572635 19:18091303-18091325 TTATCTCAGACGAGCTTCTGGGG - Intronic
1166051646 19:40264226-40264248 TTGTCCCAGGCCAGCTTCTGTGG - Intronic
1166103674 19:40586936-40586958 TCATCTCAGGTGAGCCTCTGTGG + Exonic
1166920425 19:46225493-46225515 TTTTCACAGAGGAGGTTCTGTGG + Intergenic
925397204 2:3543538-3543560 TTAGCTCAGACTAGCTTATTCGG - Intronic
926369972 2:12169862-12169884 TCATCTCAGACCCGCTTCTGAGG + Intergenic
928290084 2:30029335-30029357 ATAGCTCAGGGGAGCTTCTGGGG - Intergenic
930119779 2:47750994-47751016 TTGTCTCAGACCAGGTTCTGTGG - Intronic
933599167 2:84312404-84312426 AGATCTCAGATAAGCTTCTGAGG - Intergenic
939245250 2:139615301-139615323 TTATCTTAGACTAGGGTCTGGGG - Intergenic
944512942 2:200482492-200482514 ACAGCTCAGAGGAGCTTCTGGGG + Intergenic
945072375 2:206004588-206004610 TTACCACAGACCAGCTTCAGTGG - Exonic
945277210 2:208000030-208000052 TTATCTCAAAGGAAATTCTGGGG + Intronic
945981674 2:216317234-216317256 TTATCTCATAGAAGTTTCTGGGG + Intronic
947980512 2:234404745-234404767 TTATATTAGACGAGCCTGTGTGG + Intergenic
1169369493 20:5017742-5017764 TTATCTCAGATCTGCTTCTAGGG - Intergenic
1173242649 20:41311298-41311320 TTATCTCATAGGATCTTTTGAGG - Intronic
1174367493 20:50065334-50065356 TTATCTGAGCAGAGCTTCAGTGG + Intergenic
1178161821 21:29926504-29926526 TTATTTCAGTTAAGCTTCTGGGG + Intronic
1181344804 22:22211294-22211316 TTCTCTCTGACCAGCTACTGTGG - Intergenic
1182401022 22:30078127-30078149 TTTCCTCCGAAGAGCTTCTGTGG - Intergenic
1184751629 22:46489573-46489595 TTCTCTCATACCAGCTCCTGGGG + Intronic
950157720 3:10736223-10736245 TTATCTCAGCTGAGCTTGAGGGG + Intergenic
950968188 3:17161109-17161131 TTTTCCCAGAGGTGCTTCTGAGG + Exonic
958550375 3:95604992-95605014 TTATCTCAGACCATGTTCTAGGG - Intergenic
959317929 3:104832942-104832964 TCAGCTCAGCCGAGCTTCTCTGG - Intergenic
960528042 3:118732815-118732837 TCCTCTCAGACCTGCTTCTGTGG - Intergenic
962421005 3:135229241-135229263 TTATCTCAGAGGGGCGTATGAGG - Intronic
962716395 3:138129436-138129458 TTGCCTCTGACAAGCTTCTGTGG - Intronic
965203854 3:165695454-165695476 TTACCTCAGAGGGGCTTATGTGG - Intergenic
970284187 4:14491045-14491067 TTGTCTCTGAAGAGTTTCTGTGG - Intergenic
970994041 4:22245592-22245614 TTTTCTGAGACCTGCTTCTGAGG - Intergenic
971452165 4:26810308-26810330 TTGTCTCAGAATCGCTTCTGTGG + Intergenic
974082804 4:57230407-57230429 TTGTCTCAGATGAGCCTCAGAGG + Intergenic
979400093 4:120238593-120238615 TTATGGCAGTTGAGCTTCTGAGG + Intergenic
980490502 4:133520114-133520136 TTATCTTATACCAGGTTCTGTGG - Intergenic
989189444 5:38655713-38655735 TTAACTCAGTCTAGCTTCTCTGG - Intergenic
995638466 5:114223766-114223788 TGAACTAAGACGAACTTCTGAGG + Intergenic
997283240 5:132661562-132661584 TTACCTCAGATGAGGCTCTGAGG - Intergenic
1000958812 5:167574479-167574501 TTATTTAAGTCGAGCTACTGGGG + Intronic
1001673924 5:173496973-173496995 TTATCTCTGGCCAGCCTCTGTGG - Intergenic
1007480897 6:42149147-42149169 TTATCGCAGATCAGCTCCTGAGG + Intergenic
1007524409 6:42479448-42479470 ACATCCCAGAGGAGCTTCTGGGG + Intergenic
1010317024 6:74463610-74463632 TTATCTCAGGTGAGCCTCAGAGG + Intergenic
1013984047 6:116168529-116168551 TTATACCATAGGAGCTTCTGTGG + Intronic
1023395661 7:39749651-39749673 TGATCTCAGGCAAACTTCTGAGG + Intergenic
1025849249 7:65232428-65232450 TTGTCTCAGATGAGCCTCAGAGG + Intergenic
1031067975 7:117128035-117128057 ATATTTCAGATGAGATTCTGTGG + Intronic
1032710041 7:134453218-134453240 TTTTCTCTGAGGAGCTGCTGAGG + Intronic
1034028128 7:147730135-147730157 TTACCTCAAAAGATCTTCTGTGG - Intronic
1038063788 8:23940382-23940404 TAATCCAAGTCGAGCTTCTGGGG - Intergenic
1042792173 8:72620496-72620518 TTATCACAGACAAGATTCAGAGG - Intronic
1045904918 8:107333321-107333343 TTATCTCACATGTGGTTCTGGGG - Intronic
1047785292 8:128148503-128148525 TAATCTCAGAAGAGCTTTGGAGG + Intergenic
1048416340 8:134231532-134231554 TTATCTTAGTCCAGCTTCTCTGG - Intergenic
1049494007 8:142921158-142921180 CAATCCCAGAAGAGCTTCTGGGG - Intergenic
1052595388 9:30551201-30551223 TTATCTTAGAAGAGCATTTGAGG + Intergenic
1189674492 X:43447137-43447159 TTTCCTCAGACTAGCTTCTAAGG - Intergenic
1196862360 X:120040193-120040215 TTATCTCAGCCGAGGTGATGGGG + Intergenic
1196880742 X:120196151-120196173 TTATCTCAGCCGAGGTGATGGGG - Intergenic
1197777193 X:130126139-130126161 TTATCACAGACCAGCTATTGAGG + Intergenic
1199574651 X:149301776-149301798 TTCTCTCACACAAGCTTGTGGGG - Intergenic