ID: 1163572950

View in Genome Browser
Species Human (GRCh38)
Location 19:18093582-18093604
Sequence CTGGAATCCTGGGGAAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 1, 2: 2, 3: 49, 4: 412}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163572950_1163572954 -10 Left 1163572950 19:18093582-18093604 CCTCTCTTTCCCCAGGATTCCAG 0: 1
1: 1
2: 2
3: 49
4: 412
Right 1163572954 19:18093595-18093617 AGGATTCCAGTCAAAGCCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 140
1163572950_1163572959 5 Left 1163572950 19:18093582-18093604 CCTCTCTTTCCCCAGGATTCCAG 0: 1
1: 1
2: 2
3: 49
4: 412
Right 1163572959 19:18093610-18093632 GCCCCAGGGAGGGCTCTGATAGG 0: 1
1: 1
2: 6
3: 47
4: 424
1163572950_1163572963 15 Left 1163572950 19:18093582-18093604 CCTCTCTTTCCCCAGGATTCCAG 0: 1
1: 1
2: 2
3: 49
4: 412
Right 1163572963 19:18093620-18093642 GGGCTCTGATAGGCTGAGCTTGG 0: 1
1: 0
2: 4
3: 41
4: 686
1163572950_1163572955 -9 Left 1163572950 19:18093582-18093604 CCTCTCTTTCCCCAGGATTCCAG 0: 1
1: 1
2: 2
3: 49
4: 412
Right 1163572955 19:18093596-18093618 GGATTCCAGTCAAAGCCCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1163572950_1163572956 -6 Left 1163572950 19:18093582-18093604 CCTCTCTTTCCCCAGGATTCCAG 0: 1
1: 1
2: 2
3: 49
4: 412
Right 1163572956 19:18093599-18093621 TTCCAGTCAAAGCCCCAGGGAGG 0: 1
1: 1
2: 0
3: 19
4: 187
1163572950_1163572964 16 Left 1163572950 19:18093582-18093604 CCTCTCTTTCCCCAGGATTCCAG 0: 1
1: 1
2: 2
3: 49
4: 412
Right 1163572964 19:18093621-18093643 GGCTCTGATAGGCTGAGCTTGGG 0: 1
1: 1
2: 2
3: 34
4: 239
1163572950_1163572957 -5 Left 1163572950 19:18093582-18093604 CCTCTCTTTCCCCAGGATTCCAG 0: 1
1: 1
2: 2
3: 49
4: 412
Right 1163572957 19:18093600-18093622 TCCAGTCAAAGCCCCAGGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163572950 Original CRISPR CTGGAATCCTGGGGAAAGAG AGG (reversed) Intronic
900014869 1:141073-141095 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
900045135 1:499682-499704 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
900067332 1:741412-741434 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
900543059 1:3213669-3213691 CTGGAATCCTGGGGAAATGCTGG - Intronic
900735794 1:4298680-4298702 CTGGGATGGTGGGGAAAGAAAGG + Intergenic
901806214 1:11740243-11740265 CTGGCAGCCCAGGGAAAGAGGGG - Intronic
902530052 1:17085244-17085266 CTGGAACCCAAGGGAAAGTGAGG + Intronic
902577687 1:17388704-17388726 CCGGAACCCTGGGGTAAGAGGGG + Intronic
903317074 1:22516387-22516409 CTGGAGTTCTGGGGAAAGGTGGG + Intronic
903793935 1:25914089-25914111 CTGGAGTCCTGGGTATTGAGAGG - Intergenic
903856299 1:26339422-26339444 CTGTAGTCCTGTGGAAGGAGGGG + Exonic
903930893 1:26861991-26862013 CTAGCAACCTGGGGAGAGAGAGG - Intergenic
904622399 1:31783197-31783219 CAGGAATCCTGGGGAAGCAGAGG + Intergenic
904743236 1:32694810-32694832 CTTTTAACCTGGGGAAAGAGTGG - Intronic
904812592 1:33173036-33173058 CTGGCATCCTTGGGTCAGAGAGG - Intronic
905856010 1:41314635-41314657 CTGGAATCCTGAGGAAGAAATGG - Intergenic
905879899 1:41456681-41456703 CTGGGTGCCTGGGGAGAGAGAGG + Intergenic
905920119 1:41713813-41713835 CTGGAATGCAGGGAAATGAGTGG + Intronic
906075861 1:43051694-43051716 CTGTAAACCATGGGAAAGAGGGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908339470 1:63161750-63161772 CTGGCATCCTGGGGCATGGGTGG + Intergenic
910214176 1:84825589-84825611 CTGGAGACCTGGAGAAGGAGCGG - Intronic
910765406 1:90777389-90777411 CAGGCATCCTGGGGATAGAATGG - Intergenic
912804062 1:112742172-112742194 CTGGAATTCGAGAGAAAGAGAGG + Intergenic
912971797 1:114290509-114290531 CTGGAAGCCAGTGGAAATAGAGG + Intergenic
913016511 1:114742154-114742176 CAGGTATTCTGAGGAAAGAGTGG + Intronic
913107664 1:115629429-115629451 CTGGGATACGGGGGAGAGAGTGG - Intergenic
913681614 1:121191207-121191229 TTGGTATCCTGGGGGAAGTGGGG - Intronic
914033449 1:143978844-143978866 TTGGTATCCTGGGGGAAGTGGGG - Intergenic
916171087 1:162002238-162002260 CTGGAGTCCTGGGGAGAGCAGGG - Intronic
916861520 1:168810980-168811002 CTGTATTTATGGGGAAAGAGAGG + Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
918005925 1:180542210-180542232 CTGGAGTCTGGGGGAAAGAGAGG + Intergenic
918064536 1:181090175-181090197 CTTAAACCCTGGGGAAGGAGTGG - Exonic
918117503 1:181509450-181509472 CTGGAATCCAGGCAGAAGAGAGG - Intronic
919331795 1:196181566-196181588 CTGGCATCCCAGGGAAAGTGGGG - Intergenic
920068635 1:203287126-203287148 CTGGAGGCCAGGGGAAAGATCGG - Intergenic
920103096 1:203530198-203530220 CAGGAATCCTGGGCTTAGAGTGG - Intergenic
920468930 1:206209725-206209747 TTGGTATCCTGGGGGAAGTGGGG - Intronic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
920838704 1:209535753-209535775 GTGGCAGCCTGGGGAAAGACGGG + Intergenic
920974869 1:210776337-210776359 GTGGAATGCTAGGGATAGAGAGG - Intronic
924063940 1:240205244-240205266 CTGGAATAAAAGGGAAAGAGAGG - Intronic
1062923868 10:1299785-1299807 TTGGGCTCCTGGGCAAAGAGAGG + Intronic
1064019457 10:11797457-11797479 CTGAAATCCTGGGGGAAATGAGG + Intergenic
1065052598 10:21811053-21811075 CTGCATTCCTGGGGAAAGTAGGG - Intronic
1066058094 10:31699856-31699878 CTGGGAACCTGGGGAAGGAGTGG + Intergenic
1066411857 10:35178626-35178648 CAGAAATACTAGGGAAAGAGTGG - Intronic
1068804510 10:61180061-61180083 TTAGAACCCTGGGGAAAGTGAGG - Intergenic
1069794067 10:71041253-71041275 CTGGCCTCCTGGGGACCGAGCGG + Intergenic
1069898967 10:71696137-71696159 CCAGAATCCTGGGGAAACTGAGG + Intronic
1069952969 10:72032322-72032344 CTGGAGTCCTGGGGCCTGAGAGG - Intergenic
1070472172 10:76792091-76792113 CTGGAATACTTTTGAAAGAGAGG + Intergenic
1070688070 10:78504505-78504527 CTGGGATCCTGGGAAAAGCATGG + Intergenic
1071048091 10:81408597-81408619 TTGGGATCCTGGGCAGAGAGAGG - Intergenic
1071836512 10:89423678-89423700 CTGGAGTCCTGGGAGAAAAGGGG - Intergenic
1072633734 10:97164358-97164380 CTGGAGGCCTGGGGGCAGAGGGG + Intronic
1074142740 10:110689280-110689302 CTGGAGGCCTGGGGACACAGGGG + Intronic
1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG + Intergenic
1074459709 10:113625895-113625917 CTGGAAGCCTGGGGAAAGCTGGG + Intronic
1074687240 10:115972186-115972208 GTGGAGACCTGGGGACAGAGGGG + Intergenic
1074828131 10:117229153-117229175 AGGGAATGCTGGGGAAGGAGGGG + Intergenic
1074828587 10:117232281-117232303 AGGGAATGCTGGGGAAGGAGGGG + Intergenic
1075567320 10:123514063-123514085 CTGGAGTCCTGGGGAAGGGGAGG + Intergenic
1076702032 10:132278322-132278344 CTGTAATCCTGCAGCAAGAGAGG + Intronic
1076971464 11:136173-136195 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
1078069729 11:8100622-8100644 CTAGGATGATGGGGAAAGAGGGG - Intronic
1078545929 11:12246973-12246995 CTGGAATGCTGGGGAGGGAAGGG + Intronic
1078901855 11:15649946-15649968 CTGGACCCCTGGGGACACAGGGG - Intergenic
1079014985 11:16861200-16861222 CTGTTCTCCTGGGGAAAGAATGG - Intronic
1079304556 11:19310881-19310903 CTGGAATCCTGTGGATACCGAGG + Intergenic
1081618162 11:44602769-44602791 CTGGGATCCTGGGGGGAGACAGG + Intronic
1081672268 11:44949067-44949089 CTGGGATGGTGGGGACAGAGGGG + Intronic
1082009603 11:47441393-47441415 CTGGAACCCTGGGTAAACTGAGG - Intronic
1082216971 11:49583161-49583183 AAGGAACCCTGGGGAATGAGAGG + Intergenic
1082254819 11:50022097-50022119 TTGGAATGCTAGGGAAAGAGAGG + Intergenic
1082789816 11:57339358-57339380 CTGGATTCCTGGGGAGGGAGCGG - Intronic
1083156554 11:60826962-60826984 CTCTCATCCTAGGGAAAGAGAGG + Intergenic
1085363619 11:75916523-75916545 CTAGAATGCTGGGGAGAGAAAGG - Intronic
1085778350 11:79386151-79386173 GTGGTACCGTGGGGAAAGAGTGG + Intronic
1086124792 11:83339321-83339343 CTGGAAACCTGGGGGAAGAGGGG + Intergenic
1086632581 11:89041005-89041027 AAGGAATGCTGGGGAATGAGAGG - Intronic
1086949852 11:92880716-92880738 CTGATAGCCTGGGGAAACAGAGG - Exonic
1087192393 11:95268624-95268646 CTGGAATGCAGGGAAAAGAAGGG + Intergenic
1087236732 11:95727693-95727715 CTTCAATCCTGGGGAAAGCAGGG + Intergenic
1088540465 11:110908443-110908465 CTGGAATTGTGGGGACACAGGGG - Intergenic
1089054916 11:115577778-115577800 CTGGAATGCTCAGAAAAGAGGGG + Intergenic
1090081774 11:123618412-123618434 CTGGGCACCTGGGGGAAGAGAGG - Intronic
1090442727 11:126737440-126737462 CTGGGGGCCTGGGGAAGGAGTGG + Intronic
1091103187 11:132894819-132894841 CTGAAAACCTGGGGTAGGAGTGG - Intronic
1091139146 11:133220490-133220512 CTGGAGTCCTGGGGAGTCAGAGG + Intronic
1091203559 11:133801259-133801281 GCCGAATTCTGGGGAAAGAGTGG + Intergenic
1091972984 12:4803910-4803932 ATTGAATCCTGGGGAAGAAGGGG - Intronic
1091980503 12:4860484-4860506 CTGAAGTCCTGGGTGAAGAGGGG + Intergenic
1092125713 12:6073845-6073867 CTGGAAGCCTGAAGACAGAGGGG - Intronic
1092187270 12:6489910-6489932 CTTGAATCCGGGAGACAGAGAGG - Intergenic
1094150874 12:27281515-27281537 CTGGAAACCAGGGCACAGAGAGG - Intronic
1094329210 12:29273678-29273700 CTGAACTCCTGGGGGCAGAGGGG - Intronic
1095246219 12:39925857-39925879 CTGTATTACTGGGGAAAGACTGG - Intronic
1096668332 12:53181499-53181521 CTGGTCTCCTGGGCAAGGAGTGG - Intronic
1096880814 12:54668304-54668326 CTGGATTCCTGAGGACAGCGGGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097362454 12:58672757-58672779 CTGCAAGCCTGGGGAAAGGAAGG - Intronic
1097607574 12:61774655-61774677 CAGGGATTCGGGGGAAAGAGTGG + Intronic
1098070293 12:66667567-66667589 CTGTTATCCTGGGGAAAAAGTGG - Intronic
1098592835 12:72233825-72233847 GTGGAATCTTGGGAAAAAAGTGG - Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101317820 12:103645395-103645417 CTGCAATCCTTAGGAAAGAAAGG + Intronic
1101569937 12:105944422-105944444 CTGATATCCTGGGGAAACATTGG - Intergenic
1101672434 12:106888558-106888580 CTGAAATGCTGGGAACAGAGTGG + Intronic
1102442681 12:112975497-112975519 GTGGAACCCTGGAGTAAGAGAGG + Intergenic
1102982122 12:117250256-117250278 CTGGAATTCTGGGGAAAGGAGGG - Intronic
1104489929 12:129184828-129184850 CTGGGTTCCAGGGGAAAGAAAGG + Intronic
1104711560 12:130990514-130990536 CTGGAATCCTTGGGCTAGAGGGG + Intronic
1104830440 12:131747344-131747366 CTGGCATCATGGGGACAGGGAGG + Intronic
1105561122 13:21491678-21491700 ATGGAATGCTGTGGAAAGTGGGG + Intergenic
1105820400 13:24076266-24076288 CTGAACTCCTGGGAAATGAGTGG + Intronic
1106933847 13:34696607-34696629 CTGGAGTGCTGGGAATAGAGTGG - Intergenic
1107101655 13:36599836-36599858 CAGGAATGAAGGGGAAAGAGAGG + Intergenic
1107118815 13:36776404-36776426 ATGCAATCCAGTGGAAAGAGGGG + Intergenic
1107878131 13:44808375-44808397 CTTGCATCCAGGGGAGAGAGAGG + Intergenic
1108187339 13:47901394-47901416 TTGGTTGCCTGGGGAAAGAGAGG - Intergenic
1109859969 13:68184603-68184625 TTGGAATCCTTTTGAAAGAGTGG + Intergenic
1111554567 13:89863434-89863456 CTGGAAACCAGTGGAATGAGAGG - Intergenic
1113215873 13:108040072-108040094 CCAGAATTCTGAGGAAAGAGCGG - Intergenic
1114259611 14:21026808-21026830 CTGGCATCCAGAGGGAAGAGGGG - Intronic
1114664633 14:24370258-24370280 GTGGCAGCCTGGGGGAAGAGGGG + Exonic
1114679906 14:24475583-24475605 CTTGAAACCTGGGAAGAGAGTGG - Intergenic
1116626592 14:47272591-47272613 CTGGAGTACTAGGGAAAAAGTGG - Intronic
1116763006 14:49038209-49038231 CTGGATCCCTAGGGAAAGACTGG + Intergenic
1116867215 14:50040493-50040515 GTGGTAACATGGGGAAAGAGAGG + Intergenic
1117290264 14:54325475-54325497 CTGGCATCCTAAGGAAAGAGAGG + Intergenic
1117787069 14:59297139-59297161 CTAGAATCATGGGGGAAGAATGG - Intronic
1118206273 14:63727137-63727159 GTGAAAACCTGTGGAAAGAGAGG + Intronic
1119442676 14:74638828-74638850 CTGGAAATCTGGGGAAACTGAGG - Intergenic
1120498023 14:85260417-85260439 CTGGAATCCTGAGGGAGAAGAGG + Intergenic
1121497460 14:94404002-94404024 TTGGAAATCTGAGGAAAGAGAGG + Intergenic
1121759413 14:96432173-96432195 TTGCAATCCTGGGGAGAGAGAGG - Intronic
1122150106 14:99721001-99721023 CTTGAATCCTGGGGGGAGGGCGG + Intronic
1122823514 14:104358835-104358857 CTGGAATCGTGGTGACAGGGTGG + Intergenic
1122875859 14:104664571-104664593 GTGGAATCATGGGGAATGTGGGG - Intergenic
1122891380 14:104733732-104733754 CTGGGGTCCTGGGGACAGAGTGG + Intronic
1124784205 15:32664131-32664153 CTGGAATCATGGGACAAGATGGG + Intronic
1125172670 15:36783957-36783979 CTGGAAACCTGTGGAAAGTCAGG - Intronic
1125428604 15:39574627-39574649 CTGGAATCCTGGGCTAGGTGTGG - Intergenic
1125444801 15:39742900-39742922 GTGTAAGCCTGGGGAGAGAGGGG + Intronic
1125503575 15:40253747-40253769 CTGGAGATCTGGGGAATGAGCGG - Intronic
1125606090 15:40940810-40940832 CTGGCTTTCTGGGGAAAGTGGGG + Intergenic
1125898043 15:43319108-43319130 CTGGCTTCCTGGGGAAGGATAGG - Intergenic
1128349928 15:66881790-66881812 CTGGAGGCCTGGGGACAGGGTGG + Intergenic
1128612131 15:69082669-69082691 GTGGAATCCTGGGGAAGGCAGGG - Intergenic
1128741337 15:70085870-70085892 CAGAAGTCCTGGGGAAAGACAGG - Intronic
1129122999 15:73414324-73414346 CTGGGACCCTGGGGAAAAGGAGG - Intergenic
1129767675 15:78180714-78180736 CGGGAGGCCTGGGGAGAGAGTGG - Intronic
1131099941 15:89680139-89680161 CTTGAGTCCTGGGTAAAGAAGGG - Intronic
1131562218 15:93454723-93454745 TTGAAATGCTGGGGAAGGAGGGG - Intergenic
1132102737 15:99036621-99036643 CAGGAATCCTGGGGAAAGAGAGG + Intergenic
1134824604 16:17274511-17274533 GTGGAATTCTGAGAAAAGAGAGG + Intronic
1135343846 16:21670967-21670989 CAGGAACCTTGGGGAATGAGGGG + Intergenic
1135720576 16:24814207-24814229 CTTGAAGCCAGAGGAAAGAGTGG + Intronic
1135956605 16:26961393-26961415 CTTGAAAACTGAGGAAAGAGAGG + Intergenic
1137441702 16:48503866-48503888 CAGGCATCCTGGGGAAGGAGTGG - Intergenic
1137754873 16:50893352-50893374 CTGGAATCCTGGAGGAGGGGAGG + Intergenic
1138652647 16:58470296-58470318 CTGGAGTCCAGTGGACAGAGAGG + Intronic
1141166477 16:81664254-81664276 CTGCAGTGCTGGGGACAGAGTGG - Exonic
1141689315 16:85587508-85587530 CTGGGCTCCTGGGGACACAGCGG + Intergenic
1141929540 16:87192785-87192807 CTGGAAACCTCGGGACAGGGCGG + Intronic
1142003825 16:87679772-87679794 CTGGAGAACTGGGGTAAGAGAGG - Intronic
1142228230 16:88887702-88887724 CTGGGCTCCTGGGGACAGAGTGG - Intronic
1142328105 16:89431553-89431575 GTGGAAGCCTGGGAAGAGAGTGG - Intronic
1142413222 16:89926469-89926491 TTGGGGTCCTGGGGAAAGCGGGG - Intronic
1142448787 16:90161349-90161371 CTGAACTCCAGGGGGAAGAGGGG - Intergenic
1142458700 17:73940-73962 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
1142493408 17:293063-293085 CCGGAAGCCTTGGTAAAGAGAGG - Intronic
1142567962 17:852854-852876 TAGGCATCCTGGGGAAACAGTGG - Intronic
1142808130 17:2382282-2382304 CTGGGATCCTGGGACCAGAGGGG + Intergenic
1142878421 17:2866336-2866358 GTTGAATGCTGGGGAAAGAAGGG + Intronic
1144208780 17:12997547-12997569 CTGAGATCCTGGGGGAAGAAGGG - Intronic
1144726459 17:17504895-17504917 CTGGAGTCCTGGGGGCTGAGGGG + Intergenic
1145023390 17:19449553-19449575 CTGGCATCCTTGTGAAAGAAAGG + Intergenic
1146269004 17:31472310-31472332 CAGGGAACCTGGGGAGAGAGTGG + Intronic
1146655550 17:34632689-34632711 CTGGATACCTGGGGGAAGGGAGG - Exonic
1146938344 17:36826299-36826321 CTGCCATCCTGGGGCAGGAGGGG + Intergenic
1147559213 17:41498746-41498768 GTGGGGTCCTGGAGAAAGAGAGG - Intergenic
1147659913 17:42111971-42111993 GTGGAGTCCTGGGCAAAGGGAGG - Intronic
1147660025 17:42112478-42112500 GTGGAGTCCTGGGCAAAGGGAGG - Intronic
1148344898 17:46896786-46896808 CTGGAATCCAGGAGGAATAGGGG - Intergenic
1148485389 17:47987562-47987584 TTTGAAGCCTGGGGAATGAGAGG - Intergenic
1148736130 17:49865909-49865931 CAGGAATGCAGGGGAAAGAATGG - Intergenic
1149417670 17:56477323-56477345 CATGAATGCTGGGGAAATAGTGG - Intronic
1151101743 17:71563642-71563664 CTGGAATCATAGGAAGAGAGTGG + Intergenic
1151138429 17:71969654-71969676 CTGGAATTCAGGGGAGAGATTGG + Intergenic
1151265266 17:72950374-72950396 CCAGAATCCTGGGAACAGAGAGG + Intronic
1151486602 17:74404764-74404786 CTGGGATCCTGATGGAAGAGGGG - Intergenic
1151552513 17:74830234-74830256 CTGGGGGCCTGGGGAAAGAAGGG - Intronic
1151723964 17:75874213-75874235 CTAGAAACCTGGGAAAGGAGGGG + Exonic
1151738823 17:75964844-75964866 CTTGTATCATGTGGAAAGAGAGG - Intronic
1152193312 17:78901752-78901774 CTGAAATGCTTGGGGAAGAGGGG + Intronic
1152427441 17:80225887-80225909 CTGCAATCCTGAGGAAGGTGTGG - Exonic
1152583392 17:81178816-81178838 CTGGAAGCCTGAGGTCAGAGGGG - Intergenic
1153666682 18:7372569-7372591 CTTTTTTCCTGGGGAAAGAGGGG - Intergenic
1153695847 18:7640645-7640667 CTAGAACCATGGGGAAAGGGAGG + Intronic
1155030702 18:21981131-21981153 CTGGATTCCTGGGAGCAGAGGGG - Intergenic
1155377507 18:25176587-25176609 CTGGAATGCTGATGAAGGAGAGG + Intronic
1157106305 18:44777603-44777625 ATAGAAGCCTGGGGAAAGGGTGG - Intronic
1159449565 18:68583289-68583311 CTGGAATCCATGGAAAATAGGGG + Intergenic
1160007008 18:75075196-75075218 CTGCACTCCTGGGGACAGTGGGG + Intergenic
1160648418 19:206453-206475 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
1160988956 19:1852854-1852876 CTGGGATCCTGGGGGGAGGGAGG - Exonic
1161000247 19:1907262-1907284 CTGGAAGGCTGGGGAAGTAGGGG - Intronic
1162459068 19:10803596-10803618 CAGGAATCCAGAGGAAAGAGTGG - Intronic
1163572950 19:18093582-18093604 CTGGAATCCTGGGGAAAGAGAGG - Intronic
1163731807 19:18953951-18953973 CTGGAGTCCTGTGGGAGGAGGGG + Intergenic
1164050878 19:21585266-21585288 CAGGCAGCCTGGGGACAGAGAGG + Intergenic
1165022778 19:32937370-32937392 CTGGGATCCTGGGGGAAGGGAGG - Intronic
1165779884 19:38426145-38426167 CTGGAGTCCTGGGCAAGGGGAGG - Exonic
1165927011 19:39333057-39333079 CAGGTATCCTGGGGGAAGAAAGG - Exonic
1166382679 19:42362931-42362953 CTGGATTCCTGGGTTAAGGGAGG + Intronic
1166528278 19:43526773-43526795 CCCGACTCCCGGGGAAAGAGTGG - Intronic
1166662211 19:44654348-44654370 CTGGACTCCTGGTCTAAGAGAGG + Intronic
1166700460 19:44878972-44878994 CTTGCATGTTGGGGAAAGAGAGG + Intronic
1166856977 19:45787056-45787078 ATGGAAACATGGGGAAACAGAGG + Intronic
1167297866 19:48662336-48662358 GTGGAATTCTTGGGAAGGAGGGG + Intronic
1167342143 19:48922254-48922276 CTGGGGTCCTGGGGGAGGAGGGG + Intronic
1167595237 19:50423915-50423937 CAGGAAACCTGGGCACAGAGAGG - Intronic
1167710035 19:51104842-51104864 CTGGCTTCATGGGTAAAGAGAGG + Intronic
1168069464 19:53941794-53941816 TTGGGATCCTGGGGGAGGAGGGG + Intronic
1168069487 19:53941874-53941896 CTGAGGTCCCGGGGAAAGAGAGG + Intronic
1168077242 19:53987811-53987833 CTGGAGTTTGGGGGAAAGAGAGG + Exonic
926136874 2:10342726-10342748 CCGGACTCCTGGGCAAAGAGAGG + Intronic
927902294 2:26829279-26829301 CTGGCATCCTGGGGCAGGACAGG - Intergenic
928418075 2:31113400-31113422 CCTGAATCCTGGGGAAAGCTTGG + Intronic
928936189 2:36680629-36680651 ATAGAATCCTGGAGTAAGAGAGG - Intergenic
930485992 2:52011997-52012019 TTGGAGACTTGGGGAAAGAGTGG - Intergenic
931395397 2:61884267-61884289 CTGGAATTCAGAGGAAGGAGAGG - Intronic
933793504 2:85902395-85902417 CGGGAGTCCTGGGGAAGGGGAGG - Intergenic
934606275 2:95697869-95697891 CTGGGATGCTGGGAAAAAAGAGG + Intergenic
934738582 2:96702963-96702985 ATGTAATCCTGGGGAAATGGCGG - Intergenic
935563403 2:104581759-104581781 CTGGAAGCCTGGGGTAAGTCAGG + Intergenic
935808283 2:106770414-106770436 CTGAAATCCTTGGGATAGAGAGG - Intergenic
936462130 2:112721803-112721825 CAAAAATCCTGGGGAGAGAGAGG - Exonic
936508982 2:113130524-113130546 CAGGTATCCTGGGGAAAGTGAGG + Intronic
936913746 2:117618245-117618267 CTAGACTCCTGAGGAAAGAAGGG - Intergenic
937309226 2:120891905-120891927 CTGGAGTGCAGTGGAAAGAGGGG - Intronic
937772888 2:125742745-125742767 CTAGAATCCTGGGGATAAAAGGG + Intergenic
938261084 2:129895462-129895484 CTGGAATCCTGTGCCAAGAGGGG + Intergenic
938315130 2:130319605-130319627 CTGGAGTCCTGAGGAAGGAGAGG - Intergenic
941610211 2:167652228-167652250 CAGACATCCTGGGAAAAGAGTGG + Intergenic
943522378 2:188968949-188968971 CTTGAATCCTTGGGAACGAAAGG + Intergenic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945605660 2:211926820-211926842 CTGGTATGCTGGTCAAAGAGGGG - Intronic
946077311 2:217085332-217085354 GTAGAATCCTGCAGAAAGAGAGG + Intergenic
946107771 2:217387028-217387050 ATGGAACTCTTGGGAAAGAGAGG + Intronic
946330215 2:219004695-219004717 CAGGAACCCTGGGGAGATAGTGG + Intronic
946390031 2:219409520-219409542 CTGGAATCCCAGGGCAAGTGAGG + Intergenic
946457307 2:219837874-219837896 GTGAAATCCGGGTGAAAGAGAGG - Intergenic
946787469 2:223262969-223262991 GTGGTTTCCTGGGGCAAGAGTGG + Intergenic
947145384 2:227059467-227059489 CTGGGACCCCCGGGAAAGAGGGG - Exonic
947176393 2:227371742-227371764 CCGGGATCCTGGGAAAAGAAAGG - Intronic
948447642 2:238045402-238045424 ATGGAAACCCGGGGTAAGAGAGG - Intronic
948862924 2:240761593-240761615 GAGGAAGCCTGGGGAGAGAGGGG - Intronic
948982945 2:241504089-241504111 CTGGAACTCTGGGGAAGGAAAGG + Intronic
1170473163 20:16688454-16688476 CTGGACTCTTGGGGAAATGGTGG - Intergenic
1170657036 20:18297711-18297733 CTGGATTGCAGGGGAAGGAGAGG + Intronic
1170822796 20:19768341-19768363 CTGGAATGCTCTGGAAACAGTGG + Intergenic
1172011924 20:31850669-31850691 CTGGCACCCTGGTGAAGGAGAGG + Intronic
1172111494 20:32547961-32547983 AAGGATTCCTGGGGAGAGAGAGG - Intronic
1172262631 20:33581538-33581560 TTTGAATCCTGGGGAACCAGAGG + Intronic
1172529079 20:35618072-35618094 CCAGAATGCTGGAGAAAGAGAGG - Exonic
1172804068 20:37598547-37598569 CTGAACTCCTGGGGAGGGAGGGG + Intergenic
1173086543 20:39924818-39924840 CTGGAATCCTGGAGAAAGTTTGG + Intergenic
1173174228 20:40752167-40752189 CAGGAATACTGGGGAAGAAGTGG - Intergenic
1174116708 20:48231196-48231218 CTGGAATGAGGGGGAAAGAGAGG + Intergenic
1174165807 20:48582795-48582817 GTGGAAGCCTGGAGAGAGAGAGG - Intergenic
1175942748 20:62545507-62545529 CTGGAATCCTGCGGATGAAGTGG + Intergenic
1176661871 21:9644432-9644454 CTGGAGCCCAGGGAAAAGAGAGG + Intergenic
1179068324 21:38047646-38047668 CAGGGATCTTGGGGAAAGGGTGG + Intronic
1179834950 21:44024956-44024978 GTGGAGTCCGGGGGAAAGTGAGG - Intronic
1180579945 22:16824671-16824693 ATGGATTGCTGGGGAGAGAGTGG - Intergenic
1180737818 22:18031772-18031794 CTGGTATCCAGGGAACAGAGCGG - Intergenic
1180929402 22:19578810-19578832 CTGGTCTCCTGGGGACCGAGCGG - Intergenic
1181049502 22:20231877-20231899 CTGGACACCTGTGGAAAGACAGG - Intergenic
1181689922 22:24553562-24553584 CTGGAAGCCTGGGGGAGGAGGGG - Intronic
1181957974 22:26602014-26602036 TGGGCATCCTGGGGAAAGAGAGG + Exonic
1182875852 22:33690547-33690569 CTAGAGACCTGGGGAAAAAGAGG + Intronic
1185126408 22:49013384-49013406 CTTGAGTCCTGGGGAAACAGAGG - Intergenic
1185223756 22:49641788-49641810 CTGGCATGCTGGGGGAAGGGAGG + Intronic
1185279512 22:49964098-49964120 TGGGCATCCTGGGGGAAGAGAGG + Intergenic
949765441 3:7521212-7521234 CTGGGAACCTGGGAAAAGATGGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950128894 3:10528225-10528247 CTGGGAACGTGGGGAAAGGGTGG + Intronic
950442895 3:13020104-13020126 CTGGAAACCTTGGGACAGAAGGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951575568 3:24110101-24110123 CAGGGATACTGGGGCAAGAGTGG - Intergenic
951797147 3:26552148-26552170 CCGGAATCCTATGGAATGAGAGG - Intergenic
952404365 3:32992392-32992414 CTGGAAACCTGGGGGACAAGAGG - Intergenic
952508003 3:34024979-34025001 CTTGCATACTGGGGAAAGTGGGG + Intergenic
952819667 3:37475195-37475217 CTGCCATTCTGGGGAAAGAAAGG + Intronic
953818696 3:46184902-46184924 TTGCAATCCTGGTGGAAGAGGGG + Intronic
954630567 3:52045594-52045616 CTGGCTGCCTGGGCAAAGAGAGG + Intergenic
954673541 3:52303437-52303459 TTGGATTCATGGGGAAAGTGGGG + Intergenic
954701099 3:52451299-52451321 CAGGAACTCTGTGGAAAGAGGGG + Exonic
954755199 3:52835437-52835459 CTGGAATCCAGGGGAAGGGATGG - Exonic
955885621 3:63595311-63595333 AAGGAATTCTGGGGTAAGAGTGG - Intronic
956562459 3:70595309-70595331 TGGGAATGCAGGGGAAAGAGAGG + Intergenic
960064442 3:113355058-113355080 CTGGGACCCAGGGGAAAGGGTGG + Intronic
960441271 3:117692098-117692120 CTGAAATCCTAGGGAAAGTTTGG - Intergenic
962717308 3:138137736-138137758 CTGGATGCCTGTGGAAGGAGTGG + Intergenic
964526670 3:157622219-157622241 CTGGGACCCTGGGGATGGAGCGG - Intronic
964716577 3:159728757-159728779 CTGGATCCCTGGAGAAATAGTGG + Intronic
964748718 3:160035448-160035470 CTGGGAACCTGGAGAAAAAGTGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967253435 3:187566069-187566091 ATGGAACTGTGGGGAAAGAGAGG + Intergenic
968144096 3:196283682-196283704 CAGGAATACTGTGAAAAGAGAGG + Intronic
968369430 3:198213662-198213684 CTGAACTCCAGGGGGAAGAGGGG - Intergenic
969552637 4:7881232-7881254 TTGGAATGCTGGGGGATGAGTGG - Intronic
969963557 4:10971479-10971501 CTTGAAACCTGGGAAAAGAGAGG - Intergenic
970032953 4:11698471-11698493 CAGGAATCCTGTGAAGAGAGTGG + Intergenic
970572229 4:17394116-17394138 CTGGGACCCAGGGGCAAGAGCGG + Intergenic
970815883 4:20155845-20155867 CCGGGATCCTGGGGCATGAGTGG + Intergenic
970968150 4:21950602-21950624 TTGGAATCCTGATGAAAGCGAGG + Intergenic
971262492 4:25069820-25069842 CTGGAATACTGGCCAGAGAGAGG + Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
976028915 4:80726996-80727018 CTGGAATGCTGGGGGTGGAGTGG - Intronic
976637578 4:87302327-87302349 CTGGGATTTTGGTGAAAGAGAGG + Intergenic
977731619 4:100360384-100360406 CTAGAATCTTTGGGAAAGAGTGG - Intergenic
978331593 4:107619187-107619209 TTGGCATTCTGGGGAAAGAAAGG - Intronic
979546711 4:121948681-121948703 CTGGCATTTTGGGGAAAGAGAGG + Intronic
981099921 4:140818445-140818467 CTGGAATCATGGTGACAGAATGG + Intergenic
981162855 4:141519962-141519984 CTGGAATCATGGGCATGGAGAGG - Intergenic
981472580 4:145153301-145153323 CTGGAAGCCTGGGGTATGTGGGG - Intronic
982069830 4:151685532-151685554 CTGGAATGATTGGGAAGGAGAGG - Intronic
982217742 4:153096697-153096719 TGAGAATCCTGGGGAAACAGAGG + Intergenic
983583344 4:169330453-169330475 CTCTAATCCTGGGCAGAGAGAGG - Intergenic
985445408 4:190018835-190018857 CTGGGAGCGTGGGGCAAGAGGGG + Intergenic
985697498 5:1349020-1349042 GTGGGCTCCTGGAGAAAGAGGGG + Intergenic
985976031 5:3419791-3419813 CTGGAATGCGGGTGGAAGAGGGG + Intergenic
986157373 5:5190032-5190054 CTGGATTGATGGGGAAAGATGGG + Exonic
986195490 5:5533690-5533712 CTGCAATCCTGGGCACAGAGTGG - Intergenic
987038703 5:14041753-14041775 CTGGAATCCTGCAGGAGGAGGGG + Intergenic
987071071 5:14337603-14337625 TAGGACTACTGGGGAAAGAGGGG + Intronic
987540849 5:19253147-19253169 ATGGATTCCTGGGGAAATAGAGG - Intergenic
989829799 5:45901597-45901619 CTGGAAATCTGTGGAAATAGTGG + Intergenic
990304473 5:54481042-54481064 CTGCAATATTGGGCAAAGAGGGG + Intergenic
990705709 5:58527115-58527137 ATGGAATCCTGGAGTAAGTGTGG - Intergenic
992243157 5:74791306-74791328 CAGGAATCCAGGGGTAAAAGTGG + Intronic
992774121 5:80074964-80074986 TTGGTATCCTGGGGGCAGAGGGG - Intronic
992869045 5:80987647-80987669 CTGGAACACTGGGGAAAGAGGGG + Intronic
992890717 5:81201522-81201544 TTAGAATCCTGGGGACAGTGGGG + Intronic
995264210 5:110139153-110139175 CTGAACTCCTGGGGAAAGGATGG - Intergenic
998786194 5:145711581-145711603 ATGGAAATCTGGGGACAGAGTGG + Intronic
999697437 5:154199332-154199354 GTGGGTCCCTGGGGAAAGAGAGG - Intronic
999773848 5:154795340-154795362 CTGGGATGCAGGGGAAAGAAAGG + Intronic
999858119 5:155617123-155617145 TTGGAATGGTGAGGAAAGAGGGG - Intergenic
1000246152 5:159450007-159450029 CTGGGGTCCTGGGGTAAGAGAGG + Intergenic
1000334543 5:160232294-160232316 ATGGAGGCCTGGGGAAGGAGGGG - Intronic
1000915485 5:167075964-167075986 CTGAAAACCTGGGAAAAGACTGG - Intergenic
1002441582 5:179267131-179267153 AGGGGATCCTGGGGGAAGAGTGG - Intronic
1002728709 5:181319247-181319269 CTGAACTCCAGGGGGAAGAGGGG - Intergenic
1003035933 6:2640160-2640182 CTGGGAGCCTGGGAAAAGGGAGG + Intergenic
1003243944 6:4368720-4368742 CTGGTACAGTGGGGAAAGAGAGG - Intergenic
1003614212 6:7640687-7640709 CTATAATATTGGGGAAAGAGGGG + Intergenic
1004187178 6:13430821-13430843 AGGGAGTCCTGGAGAAAGAGAGG - Intronic
1006458145 6:34143656-34143678 TTGGGATCCGGGGGAAAGTGGGG + Intronic
1006612010 6:35299752-35299774 CTGGAAACCTGGGCTAACAGTGG + Intronic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1006882816 6:37354421-37354443 GTGGATTCCTGGGGAGAGAAGGG + Intronic
1006923554 6:37641443-37641465 CTGGAATTCTGGGGTAACTGAGG - Intronic
1007652470 6:43432127-43432149 CTGGACTCCTGGGGACAAGGGGG - Exonic
1007657785 6:43462576-43462598 CTGGAATGGTGGGGTGAGAGTGG - Intergenic
1010708639 6:79145180-79145202 ATGGAATGATGGGGAAGGAGAGG + Intergenic
1010976377 6:82319099-82319121 GGGGAATTCTGGGGAAAGATGGG + Intergenic
1012371414 6:98511858-98511880 AGGGATTTCTGGGGAAAGAGTGG + Intergenic
1012533142 6:100263028-100263050 CTGGCAATCTGGGGAAAGGGGGG + Intergenic
1013431125 6:110055576-110055598 ATGGACTCCTGGAGACAGAGAGG + Intergenic
1014479712 6:121920861-121920883 ATGGAATCCTGGGGTAGGAAAGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017764174 6:157593382-157593404 CTGGCAGCCTGGGGAGACAGAGG - Intronic
1018234109 6:161706025-161706047 CTGGTATGCAGGGGAAAGAGTGG - Intronic
1019507412 7:1399273-1399295 CTGGAGACCTGGGGAAGCAGAGG - Intergenic
1019626624 7:2019165-2019187 CTGGGGGTCTGGGGAAAGAGTGG - Intronic
1020022884 7:4879518-4879540 CTGGAAAGCTCTGGAAAGAGTGG + Intronic
1021973648 7:25989901-25989923 CTGGATTGGTGGGGACAGAGGGG - Intergenic
1022334260 7:29407573-29407595 CTTGAATCCTGAGAAAAGACTGG - Intronic
1023994745 7:45152377-45152399 CTGGAAGGCTGGGGACACAGGGG + Intergenic
1024458993 7:49640279-49640301 CTGGAATCCTTGAGGCAGAGCGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1025848837 7:65225650-65225672 CTGGAAACTTGGGGAAAGGGCGG - Intergenic
1026157550 7:67840265-67840287 TTGTAATCCTGGGGGAAGAGCGG + Intergenic
1026501232 7:70944924-70944946 CTGGCATACTTGAGAAAGAGGGG - Intergenic
1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG + Intergenic
1028194917 7:87894969-87894991 CTGGAATGGTGGAAAAAGAGGGG - Intronic
1029440491 7:100584404-100584426 CCGGAATGCTGGGGGAGGAGGGG + Intronic
1029448645 7:100628299-100628321 CCGGAAGCCTGGGGACAGAGGGG + Exonic
1029543993 7:101200865-101200887 CTGGGATCCTGCTGGAAGAGGGG - Exonic
1031681827 7:124684243-124684265 CTGGGATCTTGGTGAAATAGAGG - Intergenic
1031868747 7:127069106-127069128 CTGGCTGCCTGTGGAAAGAGGGG - Intronic
1032086195 7:128885071-128885093 CTGGAAGCCTGGGGCGGGAGGGG - Intronic
1034227111 7:149492883-149492905 CTGGAATCTTGGGGCCAGGGCGG + Exonic
1034242303 7:149619948-149619970 CTGGAATCTTGGGGTCAGGGCGG + Intergenic
1034641622 7:152608440-152608462 GTCGAATCCTGGAGAAGGAGCGG - Intergenic
1034972034 7:155425218-155425240 CTGCAAACCTGGGCAAGGAGTGG + Intergenic
1035434759 7:158850874-158850896 TTAGAGTCCTGGGGAAAAAGAGG - Intergenic
1035705781 8:1673381-1673403 CAGAAATCCTGGGCATAGAGAGG - Intronic
1035756039 8:2033811-2033833 CTGGCCTCCTGGGGAAACTGGGG + Intergenic
1036683229 8:10891383-10891405 CTGGGATCCTTGGGCTAGAGTGG - Intergenic
1036777982 8:11626678-11626700 CTGGAAAACCTGGGAAAGAGTGG - Intergenic
1037279520 8:17222066-17222088 CTGGAAGCTAGGGGAAAAAGAGG + Exonic
1037689304 8:21169451-21169473 CTGACCTCCTGGGGATAGAGGGG + Intergenic
1037742786 8:21620653-21620675 CTTGGATCCTGGGGGATGAGTGG + Intergenic
1041152095 8:54945221-54945243 AGGGATTCCTGGGGAAAGGGGGG - Intergenic
1041251182 8:55936225-55936247 AAGGAAGCCTGGGGAAATAGAGG - Intronic
1042184246 8:66121199-66121221 CTGGAAAACTGTTGAAAGAGGGG + Intergenic
1044585063 8:93861833-93861855 ATGAAATACCGGGGAAAGAGTGG - Intronic
1045020888 8:98043530-98043552 CTGGAATTCTGGGCACTGAGGGG - Intronic
1045865839 8:106864413-106864435 ATGGAATAATGAGGAAAGAGAGG + Intergenic
1046368068 8:113262445-113262467 CTGCACTCATGGGGAAGGAGTGG - Intronic
1047882155 8:129206891-129206913 ATGGAATCCTGGAGAAAAACTGG + Intergenic
1048272031 8:133037154-133037176 AAGGGATCCTGGGGAAGGAGGGG - Intronic
1048348387 8:133595588-133595610 GGGGACTCCTGGGGGAAGAGGGG + Intergenic
1051028409 9:12643898-12643920 CCAGAATCCTGGAGGAAGAGTGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052669833 9:31541770-31541792 CTGCCATCCTGGGGAAAGCATGG - Intergenic
1052713057 9:32081117-32081139 CTGGATTCATGAGGACAGAGAGG - Intergenic
1053160292 9:35809301-35809323 TGGGAATCATAGGGAAAGAGAGG + Intronic
1053253150 9:36591967-36591989 CTGGGATGTAGGGGAAAGAGAGG - Intronic
1053274128 9:36770632-36770654 CTTGAGGCCTGGGGCAAGAGGGG - Intergenic
1055307702 9:74947370-74947392 CTCTAATCCTGGGAAAACAGGGG + Exonic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056019289 9:82424470-82424492 CTGGATCCCTGGGTGAAGAGTGG - Intergenic
1057212780 9:93209794-93209816 CTGGGATCCTGGGGGAAGGGCGG - Intronic
1057693210 9:97305461-97305483 TTGTTATCCTGGGGGAAGAGAGG + Intergenic
1058380298 9:104370595-104370617 CTGGAATCCAGGGGACAGTATGG + Intergenic
1058540174 9:106003468-106003490 CTGGGAACTTGGGGTAAGAGTGG - Intergenic
1058728989 9:107831995-107832017 CTGGATATCTGGGGAAAGAATGG + Intergenic
1061198948 9:129125066-129125088 CAGGATGGCTGGGGAAAGAGGGG + Intronic
1061775125 9:132957826-132957848 CAAGCATGCTGGGGAAAGAGAGG + Intronic
1062024537 9:134334194-134334216 CAGGAAGCCTGGGAAAAAAGAGG - Intronic
1062278755 9:135742757-135742779 CAGGAAGCCTGGGGACACAGAGG - Intronic
1062753769 9:138276346-138276368 CTGAACTCCAGGGGGAAGAGGGG - Intergenic
1203576285 Un_KI270745v1:11125-11147 CTGAACTCCAGGGGGAAGAGGGG - Intergenic
1203639433 Un_KI270750v1:146275-146297 CTGGAGCCCAGGGAAAAGAGAGG + Intergenic
1187258759 X:17666012-17666034 GGGGAGTCCTGGGGAAAGAATGG + Intronic
1188520679 X:31034223-31034245 TCAGAATCCTGGTGAAAGAGAGG - Intergenic
1188937401 X:36193552-36193574 CTGAATTCCTGGGGAAACATAGG + Intergenic
1189361216 X:40353677-40353699 GTGGACTACTGGGGAAAGATGGG - Intergenic
1190008795 X:46764677-46764699 ATGGAATGCTGGGGAAACAGAGG + Intergenic
1190242563 X:48668742-48668764 AAGGAGTCCTGGGGAAAGTGAGG + Intergenic
1190905286 X:54721334-54721356 CTGGAACCTTGGGGGAGGAGTGG - Intergenic
1191740459 X:64432258-64432280 CAGAAGTCCTGGGGAATGAGAGG - Intergenic
1192655365 X:72987818-72987840 CTGGGATGCTGGGGTAGGAGTGG + Intergenic
1193291499 X:79778040-79778062 CTGGAGATCTGTGGAAAGAGTGG + Intergenic
1193603462 X:83537331-83537353 TTGGAATCCTGTGGAGAGAAGGG + Intergenic
1194010266 X:88553431-88553453 CTGAAATCATGAGGAAATAGAGG - Intergenic
1196458039 X:115903593-115903615 CTGGAAGCCTGAGGGAAGAGGGG - Intergenic
1196685924 X:118510202-118510224 ATGGAATCCTGGGGTCAGAGGGG + Intronic
1197475761 X:126923061-126923083 GAGGACTCATGGGGAAAGAGTGG - Intergenic
1198142183 X:133815335-133815357 CAGGACTCCTGGGGAAAGATAGG - Intronic
1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG + Intronic
1198174726 X:134143972-134143994 CTTGAACCCTGGGCCAAGAGTGG - Intergenic
1199243707 X:145577850-145577872 CTGAAATCATTAGGAAAGAGGGG - Intergenic
1200376381 X:155784868-155784890 CTGGAATTCAGGGGAGAGATTGG - Intergenic
1202177825 Y:22113876-22113898 CTGCAATCCTGGGGAAAAAATGG + Intergenic
1202213536 Y:22472519-22472541 CTGCAATCCTGGGGAAAAAATGG - Intergenic