ID: 1163574864

View in Genome Browser
Species Human (GRCh38)
Location 19:18104721-18104743
Sequence ACTTAGGTGCAGAGGAAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163574864_1163574874 20 Left 1163574864 19:18104721-18104743 CCGGCTTTCCTCTGCACCTAAGT 0: 1
1: 0
2: 0
3: 15
4: 208
Right 1163574874 19:18104764-18104786 CCCTGCCCGCGGTTCGTAGGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1163574864_1163574870 9 Left 1163574864 19:18104721-18104743 CCGGCTTTCCTCTGCACCTAAGT 0: 1
1: 0
2: 0
3: 15
4: 208
Right 1163574870 19:18104753-18104775 AGTAAAACAGCCCCTGCCCGCGG 0: 1
1: 0
2: 0
3: 9
4: 99
1163574864_1163574871 17 Left 1163574864 19:18104721-18104743 CCGGCTTTCCTCTGCACCTAAGT 0: 1
1: 0
2: 0
3: 15
4: 208
Right 1163574871 19:18104761-18104783 AGCCCCTGCCCGCGGTTCGTAGG 0: 1
1: 0
2: 0
3: 2
4: 43
1163574864_1163574876 23 Left 1163574864 19:18104721-18104743 CCGGCTTTCCTCTGCACCTAAGT 0: 1
1: 0
2: 0
3: 15
4: 208
Right 1163574876 19:18104767-18104789 TGCCCGCGGTTCGTAGGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163574864 Original CRISPR ACTTAGGTGCAGAGGAAAGC CGG (reversed) Intronic
901239322 1:7683846-7683868 ACTGCGGTGCTGAGGAAAGCAGG - Intronic
905008088 1:34727300-34727322 ACCTAGATGCAGAAGGAAGCTGG - Intronic
906729201 1:48066713-48066735 ACTGAGGTCCAGAGGAGGGCAGG - Intergenic
908879620 1:68716076-68716098 ACTGAGGGGCTGAGGGAAGCTGG - Intergenic
909642794 1:77886568-77886590 AGTTAGGTGAAGGGGAAAGTGGG + Intergenic
909911593 1:81265054-81265076 ATTGAAGTTCAGAGGAAAGCAGG - Intergenic
910285789 1:85552669-85552691 AATTAGGTGGAAAGGAAAGAAGG + Intronic
911907224 1:103585871-103585893 GTTTAAGTGCAGAGGATAGCTGG + Intergenic
911942966 1:104070622-104070644 GCTTAGATGCAGAGGAAAACTGG + Intergenic
916202727 1:162287458-162287480 TCTGAGGTGAAGAGGAAAGCAGG + Intronic
916444474 1:164859406-164859428 ACTTGGGTGCAGAGGATAAATGG - Intronic
920016351 1:202912744-202912766 GCTTAGCTGGAGAGGAGAGCCGG + Intronic
920251004 1:204622424-204622446 AAATAGCTGCAGAGGAAAGTGGG - Intronic
920614772 1:207479632-207479654 AATTAGGTGCACAGGACACCAGG - Intronic
922512305 1:226179404-226179426 TCCTTGGTGCAGAGGAGAGCAGG + Intronic
1063621437 10:7652361-7652383 ACTGAGCTCCAGAGGCAAGCAGG + Intronic
1066277547 10:33883839-33883861 CCTTAGGTGCAGAGCCAAGCAGG + Intergenic
1067182018 10:43995366-43995388 ACCCATGTGCAGAGGAAGGCGGG + Intergenic
1071028462 10:81143493-81143515 ACTTGGGAGCAGACGAAAGTTGG - Intergenic
1071131524 10:82398914-82398936 ACTTAAGTACAGAAGGAAGCAGG + Intronic
1072072805 10:91936332-91936354 CCTGATGTGCAGAGTAAAGCAGG + Intronic
1073044920 10:100631442-100631464 ACTTAGCTGTTGAGGAAAGAGGG + Intergenic
1085404494 11:76254053-76254075 ACTGAGGGGCAGAGGACAGAGGG - Intergenic
1087173586 11:95075401-95075423 AGTTAGTTACAGAGGAAAACCGG + Intergenic
1087985054 11:104668458-104668480 ACGTTGGTACAGAGGAAAGGAGG + Intergenic
1088389994 11:109303667-109303689 AATGGGGTGCAGTGGAAAGCAGG - Intergenic
1089155563 11:116399451-116399473 GCTTAGGTAGAGAGGAAAGATGG + Intergenic
1089218555 11:116851478-116851500 ACTTAGGGGCAGAGGCAGGATGG + Intronic
1090067876 11:123519024-123519046 GCTTGGGGGCAGAGCAAAGCGGG - Intergenic
1091463588 12:664585-664607 ACCTAGGTGCACAGGAGGGCGGG + Intergenic
1091948159 12:4567869-4567891 ACTCAGGGACAGAAGAAAGCAGG - Intronic
1092451495 12:8606573-8606595 ATTCAGATGCTGAGGAAAGCTGG + Intronic
1094168545 12:27466849-27466871 CCTTTGGTGCTGAGGAAAGGAGG + Exonic
1094455605 12:30629360-30629382 AGGGAGGAGCAGAGGAAAGCAGG + Exonic
1096820815 12:54232617-54232639 ACTTGGGAGCAGAGGGAAGTTGG + Exonic
1097465142 12:59913437-59913459 AATTAGGTGTAAAGGAAAGCAGG + Intergenic
1097472701 12:60014967-60014989 ATTTAGGGGAAGAGGAAAGGTGG + Intergenic
1100085763 12:90908431-90908453 GCTGACGTGCAGAGAAAAGCAGG - Intronic
1101422669 12:104562395-104562417 ACTCAGGTGCAGGGGGAAGATGG - Intronic
1107377735 13:39822597-39822619 ACTTGTCTGCAGTGGAAAGCAGG + Intergenic
1108355375 13:49625094-49625116 ACTGAGGTGCAGAGAAATTCAGG + Intergenic
1109053230 13:57511506-57511528 ACTTTGGTGTAGAGCAAATCTGG - Intergenic
1109453994 13:62559155-62559177 TCTTAGGAACAGAGAAAAGCAGG + Intergenic
1110237208 13:73229407-73229429 AGGCAGGTGGAGAGGAAAGCTGG - Intergenic
1111016005 13:82382910-82382932 ACAAAGGTGCAGTGGAAACCAGG + Intergenic
1111859692 13:93686474-93686496 ACTGAGGTACAGAAGAAAACAGG - Intronic
1111942618 13:94627882-94627904 ACTTAGGTGAAGGGACAAGCAGG + Exonic
1112676515 13:101708323-101708345 ACTGAGCTGAAGAGGAGAGCTGG - Intronic
1113571667 13:111362363-111362385 ACCTGGGTGCAGAGGAGAGGAGG + Intergenic
1114066275 14:19062067-19062089 ACTGAGGTCCAGAGGAGGGCAGG + Intergenic
1114095993 14:19337957-19337979 ACTGAGGTCCAGAGGAGGGCAGG - Intergenic
1116965898 14:51014944-51014966 GCTTTAGTGCAGATGAAAGCAGG - Intronic
1119573034 14:75693165-75693187 TTTTAGATGGAGAGGAAAGCAGG + Intronic
1120364009 14:83542036-83542058 ACTGAGGTGGGGAGGAAAGGGGG - Intergenic
1122349858 14:101082836-101082858 ACTTATGAGCAGAGGACAGAGGG + Intergenic
1124237455 15:28002728-28002750 ATGTAAGAGCAGAGGAAAGCAGG - Intronic
1126096430 15:45094092-45094114 ACTTAGGTGCACAGAAGAGAAGG + Exonic
1127721995 15:61712066-61712088 ACTTTAGTGGAGAGGAAAGGAGG + Intergenic
1127881471 15:63162040-63162062 ACTTCAGTCCAGGGGAAAGCTGG - Intergenic
1129233546 15:74209801-74209823 ACCTAGGTGCTGTGGCAAGCAGG + Intronic
1129462888 15:75708696-75708718 ACTGAGGCTCAGAGAAAAGCAGG - Intronic
1129721989 15:77882720-77882742 ACTGAGGCTCAGAGAAAAGCAGG + Intergenic
1130040708 15:80403953-80403975 ATTTAGATTCAGAGGGAAGCCGG - Intergenic
1131485713 15:92818753-92818775 ACTTCCCTGCAGAGGAAAGGTGG + Intergenic
1131852290 15:96555840-96555862 ACTAAGGAGCAGAGGAAGGGAGG + Intergenic
1131971777 15:97900764-97900786 ACTTAGGTGCAGGGTAGAGAGGG - Intergenic
1132419866 15:101655806-101655828 ACTAGGGTGCAGATGAGAGCGGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1135927094 16:26705022-26705044 GCTTAGGGCCAGAGGAAAGGTGG + Intergenic
1136139274 16:28278248-28278270 ACTTTGGGGCAGGGGAGAGCAGG + Intergenic
1136598520 16:31268171-31268193 CCCTAGGTGGAGAGGGAAGCTGG - Intronic
1137402257 16:48163250-48163272 ACTGATGTGCAGAGCAAAGGAGG - Intergenic
1137798868 16:51244417-51244439 ATTGAGGTTCAGAGGAGAGCAGG - Intergenic
1143683762 17:8497090-8497112 GCTGAGGTGCTGAGGAAACCAGG - Intronic
1146541718 17:33701836-33701858 ACTGATGTGCAGAGGCAGGCTGG - Intronic
1146651901 17:34612304-34612326 AATTCGGGGCTGAGGAAAGCAGG + Intronic
1146668924 17:34723464-34723486 ACTGAGGTGCAGAGAAGAGCAGG + Intergenic
1148459657 17:47831854-47831876 ACTTAGGAGAGGAGGAAAGGGGG - Exonic
1155047580 18:22116295-22116317 TCATAGATGCAGAGGAAAGGTGG + Intergenic
1155316755 18:24579334-24579356 AGTGAAGTGCAGTGGAAAGCAGG + Intergenic
1155422204 18:25667589-25667611 CCTTAGGTGCAGATGCAGGCAGG - Intergenic
1155437294 18:25826567-25826589 TCTGAGCTGCAGAGGACAGCTGG - Intergenic
1155936808 18:31763062-31763084 ACTTGGGTGCTGAGGACAGAAGG - Intergenic
1156600631 18:38601705-38601727 ACATATGTGCAGAGGCAAGTTGG + Intergenic
1157476007 18:48024098-48024120 ACTTAGGAGCAGAGAAAAGGAGG + Intergenic
1157958214 18:52123018-52123040 ACTTATGTGCCCAGGAAAGACGG + Intergenic
1159259739 18:65998181-65998203 AGTTAGGCACAGAGGAAGGCAGG - Intergenic
1159645897 18:70917223-70917245 GCTTAGGTATAGAGGAAAGTAGG + Intergenic
1160115796 18:76078268-76078290 ACTCAGGGCCAGAGGACAGCAGG + Intergenic
1163574864 19:18104721-18104743 ACTTAGGTGCAGAGGAAAGCCGG - Intronic
1165087925 19:33364275-33364297 ACTGAGGTGCAGAAGAAACTGGG - Intergenic
925581082 2:5411607-5411629 TCGTAGCTGGAGAGGAAAGCAGG - Intergenic
929094419 2:38249934-38249956 ACTTATGTGCACAGGAAATGGGG + Intergenic
933589284 2:84214270-84214292 ACTTCAGTGCAGAGGAATTCAGG - Intergenic
934665099 2:96164254-96164276 ACTTAGTAGCTGAGGAAAGTGGG - Intergenic
935476701 2:103531275-103531297 ACTTGGGTTCAGAGGATTGCTGG - Intergenic
935720126 2:105972629-105972651 ACCTGGGTTCAGAGGAGAGCAGG + Intergenic
936082801 2:109446471-109446493 CCTTGGGAGCAAAGGAAAGCTGG + Intronic
937699899 2:124852371-124852393 TTCTAGGTGCAGAGAAAAGCAGG + Intronic
937804783 2:126126622-126126644 ACTTTGGTGCAAAAGAGAGCTGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
942276180 2:174325754-174325776 ACTTAAGGGAAGAAGAAAGCAGG + Intergenic
942673873 2:178406111-178406133 ACTGAGGGGCTGAGGACAGCCGG + Intergenic
945313735 2:208347093-208347115 ACTTAGGGGAAGAGGGGAGCGGG - Intronic
945437381 2:209834942-209834964 CCTCAGGTGCAGAGGATACCTGG - Exonic
946733968 2:222735905-222735927 GCTTGGGTGAAGGGGAAAGCAGG - Intergenic
947998361 2:234547390-234547412 AATCAGGTGCTGAGGAAAGCAGG + Intergenic
1169730779 20:8783686-8783708 ACTAATATGCAGAGAAAAGCAGG - Intronic
1170163973 20:13343609-13343631 ACTTTGCTACTGAGGAAAGCAGG - Intergenic
1173220878 20:41132118-41132140 ACCCAGGTGAGGAGGAAAGCAGG + Intergenic
1174429884 20:50460115-50460137 ACTTAGGTAAAGAGGAAATTGGG + Intergenic
1175100992 20:56578724-56578746 ACTGAGGCTCAGAGAAAAGCAGG + Intergenic
1180484753 22:15784658-15784680 ACTGAGGTCCAGAGGAGGGCAGG + Intergenic
1181133768 22:20750220-20750242 ACGTGTGTGCAGAGGAAATCTGG + Intronic
1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG + Intergenic
949511329 3:4769686-4769708 ACTGAGGTGCAGAGGACACAGGG + Intronic
951429619 3:22590993-22591015 ACTAAGGTGAAGTGAAAAGCTGG + Intergenic
951527288 3:23665568-23665590 ACTTCGGGGCAGAGGATAGGAGG - Intergenic
951599873 3:24361871-24361893 ACTTATGGGCAGATGATAGCAGG + Intronic
951842888 3:27052906-27052928 ACTTAGGTGCACATCAAAGGTGG - Intergenic
952515666 3:34102602-34102624 ATTTAGGCACAGAGTAAAGCAGG + Intergenic
953415355 3:42712497-42712519 AGCCAGGTGCAGAGGGAAGCTGG - Intronic
953578015 3:44128732-44128754 CCTTAGCTGCTGTGGAAAGCTGG - Intergenic
954466696 3:50659323-50659345 ACTTTGGGGAAGAGGAAAGTGGG - Intergenic
955047520 3:55374094-55374116 ACTCAAGTGCAGTGGAAAGATGG - Intergenic
956028095 3:65005585-65005607 ACAGTGGTGGAGAGGAAAGCAGG - Intergenic
958451430 3:94278078-94278100 ACTTAGGGGCAGAGCAGAGATGG + Intergenic
961140699 3:124553461-124553483 ACTGAGCTTCAGAGGAAACCAGG - Intronic
961468406 3:127096012-127096034 AGTGAAATGCAGAGGAAAGCAGG - Intergenic
961550962 3:127670453-127670475 ACTCAGGGGCAGCGAAAAGCAGG - Intronic
961942677 3:130654611-130654633 ACTTAGGACCAGAGGACACCTGG - Intronic
962940926 3:140124251-140124273 AATGAGCTGGAGAGGAAAGCAGG + Intronic
963643189 3:147882602-147882624 ACTTAAATGCAGAGGAGAGAAGG + Intergenic
963966968 3:151382804-151382826 ACTTAGGAGAAGTGGAAAGCTGG - Intronic
964305403 3:155334097-155334119 ACTTAGGTGCAGCTGACAGTAGG + Intergenic
966643299 3:182214747-182214769 AATCAGGTGAAGAGGGAAGCAGG + Intergenic
967190875 3:186984027-186984049 ACCTGGGGGCAGAGGAAATCTGG - Intronic
968824519 4:2884735-2884757 ATTTAGGAGAAGAGGGAAGCAGG + Intronic
968951911 4:3699817-3699839 ACTGAGGGGCAGAGGCAAGAGGG + Intergenic
969252408 4:5976807-5976829 TATTAGGCGCAGATGAAAGCTGG + Intronic
970091596 4:12414490-12414512 TCTTGTGTGCAGAGGAATGCAGG + Intergenic
970404018 4:15744684-15744706 GCTTAGGGGCAGAGGAGTGCTGG + Intergenic
971514440 4:27468964-27468986 ACTTTGGGGCAGGTGAAAGCTGG - Intergenic
971914698 4:32852293-32852315 AATTAGGTTCATAGGAAAGGAGG - Intergenic
974418244 4:61638902-61638924 AATTAAGTGAAGAGGAAAGCAGG - Intronic
976405175 4:84654914-84654936 ACGTGGGTGCAGAGGAGACCTGG - Intergenic
979807537 4:124993372-124993394 ACTCAGTTGGAGAGGAAAGTAGG + Intergenic
981141449 4:141274340-141274362 ACTCAGGTACAGAGCAAAACAGG - Intergenic
981775499 4:148362579-148362601 ACTTTTGAGCAGATGAAAGCGGG - Intronic
984614334 4:181879024-181879046 ACTTAGTTTCAGATGAAAGTGGG + Intergenic
985722869 5:1499797-1499819 AGTTAGGTGCAGGGGGAAGACGG - Intronic
986457694 5:7936589-7936611 CCATAGGTACAGAAGAAAGCAGG + Intergenic
988438919 5:31209797-31209819 ACTTTGATGCTGAGGATAGCAGG - Intronic
988490581 5:31701918-31701940 TCTGAGGTGGAGGGGAAAGCAGG - Intronic
992206911 5:74439887-74439909 ACTTAGGTAAAGACCAAAGCTGG - Intergenic
992348550 5:75905996-75906018 ACAGAGGTGCACAGGAAAGATGG + Intergenic
993351377 5:86853900-86853922 ACTGAGGTGAAGTTGAAAGCAGG - Intergenic
993989972 5:94644161-94644183 ACAGAAGTGCAGAGGAAAGATGG - Intronic
996829477 5:127723979-127724001 ACTTAGGTTCAGAGAAATGGAGG + Intergenic
998458079 5:142289208-142289230 ACTGAGGGCCAGAGTAAAGCTGG - Intergenic
999227532 5:150038913-150038935 ACTTAGGTTCACACAAAAGCTGG - Intronic
1001405910 5:171477456-171477478 ACTGAGGTCCAGAGAAAAGAAGG - Intergenic
1002716422 5:181230975-181230997 CCCTAGGTGCTGAGGAGAGCGGG + Intronic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1005569661 6:27132671-27132693 ACTAAGGCGCAGAAGAAAGACGG - Exonic
1006103341 6:31700921-31700943 AGGTAGGTGGAGAGGAAACCTGG - Exonic
1007150470 6:39685341-39685363 AATTAGGTGCAGATGCAGGCTGG + Intronic
1007458222 6:41997380-41997402 ACTAAGGTGCAGTAGGAAGCAGG + Intronic
1009943153 6:70312975-70312997 AATTAGATGCAGAGTGAAGCGGG - Intergenic
1011855303 6:91682456-91682478 ACTTAGTTGCATGGGGAAGCAGG - Intergenic
1013188495 6:107782557-107782579 GCTTTGGTGCAGAGAAGAGCAGG - Intronic
1014613313 6:123570474-123570496 ACTTAGGACCAGATGACAGCAGG + Intronic
1015450374 6:133360734-133360756 AGGAAGGTGTAGAGGAAAGCTGG - Intronic
1016426120 6:143937417-143937439 GGTTAGGGGCAGAGGAAAGAAGG + Intronic
1016534688 6:145097222-145097244 ACTCTGGAGCAGAGGAGAGCTGG - Intergenic
1017344568 6:153366199-153366221 ACTCAGGAGAAGGGGAAAGCAGG + Intergenic
1017627045 6:156359295-156359317 AATTAGGAGCAGGGGAGAGCTGG - Intergenic
1021038501 7:15831319-15831341 CCTTTGGTGCATAGGAAGGCAGG - Intergenic
1021292791 7:18866475-18866497 ACTGAGGGACAGAGGAGAGCGGG - Intronic
1023361337 7:39418792-39418814 GCTTTGCTTCAGAGGAAAGCTGG - Intronic
1024759906 7:52583176-52583198 ACTTAGGTGAAGAGGATGGCTGG - Intergenic
1025244913 7:57309592-57309614 ACTTAGGTAAAGAGGAAATTGGG - Intergenic
1030582318 7:111373439-111373461 ACTTAGTAGCAGTGAAAAGCAGG - Intronic
1030684961 7:112476544-112476566 ACTTGGGTGCTGAGGCAAGAGGG + Intronic
1030691545 7:112540182-112540204 AGCAAGGTGCTGAGGAAAGCTGG - Intergenic
1031023550 7:116654427-116654449 CCTTAGATGCAAAGGAATGCAGG + Intergenic
1031457747 7:122004339-122004361 ACTTAGGGGCAGGGGAAATGGGG + Intronic
1032068992 7:128792248-128792270 GCTGGGGTGCAGAGGAAAGAAGG - Exonic
1032525839 7:132577582-132577604 ACGTTGGTGCGGAGGAGAGCCGG - Intronic
1032744552 7:134772552-134772574 AATTAGATTCAGAGGATAGCAGG - Intronic
1033435620 7:141331038-141331060 ACTGAGATTGAGAGGAAAGCAGG + Intronic
1036678494 8:10853595-10853617 ACCTGGGTGCAGAGGAGATCAGG + Intergenic
1038610045 8:29052251-29052273 AGATAGGAGCAGAGAAAAGCAGG + Exonic
1040770773 8:50972543-50972565 ATTTAGGAAAAGAGGAAAGCTGG + Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1041861152 8:62513934-62513956 ACTTAGGAGTAGATGAAAGAAGG + Intronic
1042219799 8:66462115-66462137 ACTTAGGAGGAGAGGAATGGAGG - Intronic
1043678345 8:82990041-82990063 ACATAGTTGCAGAGGAGAGCAGG + Intergenic
1044233679 8:89806848-89806870 GCTGAGGTCCAGAGGACAGCTGG - Intergenic
1045308071 8:100976022-100976044 ACAGAGGTGCAGAGGCAAGCTGG - Intergenic
1047084732 8:121503959-121503981 ACTTAGGTGGAGAGGAATACAGG + Intergenic
1047911726 8:129537166-129537188 ACTTAGCTGCAGAATAAAACTGG + Intergenic
1048065721 8:130966428-130966450 GGTTAGGTGCAGAGGGAAGAAGG + Intronic
1049680143 8:143914574-143914596 ACTTAGGGGAGGAGGGAAGCGGG - Intergenic
1050163664 9:2742916-2742938 AATGGGGTGCAGAGGAAAGAAGG - Intronic
1051088226 9:13376931-13376953 ATTCAGGGGCAGAGGAAATCAGG - Intergenic
1053566814 9:39261178-39261200 TCTTAGGAAAAGAGGAAAGCAGG - Intronic
1053589519 9:39497649-39497671 AATTAGGTTCAGAGGAAATAAGG - Intergenic
1054130329 9:61357829-61357851 TCTTAGGAAAAGAGGAAAGCAGG + Intergenic
1054576778 9:66867636-66867658 AATTAGGTTCAGAGGAAATAAGG + Intronic
1055326362 9:75134757-75134779 ACTGAGGAGCAGAGGAGAACAGG - Intronic
1057577080 9:96251261-96251283 GCTAAGGTGAAGAGGAAAGGGGG + Intronic
1058284806 9:103163907-103163929 ATTTAGCTTCAGAGTAAAGCAGG - Intergenic
1059639078 9:116199136-116199158 AATTTGGTTCAGAGGAAACCAGG - Intronic
1061641691 9:131962856-131962878 CCTTTAGTGAAGAGGAAAGCTGG + Intronic
1187466820 X:19534819-19534841 ACATAGGTTAAGAGGAAGGCAGG + Exonic
1187553301 X:20327250-20327272 ACTGAGGTGGGGTGGAAAGCTGG + Intergenic
1187592138 X:20729145-20729167 AGCTAGGTGGAGTGGAAAGCTGG + Intergenic
1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG + Exonic
1190217692 X:48490901-48490923 ACACAGGAGCTGAGGAAAGCTGG + Intergenic
1190633083 X:52408027-52408049 ACTTAAGGGAAAAGGAAAGCAGG - Intergenic
1194768704 X:97873940-97873962 ATTTTTGTGCAGATGAAAGCAGG - Intergenic
1194904096 X:99551936-99551958 ACTTAGGTGCACATCAAAGGTGG - Intergenic
1199740272 X:150729117-150729139 ACCAAGCTGCAGAGGAAAGTGGG - Intronic