ID: 1163575915

View in Genome Browser
Species Human (GRCh38)
Location 19:18110600-18110622
Sequence CACACGAAGGGGCGGCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163575903_1163575915 9 Left 1163575903 19:18110568-18110590 CCGCAGCCGCCATCCGGAGATCC 0: 1
1: 0
2: 0
3: 3
4: 119
Right 1163575915 19:18110600-18110622 CACACGAAGGGGCGGCCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 97
1163575900_1163575915 20 Left 1163575900 19:18110557-18110579 CCCTGAGGGAACCGCAGCCGCCA 0: 1
1: 0
2: 1
3: 13
4: 116
Right 1163575915 19:18110600-18110622 CACACGAAGGGGCGGCCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 97
1163575908_1163575915 -4 Left 1163575908 19:18110581-18110603 CCGGAGATCCGGATTCGGCCACA 0: 1
1: 0
2: 1
3: 1
4: 33
Right 1163575915 19:18110600-18110622 CACACGAAGGGGCGGCCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 97
1163575897_1163575915 28 Left 1163575897 19:18110549-18110571 CCCCTACTCCCTGAGGGAACCGC No data
Right 1163575915 19:18110600-18110622 CACACGAAGGGGCGGCCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 97
1163575905_1163575915 3 Left 1163575905 19:18110574-18110596 CCGCCATCCGGAGATCCGGATTC 0: 1
1: 0
2: 1
3: 2
4: 46
Right 1163575915 19:18110600-18110622 CACACGAAGGGGCGGCCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 97
1163575901_1163575915 19 Left 1163575901 19:18110558-18110580 CCTGAGGGAACCGCAGCCGCCAT 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163575915 19:18110600-18110622 CACACGAAGGGGCGGCCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 97
1163575898_1163575915 27 Left 1163575898 19:18110550-18110572 CCCTACTCCCTGAGGGAACCGCA 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1163575915 19:18110600-18110622 CACACGAAGGGGCGGCCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 97
1163575899_1163575915 26 Left 1163575899 19:18110551-18110573 CCTACTCCCTGAGGGAACCGCAG 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1163575915 19:18110600-18110622 CACACGAAGGGGCGGCCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 97
1163575907_1163575915 0 Left 1163575907 19:18110577-18110599 CCATCCGGAGATCCGGATTCGGC 0: 1
1: 0
2: 0
3: 1
4: 6
Right 1163575915 19:18110600-18110622 CACACGAAGGGGCGGCCGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163575915 Original CRISPR CACACGAAGGGGCGGCCGCC AGG Intronic
900140226 1:1136767-1136789 CAAACAAAGGTGCGGTCGCCAGG + Intergenic
900149512 1:1171941-1171963 CCCACGCCGGGGCGGCAGCCTGG - Intergenic
900184116 1:1325011-1325033 CCCAGGAAGGGGCGGAGGCCCGG - Exonic
905922215 1:41727344-41727366 CACAGGAAGGGGCTGCCTCCCGG - Intronic
910676547 1:89821547-89821569 CTCCCGCAGGGCCGGCCGCCCGG - Intronic
913967847 1:143391999-143392021 CAAACGAAGGGGTGGGCGCAAGG + Intergenic
914062227 1:144217589-144217611 CAAACGAAGGGGTGGGCGCAAGG + Intergenic
914116923 1:144748765-144748787 CAAACGAAGGGGTGGGCGCAAGG - Intergenic
920706236 1:208252621-208252643 CAGAGGAGGGGGCGGCTGCCAGG - Intergenic
922729174 1:227941074-227941096 CACGGGAAGGTGCGGCAGCCTGG + Intronic
1069793761 10:71039787-71039809 CAGACAAAGGGGCGGCTGCGAGG - Intergenic
1080749538 11:35139426-35139448 CAGCCGGAGGGGCTGCCGCCGGG - Intronic
1084461177 11:69297521-69297543 CACAGGCAGCTGCGGCCGCCCGG + Intronic
1094738600 12:33262625-33262647 CACAGGAAGGGGCAGCTGCTGGG + Intergenic
1104438557 12:128776502-128776524 CACACGAAGAGGTGGTTGCCAGG + Intergenic
1106248740 13:27968610-27968632 CGCAGGAAGGCGCGGCGGCCGGG + Exonic
1112449871 13:99498724-99498746 CATGCGCAGGGCCGGCCGCCCGG - Intergenic
1113709161 13:112452728-112452750 CAGACGGAAGGGCGGCTGCCGGG + Intergenic
1113906596 13:113822214-113822236 CTCACGTAGGGGTGGCCGGCAGG - Intronic
1115555611 14:34542996-34543018 CAGACGGAGGAGGGGCCGCCTGG - Intergenic
1115558297 14:34560097-34560119 CAGACGGAGGAGGGGCCGCCTGG + Intergenic
1117253268 14:53955263-53955285 CAGTAGAAGGGGCGGGCGCCCGG + Intronic
1122309194 14:100783813-100783835 CACACGTTGGGGCTGCCGGCTGG - Intergenic
1125456861 15:39868809-39868831 CATACGAAGGGGCAGGAGCCAGG + Intronic
1127071261 15:55289950-55289972 CCCTCGGAGGCGCGGCCGCCGGG - Intronic
1133259303 16:4538189-4538211 CACACAGCGGGGCGCCCGCCCGG + Intronic
1137021440 16:35432247-35432269 CACAAGAGGGTGCTGCCGCCTGG + Intergenic
1137787213 16:51149809-51149831 CCCACTAAGCTGCGGCCGCCCGG - Intronic
1138037741 16:53625405-53625427 CCCCAGACGGGGCGGCCGCCAGG - Intronic
1142155850 16:88532610-88532632 CACACGAAGGGCCGCTCTCCTGG - Exonic
1142236680 16:88925725-88925747 CACACGCAGGGGCTCCCGGCGGG - Intronic
1143733433 17:8894259-8894281 CACAAGACGGGGCAGCCTCCTGG - Intronic
1147994868 17:44354917-44354939 CACCCGAAGGCTCGGCGGCCGGG + Exonic
1160524345 18:79526256-79526278 CACACGGAGGGGCGGGAGCCCGG + Intronic
1161172490 19:2819992-2820014 GACACGCAGGGGAGGCCGGCCGG + Exonic
1161959456 19:7515959-7515981 CAGACAAAGGCGCGGCCGCGCGG + Intronic
1163524369 19:17811688-17811710 CCCACGAAGAGGTGGCGGCCAGG - Exonic
1163575915 19:18110600-18110622 CACACGAAGGGGCGGCCGCCAGG + Intronic
1163747219 19:19055682-19055704 CCCACGGAGGGGAGGCCGCAGGG + Intronic
1164948025 19:32312413-32312435 CACACGATGGGGAAGCTGCCAGG + Intergenic
1165737020 19:38183337-38183359 CAGACGAAGGGGCGGGAGCAGGG + Intronic
1165924812 19:39320535-39320557 CAGCCGGAGGGGCGGCCGCTCGG + Intergenic
1166679994 19:44760080-44760102 CACACGAAGGCACTTCCGCCAGG - Intergenic
1168339435 19:55614901-55614923 CCCACGCGGGGGCGGGCGCCGGG + Exonic
1202701635 1_KI270712v1_random:169467-169489 CAAACGAAGGGGTGGGCGCAAGG + Intergenic
925203993 2:1991268-1991290 CACAAGAGGGGGCGGCGGCAGGG - Intronic
931727980 2:65129710-65129732 GACGCGGAGGGGCGGCCGCGCGG - Intronic
934172550 2:89552914-89552936 CAAACGAAGGGGTGGGCGCAAGG + Intergenic
934282863 2:91627266-91627288 CAAACGAAGGGGTGGGCGCAAGG + Intergenic
937520623 2:122709151-122709173 CACAGGAAAGGGAGGCAGCCTGG + Intergenic
1168975916 20:1965874-1965896 CACAGGAGGTGGCGGCCGCGAGG - Intergenic
1169140893 20:3227035-3227057 CACACGAAGCCTCGGCCTCCCGG + Intergenic
1169325017 20:4668511-4668533 CATATGAAGGGGCGGCAGTCAGG + Intergenic
1176034304 20:63028912-63028934 CACACGGAGGCGCGGAGGCCCGG - Intergenic
1176034315 20:63028943-63028965 CACACGGAGGCGCGGAGGCCCGG - Intergenic
1176034335 20:63029005-63029027 CACACGGAGGCGCGGAGGCCCGG - Intergenic
1176034346 20:63029036-63029058 CACACGGAGGCGCGGAGGCCCGG - Intergenic
1176034357 20:63029067-63029089 CACACGGAGGCGCGGAGGCCCGG - Intergenic
1176034368 20:63029098-63029120 CACACGGAGGCGCGGAGGCCCGG - Intergenic
1176034379 20:63029129-63029151 CACACGGAGGCGCGGAGGCCCGG - Intergenic
1176034390 20:63029160-63029182 CACACGGAGGCGCGGAGGCCCGG - Intergenic
1176034401 20:63029191-63029213 CACACGGAGGCGCGGAGGCCCGG - Intergenic
1176034421 20:63029253-63029275 CACACGGAGGCGCGGAGGCCCGG - Intergenic
1176034432 20:63029284-63029306 CACACGGAGGCGCGGAGGCCCGG - Intergenic
1178561559 21:33643059-33643081 CCCGGGAAGGAGCGGCCGCCCGG - Intronic
1179574998 21:42302406-42302428 CACAGGCAGGGGCTGCCGGCTGG + Intergenic
1180130452 21:45823604-45823626 CACCCAAAGGGGTGGCCGACGGG + Intronic
1181085210 22:20436651-20436673 CAGCCGCAGAGGCGGCCGCCGGG - Intronic
1184523588 22:45009189-45009211 CTCACGAAGGGGCCCCCTCCAGG + Intronic
1184658822 22:45955927-45955949 TACAAGGAGGGGCTGCCGCCAGG + Intronic
1185285230 22:49997047-49997069 CAAAAGCAGGGGCGGCTGCCAGG + Exonic
1185319116 22:50192402-50192424 CACACGAGGGGGCTGCCCCGAGG - Intronic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
963027172 3:140931374-140931396 CACCCGAGGGGGCGGTCCCCAGG + Intergenic
968607003 4:1540290-1540312 AACAGGAAGGGGCTGCAGCCGGG - Intergenic
972532902 4:39977067-39977089 CACGCGCAGCGGCGGCTGCCGGG + Intronic
985574671 5:668455-668477 CACACGGAGAGGGGGCCGCGTGG + Intronic
990297743 5:54420600-54420622 TCCCAGAAGGGGCGGCCGCCGGG + Intergenic
1000345695 5:160312063-160312085 CGCAGGAGGGGGCGCCCGCCGGG - Intronic
1002044961 5:176536674-176536696 CAAAGGAAGTGGCGGCCGCAGGG + Intronic
1002195854 5:177500978-177501000 CAAAGGAAGAGGCGGCAGCCTGG + Intergenic
1015935708 6:138404421-138404443 CACACGCAGGCGGGGCGGCCCGG + Exonic
1018726559 6:166617043-166617065 CCCACGATGGAGCGGGCGCCCGG - Intronic
1018762202 6:166902387-166902409 CACACAGAAGGGCGACCGCCTGG + Intronic
1020790999 7:12628091-12628113 CAAACGAAGGAGAGGCTGCCAGG - Intronic
1029735765 7:102465032-102465054 CACACGCCGGGGTGGCCGACTGG + Exonic
1029896558 7:103989867-103989889 GACAGGGAGGGGCGCCCGCCGGG + Intergenic
1031406720 7:121395923-121395945 CCCACGCCGGGGCGGCGGCCGGG + Intronic
1034223010 7:149460217-149460239 CCCACGCAGGCCCGGCCGCCCGG + Intronic
1035404197 7:158587591-158587613 CGGACGAAGGGGCGGCAGGCAGG + Exonic
1038421926 8:27439052-27439074 CACACTCAGGGGAGGCCACCAGG - Exonic
1048919328 8:139213520-139213542 CCCAGGAAGAGGCGGCCGCGGGG + Intergenic
1057214027 9:93218404-93218426 CAGATGCAGGGGTGGCCGCCTGG + Intronic
1060965838 9:127711961-127711983 CCCACGGAGGGGCGGGCGGCGGG + Intronic
1061004686 9:127921836-127921858 CACACGGAGTGACGGGCGCCCGG - Exonic
1061290824 9:129649455-129649477 CACACGAAGGGGTGGGCCCAGGG + Intergenic
1061970442 9:134041990-134042012 CACACCAAGGGGCAGCCCCATGG - Intronic
1062607412 9:137354389-137354411 AACAGGAAGGGGCGGTTGCCAGG + Intronic
1200003612 X:153074081-153074103 CACAGGAAGGGGCCGGTGCCCGG + Exonic
1200004111 X:153075928-153075950 CACAGGAAGGGGCCGGTGCCCGG - Intergenic