ID: 1163577406

View in Genome Browser
Species Human (GRCh38)
Location 19:18118700-18118722
Sequence CTCCAAGAGCGGTGAGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163577406_1163577415 25 Left 1163577406 19:18118700-18118722 CCAAAGCCTCACCGCTCTTGGAG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1163577415 19:18118748-18118770 GAGAGGATAAGTGAGGGCTGTGG 0: 1
1: 0
2: 2
3: 48
4: 492
1163577406_1163577414 19 Left 1163577406 19:18118700-18118722 CCAAAGCCTCACCGCTCTTGGAG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1163577414 19:18118742-18118764 AAAGCAGAGAGGATAAGTGAGGG 0: 1
1: 0
2: 7
3: 63
4: 526
1163577406_1163577409 8 Left 1163577406 19:18118700-18118722 CCAAAGCCTCACCGCTCTTGGAG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1163577409 19:18118731-18118753 TCCCCTTTTGAAAAGCAGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 274
1163577406_1163577413 18 Left 1163577406 19:18118700-18118722 CCAAAGCCTCACCGCTCTTGGAG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1163577413 19:18118741-18118763 AAAAGCAGAGAGGATAAGTGAGG 0: 1
1: 0
2: 5
3: 58
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163577406 Original CRISPR CTCCAAGAGCGGTGAGGCTT TGG (reversed) Intronic
912686580 1:111772494-111772516 CTCTGAGAGCAGTGATGCTTTGG - Intronic
921480154 1:215655676-215655698 CTCCAAGAATGGTGACCCTTTGG + Intronic
923019684 1:230153735-230153757 CTCCAAGAGCGGAGTGGCCTCGG - Intronic
924438584 1:244067722-244067744 ATCCAGGAGCAGTGAGGTTTGGG + Intergenic
1066215083 10:33278515-33278537 CTGCAAGAGAGGTGAGGACTTGG - Intronic
1071681566 10:87711157-87711179 CTCCATGAGCTGTGTGACTTTGG + Intronic
1072762154 10:98065520-98065542 CCCGAAGAGCTGTAAGGCTTTGG + Intergenic
1073442445 10:103560378-103560400 CTCCCAGAGCAGTGAGGAATTGG + Intronic
1078174902 11:8963523-8963545 CTGCAAGAGAGGTGAGGTTGTGG - Intronic
1081800236 11:45853765-45853787 CCAGAAGAGTGGTGAGGCTTGGG + Intronic
1085182184 11:74545283-74545305 CTCCAAGAACGGCAAGGCCTTGG - Intronic
1086937898 11:92764510-92764532 CACCACCAGAGGTGAGGCTTAGG + Intronic
1091058496 11:132440593-132440615 CTCCAAGAACAGTGAGTCCTTGG - Intronic
1091860304 12:3775554-3775576 GTGCAAGAGCAGTGAGGCTAGGG - Intergenic
1095255754 12:40033908-40033930 CTTCAGGAGGAGTGAGGCTTGGG - Intronic
1095562436 12:43582225-43582247 ATACAGGAGTGGTGAGGCTTTGG - Intergenic
1101573481 12:105976526-105976548 AGCCAAGAGCTGTGTGGCTTGGG + Intergenic
1104750076 12:131232779-131232801 CTCCAAGAGCGGGTTGGCCTGGG - Intergenic
1119209985 14:72824290-72824312 CTCCAAGAGGGATGTGGGTTTGG + Intronic
1121110229 14:91307526-91307548 CTCAAACAGAGGTGAGGCTGAGG + Intronic
1122280480 14:100619550-100619572 CTCCCAGGGCTGTGAGGCTCAGG - Intergenic
1123941826 15:25220380-25220402 CTCTAAGTGCGCTGAAGCTTGGG + Intergenic
1126796950 15:52267223-52267245 CTCAAAGTATGGTGAGGCTTTGG + Intronic
1128461632 15:67872885-67872907 CTCCCAGAGTGTTGAGACTTTGG + Intergenic
1130202044 15:81841000-81841022 GTCCAAGTGCGGTGAGTTTTAGG - Intergenic
1132815973 16:1826736-1826758 CTCCCAGCGCGGCGAGGCTGCGG + Exonic
1139947043 16:70648623-70648645 CTCCAGGAGGGGTGGGTCTTAGG + Intronic
1141684506 16:85562601-85562623 GTCCAGGAGCTGTGTGGCTTGGG - Intergenic
1143957895 17:10688492-10688514 CACCAAGAGTGGTGATGCTGTGG + Intronic
1145049553 17:19648719-19648741 GGCCAATAGGGGTGAGGCTTTGG + Intronic
1147686636 17:42289901-42289923 CTCCAGGAGCTGGGTGGCTTGGG - Exonic
1148109389 17:45136222-45136244 GCCCAAGAACGGTGAGGCTGCGG + Exonic
1151304434 17:73253919-73253941 CTGCAAGGACGGTGAGGCCTTGG - Exonic
1152570496 17:81119368-81119390 GTCCAAGAGAGGTGAGGCCTGGG - Exonic
1159933157 18:74335026-74335048 CACCAAGAGAGATGAGACTTAGG - Intronic
1160879639 19:1313542-1313564 ATCCCAGAGCTGTGGGGCTTAGG - Intergenic
1162571924 19:11479321-11479343 GTCCAGGAGGGGAGAGGCTTAGG + Intronic
1163577406 19:18118700-18118722 CTCCAAGAGCGGTGAGGCTTTGG - Intronic
1165240254 19:34460903-34460925 CTCCAAGAGTGGGGAAGCCTTGG + Intronic
1167121645 19:47520941-47520963 CTTCTAGAGCAGGGAGGCTTGGG - Exonic
1168104926 19:54160792-54160814 GTCCAAGAGAGGAGAGGCTTGGG - Intronic
925091674 2:1161510-1161532 CTCCCAGTGCCGTCAGGCTTAGG + Intronic
929617607 2:43324345-43324367 CTCCCACAACTGTGAGGCTTGGG + Intronic
929992879 2:46804281-46804303 CTCCAAGAGCAGTCAGGCCGGGG + Intergenic
930848470 2:55931875-55931897 CTCCCAGACAGGTGAGGCTTGGG - Intergenic
932095266 2:68841908-68841930 CACCAATAGCAGTGAGACTTTGG - Intergenic
936182071 2:110275659-110275681 CTCCAAGAGCAGAGACACTTTGG + Intergenic
936230498 2:110696014-110696036 CTCCAAGAGCAGAGACACTTTGG - Intergenic
938757713 2:134396086-134396108 CTCCTAGAGAGGTAAGGGTTTGG + Intronic
938903877 2:135820746-135820768 CTCCAGGAGCGCTGAGGTTCTGG + Intronic
939839052 2:147165032-147165054 CTCCAAGGTGGGTGAGGCATAGG + Intergenic
941351290 2:164440436-164440458 CTCCCAGAGTGGTGAATCTTGGG + Intergenic
944837979 2:203598496-203598518 GCTCAAGAGCGGTGAGGTTTTGG - Intergenic
948105790 2:235412538-235412560 GTCCAAGGGAGGTGAGGCTTTGG - Intergenic
1175399083 20:58689855-58689877 CTACAGGACCCGTGAGGCTTTGG - Intronic
1175623080 20:60467261-60467283 CACCAAGGGAGGTGAGGCTGTGG - Intergenic
1175856674 20:62124219-62124241 CGCAATGTGCGGTGAGGCTTTGG + Intronic
1176994749 21:15542475-15542497 CTCCAAGAGCTCTGAGGTGTGGG - Intergenic
1178960270 21:37058695-37058717 CTCCAAGCCCTGTGAGCCTTTGG + Intergenic
1180392226 22:12294887-12294909 TTCCATGAGAGGTGAGGCTGAGG - Intergenic
1180407519 22:12569884-12569906 TTCCATGAGAGGTGAGGCTGAGG + Intergenic
1181324472 22:22034027-22034049 CTCCATGAGCAATGAGGCTGGGG + Intergenic
1183173179 22:36202874-36202896 CTCCAAGAGCTGTGCGACTCTGG - Intronic
1183178016 22:36238469-36238491 CTCCAAGAGCTGTGTGACTCTGG - Intronic
1183180086 22:36254135-36254157 CTCCAAGAGCTGTGTGACTCTGG + Intronic
1183387479 22:37523429-37523451 TTCCAAGAGTGGTGAGGATGAGG + Intergenic
1185208901 22:49555633-49555655 CTCCAAGAGCTGTGAGGGAAGGG - Intronic
951037212 3:17946783-17946805 CTACAAGAGCGTTTTGGCTTCGG + Intronic
952644384 3:35638875-35638897 CTCCAAGAGCGCTGAGGCTACGG + Intergenic
962932871 3:140053716-140053738 CCCCCTGAGCTGTGAGGCTTTGG + Intronic
967270136 3:187726186-187726208 TTGCAAGAGGGGTGGGGCTTGGG + Intronic
972346819 4:38199308-38199330 CTCCAGGAGCTGGGATGCTTGGG + Intergenic
975637355 4:76463676-76463698 TTCAAAGAGCAGTGGGGCTTTGG - Intronic
978516626 4:109575654-109575676 CTCCAAGAGAGGTTAGACTTTGG - Intronic
978892137 4:113842663-113842685 GTCCAAAAGCGGTCAGGCTGGGG + Intergenic
983016720 4:162622497-162622519 CTCCCAGATTGGTTAGGCTTTGG + Intergenic
983214432 4:164990191-164990213 CCTCAAGCGCGGTGAGGTTTGGG - Intergenic
988602031 5:32649114-32649136 CTCCAAGCCAGGTCAGGCTTTGG - Intergenic
988602122 5:32649716-32649738 CTCCAAGCCAGGTCAGGCTTCGG + Intergenic
989728404 5:44617462-44617484 CTCCAAAAGTGGGGAGGGTTGGG - Intergenic
991957036 5:72005179-72005201 CTGCAAGAGCAGTGAGCCTTGGG - Intergenic
992047917 5:72915329-72915351 TTTTAAGAGAGGTGAGGCTTGGG + Exonic
994256310 5:97600560-97600582 CTCCCAGAGCTGTGAGGTTTAGG + Intergenic
996397815 5:123031350-123031372 CTGCAGGAACGGTGAGGCTAAGG + Intronic
997199385 5:132000492-132000514 CTGCAAGATCTGTGAGGCTTAGG + Intronic
1000001448 5:157142631-157142653 CTCCGAGAGCGCGGAGGCCTCGG - Intronic
1001646901 5:173288818-173288840 CTACAAGAGCTGTGTGACTTTGG - Intergenic
1004065619 6:12241086-12241108 TTCCAAGAGCAGTAAGGATTGGG - Intergenic
1006838553 6:37013955-37013977 CCCCAAGAGCAGCGAGGCTTCGG + Exonic
1006876554 6:37302382-37302404 CTCCAAGAGCTTTTAGGCTTAGG + Intronic
1011167852 6:84469756-84469778 CTCCTAAAGAGGTCAGGCTTGGG + Intergenic
1011984115 6:93420142-93420164 CTCCAAGAGCCGTCAGTTTTAGG + Intergenic
1012452021 6:99362732-99362754 CCCCAGGAGAGGTGATGCTTGGG + Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1014250453 6:119110447-119110469 CTGCAAGAGAGGTGAGGCAATGG + Intronic
1018796260 6:167187642-167187664 ATCCAAGAGCTGTGAGCCTGTGG + Intronic
1025920306 7:65905854-65905876 CTACAAGCACGGTGAGGATTGGG - Intronic
1029127729 7:98306321-98306343 GTCCACGAGAGCTGAGGCTTAGG + Intronic
1029375525 7:100174840-100174862 CATCAAGAGCAGTGAGGGTTGGG + Intronic
1029797386 7:102909830-102909852 ATCGATGAGCTGTGAGGCTTGGG + Intronic
1032091688 7:128914639-128914661 CTCCAGGAGCTGCAAGGCTTTGG + Intergenic
1045030822 8:98134360-98134382 CTCCATGAGAGGTGAAGTTTTGG - Intronic
1045620358 8:103970345-103970367 CTCCCAGATTGGTTAGGCTTTGG + Intronic
1048289653 8:133171090-133171112 CTTGAAGAGAAGTGAGGCTTAGG - Intergenic
1048598824 8:135896798-135896820 CTCTCAGAGCTGTGGGGCTTGGG - Intergenic
1053043204 9:34892022-34892044 CTCCAAAACAGGGGAGGCTTTGG - Intergenic
1056738751 9:89234606-89234628 CTCCAGGAGCGGTTTGACTTGGG + Intergenic
1060724755 9:125999434-125999456 CCCCAAGACCGGTCAGGGTTGGG - Intergenic
1060944556 9:127562213-127562235 CTCCAAGAGAGGTAAGCTTTCGG - Intronic
1062217417 9:135396806-135396828 CTCCTAGTGCGGTGAGCGTTGGG - Intergenic
1186451726 X:9679713-9679735 CTGCCAGAGTGGTGAGACTTCGG - Intronic
1191668741 X:63729673-63729695 CTCAAAGAGCTCTGAGCCTTAGG + Intronic
1193978235 X:88150021-88150043 CTCCAAGAGCCTTGGGGCTCAGG - Intergenic
1200097566 X:153671344-153671366 CTCCAAGAGCTCTGGGGCTGGGG + Exonic
1200760984 Y:7039005-7039027 CTGCCAGAGTGGTGAGACTTTGG - Intronic