ID: 1163581037

View in Genome Browser
Species Human (GRCh38)
Location 19:18138892-18138914
Sequence CAGGGCAAAGGCTCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1685
Summary {0: 1, 1: 4, 2: 71, 3: 375, 4: 1234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163581037 Original CRISPR CAGGGCAAAGGCTCTGAGGT GGG (reversed) Intronic
900173629 1:1282329-1282351 CAGAGCCATGGCTCTGAGGAGGG - Intronic
900792971 1:4691756-4691778 CAAGGCAAGGTCTTTGAGGTCGG + Intronic
900811578 1:4805776-4805798 CAGGGCACAGGATATGAAGTGGG + Intergenic
900867773 1:5280696-5280718 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
900939158 1:5786744-5786766 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
901098733 1:6702790-6702812 CAGGAGAATGGCTCTGGGGTAGG - Intergenic
901099403 1:6707839-6707861 CAGGGCAAAGCCTTTGAGGCAGG + Intergenic
901102045 1:6726446-6726468 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
901115381 1:6839760-6839782 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
901129700 1:6954658-6954680 CAGGAGACAGGCTCTGAGCTCGG + Intronic
901145419 1:7061650-7061672 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
901167436 1:7230349-7230371 GAGGGCACAGGCTCAGAGCTGGG - Intronic
901336841 1:8456739-8456761 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
901434461 1:9238207-9238229 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
901675658 1:10882260-10882282 CAGTGCAAAGGCCCGGAGGCAGG - Intergenic
901690115 1:10967323-10967345 CAGTGCAAGGGCCCTGAGGCAGG - Intronic
901732593 1:11290988-11291010 CAGGTCAAAGGCTCAGGTGTTGG - Intronic
901839097 1:11942803-11942825 CAGGGCTAGGGGTCTGAGGTGGG - Intronic
901860017 1:12068358-12068380 CAGTGCAGAGGCCCAGAGGTAGG + Intronic
902150441 1:14438539-14438561 CAGTGCAAAGGCCCTGGGGCAGG + Intergenic
902183843 1:14710563-14710585 TAGTGCAAAGGCCCTGAGGTGGG - Intronic
902369225 1:15994877-15994899 CAGAGCCAAGGCCCTGAGGTGGG - Intergenic
902447055 1:16474205-16474227 CAGGGAAAAGGCCCTGAGGCGGG + Intergenic
902451058 1:16497519-16497541 CAGTGCAAAGGCCCAGAGGTGGG - Intergenic
902501799 1:16915835-16915857 CAGTGCAAAGGCCCAGAGGTGGG + Intronic
902513297 1:16977459-16977481 AGGTGCAAAGGCTCTGAGGGAGG - Intronic
902535048 1:17114821-17114843 AACTGCAAAGGCCCTGAGGTGGG + Intronic
902571756 1:17351769-17351791 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
902619420 1:17642306-17642328 AAGTACAAAGGCCCTGAGGTAGG + Intronic
902627573 1:17685390-17685412 CAGTGCAAAGGCCCGGAGGCAGG - Intronic
902744777 1:18466498-18466520 TCCAGCAAAGGCTCTGAGGTAGG - Intergenic
902774591 1:18666603-18666625 GTGGGCAAAGGCTTTGGGGTGGG + Intronic
902907069 1:19566215-19566237 CAGTGCAAAGGCCCTAAGGTAGG + Intergenic
903064611 1:20692199-20692221 CAGGGCAAAGGCCTTGGGGCAGG - Intronic
903188695 1:21644196-21644218 AGGTGCAAAGGCTCTGAGGCAGG - Intronic
903208856 1:21803923-21803945 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
903209873 1:21811933-21811955 GAGTGCAAAGGCCCTGAGGCAGG + Intergenic
903249581 1:22043092-22043114 AAGAGCAAAGCCTCTGAGCTAGG + Intergenic
903286337 1:22279332-22279354 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
903349101 1:22707416-22707438 AGAGGCAAAGGCCCTGAGGTGGG - Intergenic
903353022 1:22729585-22729607 CAGTGCAAAGGCCCTGTGGTGGG - Intronic
903471560 1:23591198-23591220 AAGTGCAAAGGCGTTGAGGTTGG - Intronic
903539261 1:24087536-24087558 AAGTGCAAAGGCCCAGAGGTGGG - Intronic
903543401 1:24109106-24109128 GTGGGCAAAGGCCCAGAGGTAGG - Intronic
903661165 1:24979731-24979753 ATGGGCAAAGGCTCAGAGGAGGG + Intergenic
903662842 1:24989263-24989285 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
903765149 1:25729226-25729248 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
903772532 1:25772883-25772905 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
903853688 1:26322950-26322972 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
903926008 1:26831246-26831268 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
903946964 1:26970088-26970110 TGGTGCAAAGGCCCTGAGGTTGG + Intergenic
903972156 1:27126037-27126059 AAATGCAAAGGCCCTGAGGTGGG - Intronic
904237404 1:29124025-29124047 CAGGTCAAAGGATCGCAGGTAGG + Intergenic
904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG + Intergenic
904316810 1:29671039-29671061 CAGGCCCTGGGCTCTGAGGTTGG - Intergenic
904355148 1:29933906-29933928 CAGGCCCTGGGCTCTGAGGTTGG - Intergenic
904377691 1:30092042-30092064 AAGTGCAAAGGCCCTGATGTAGG - Intergenic
904380553 1:30107650-30107672 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
904602055 1:31678958-31678980 CGGTGCAAAGGCCCAGAGGTGGG - Intronic
904799931 1:33085460-33085482 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
904850775 1:33457722-33457744 AAGTGCAAAGGCCCTAAGGTGGG - Intergenic
904863771 1:33560504-33560526 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
904888049 1:33756572-33756594 AAGGGCAAAGGCCCTGGGGTGGG + Intronic
904905875 1:33896883-33896905 ACGTGCAAAGGCCCTGAGGTGGG + Intronic
904910325 1:33929802-33929824 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
904921570 1:34012211-34012233 CAAGGGCAAGGCTCTGAGGTGGG - Intronic
904938126 1:34146193-34146215 CAGGGCACAGGTCCTGAGCTGGG - Intronic
904948296 1:34215231-34215253 AAGTGCAAGGGCTCTGAGGTGGG + Intronic
904989238 1:34578228-34578250 GAGTGCAAAAGCCCTGAGGTGGG - Intergenic
905035057 1:34912803-34912825 CAGGTCAGAGGCTCTGTGTTAGG - Intronic
905260612 1:36715612-36715634 CAGTGCAAAGGCGCAGAGGAGGG - Intergenic
905321716 1:37122315-37122337 AAATGCAAAGGCCCTGAGGTGGG + Intergenic
905410219 1:37763564-37763586 CATGGCAAATACTCTAAGGTTGG + Intronic
905451748 1:38061478-38061500 AAGTGCAAAGGCCCTGCGGTGGG + Intergenic
905726388 1:40255419-40255441 AAGTGCAAAGGCCCTGAGATTGG - Intergenic
905791900 1:40794166-40794188 CAGAGCAAAGGCCTTGAGATGGG + Intronic
905907908 1:41631903-41631925 CTGAGCCAAGGCTCAGAGGTAGG - Intronic
905937310 1:41834878-41834900 AAGTGCAATGGCCCTGAGGTGGG + Intronic
906123389 1:43410871-43410893 CCAGGCAAGGCCTCTGAGGTGGG + Intronic
906180649 1:43815569-43815591 AAGGGCACAGGCTCAGAGCTAGG + Intronic
906187629 1:43872947-43872969 CAGTGCAAAAGCTCTGAGGTGGG + Intronic
906582920 1:46951298-46951320 AAGCACAAAGGCTCTGGGGTGGG - Intergenic
906610472 1:47198433-47198455 AAGTGCAAAGGCCCTGAGGAAGG + Intergenic
906721082 1:48005278-48005300 CTGGGAAAAGGCCCAGAGGTGGG + Intergenic
906945349 1:50290044-50290066 CAGGCCACAGGCTCTGGGCTGGG - Intergenic
907077177 1:51589650-51589672 AAGTGCAAAGGCCCTGAGATGGG + Intronic
907266841 1:53267038-53267060 CTGAGCAAAGGCTCTGAGGCAGG - Intronic
907910462 1:58821423-58821445 AAGTGCAAATGCCCTGAGGTGGG + Intergenic
908241699 1:62194233-62194255 CAGTGCAAGGGCCCTGAGGCAGG + Intergenic
908342189 1:63193024-63193046 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
908545028 1:65153837-65153859 AAGTGCAAAGGCCCTAAGGTGGG + Intronic
908774412 1:67626290-67626312 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
908794723 1:67819789-67819811 CAGTGCAAAGGCACTGAGCTGGG - Intronic
908843052 1:68297830-68297852 CAGGGGAAGGGGGCTGAGGTGGG - Intergenic
909107590 1:71431942-71431964 TAGTGCTAAGGCCCTGAGGTAGG + Intronic
909430089 1:75577435-75577457 AAGTGCGAAGGCTCTGAGGCGGG - Intronic
909502083 1:76345867-76345889 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
909566874 1:77062417-77062439 AAGTGCAAAGGCCCTGAAGTAGG + Intronic
909818779 1:80031605-80031627 CTATGCAGAGGCTCTGAGGTAGG + Intergenic
910268778 1:85369934-85369956 CAGTGCAAAGGCCCTAAGGTGGG + Intronic
910433852 1:87185286-87185308 GTGTGCAAAGGCCCTGAGGTGGG - Intergenic
910708052 1:90150642-90150664 TAGGGAAAAGGCTAGGAGGTGGG - Intergenic
911230355 1:95354450-95354472 AAGAGCAAAGGCCCTGAGGTAGG - Intergenic
912096720 1:106153685-106153707 AAGTGCAAAGGCTCAGAGGTTGG - Intergenic
912496095 1:110092685-110092707 CAGGACAAAGTCCCTGAGGTGGG - Intergenic
912698505 1:111858877-111858899 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
912870283 1:113297994-113298016 AAGTGCAAAGGCTCTGAGGTAGG - Intergenic
912951139 1:114121287-114121309 CAGGGCCAAGGCTCCAAGGAGGG - Intronic
913066438 1:115260175-115260197 AAGACCAAAGGCTCTGAAGTTGG + Intergenic
913225332 1:116693856-116693878 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
913257012 1:116962935-116962957 CAGAGCTAAGGCTGGGAGGTAGG + Intronic
913325450 1:117624082-117624104 TAGGGCTAGGGCTCTCAGGTAGG + Exonic
913683464 1:121209023-121209045 CAGGGAAAAGGGGCTGAGGGAGG - Intronic
914035305 1:143996647-143996669 CAGGGAAAAGGGGCTGAGGGAGG - Intergenic
914154148 1:145071323-145071345 CAGGGAAAAGGGGCTGAGGGAGG + Intronic
914706217 1:150172034-150172056 AAGGGCAAAGGTCCTGAGGTGGG - Intergenic
914751613 1:150538519-150538541 CAGGGCACAGGGTTGGAGGTGGG - Intergenic
915189030 1:154133151-154133173 AATGGCAAAGGTTCTGAAGTAGG - Intronic
915272453 1:154764329-154764351 TAGGGAAAAGGCTCTCAGGCTGG + Intronic
915752599 1:158226273-158226295 GAGGTGGAAGGCTCTGAGGTGGG - Intergenic
915986624 1:160472316-160472338 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
916010812 1:160703840-160703862 CAGAGCAAAGGCCCTGGGGCAGG + Intronic
916170613 1:161998972-161998994 CAGAGAAAAGGCCCTGAGGCAGG + Intronic
916271487 1:162947480-162947502 AAGTGCAAAGGTTCTGAAGTAGG - Intergenic
916362312 1:163984449-163984471 CAGTACAAAGGCCCTGAGGCAGG + Intergenic
916447360 1:164885680-164885702 AAGGGCAAAGACCCTGAGGTAGG - Intronic
916499096 1:165371193-165371215 AAGTGCAAAGGCACTGAGGTGGG - Intergenic
916504418 1:165415232-165415254 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
916577000 1:166076353-166076375 AAGTGCAAAGGCCCTCAGGTGGG - Intronic
916667839 1:166982863-166982885 AAGTGCAAAAGCTCTGAGGTGGG - Intronic
916698439 1:167264894-167264916 AAGTGTAAAGGCCCTGAGGTGGG - Intronic
917030284 1:170682925-170682947 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
917277196 1:173343408-173343430 AAGTGCAAAGACTCTGAGGCAGG + Intergenic
917459733 1:175219550-175219572 CAGTGCAAAGACCCTGAAGTGGG - Intergenic
917539590 1:175899845-175899867 CAGTGCGAAGGCCCTGAGGCAGG + Intergenic
917861129 1:179145682-179145704 CAATGCAAAAACTCTGAGGTAGG + Intronic
918094537 1:181323921-181323943 CAGGGCTCAGGTTCTGAGGTTGG - Intergenic
918371533 1:183866533-183866555 CACGGGAAAGCCTCTGAGGCAGG + Intronic
918634883 1:186763962-186763984 CAGTGCAAAGGCCCAGAGGCAGG - Intergenic
919052699 1:192531278-192531300 AAGTACAAAGGCTCTGAGGAAGG + Intergenic
919122302 1:193356411-193356433 CAGGGATAAGGGCCTGAGGTGGG - Intergenic
919516578 1:198532769-198532791 AAGTGCAGAGGCCCTGAGGTGGG + Intronic
919613331 1:199774031-199774053 AGGAGCAAAGGCTCTGAGGTGGG + Intergenic
920049741 1:203156426-203156448 AAGTGCAAAGCCCCTGAGGTAGG + Intronic
920129300 1:203719317-203719339 CAAGGCAAAGGCAATGAGGGTGG - Intronic
920216670 1:204366006-204366028 AAGCGCCAAGGCTCTGAGGTGGG + Intronic
920439647 1:205971141-205971163 CAGAGCTGAGCCTCTGAGGTTGG + Intergenic
920470772 1:206227532-206227554 CAGGGAAAAGGGGCTGAGGGAGG - Intronic
920763937 1:208812806-208812828 CTGGACACAGGCTCTGAGGTGGG + Intergenic
920852238 1:209635931-209635953 CTGGACAAAGGCTCTGAGGAGGG - Intronic
921224614 1:213005842-213005864 CAAGGGAAAGGCCCTGAGGTTGG - Intronic
921337405 1:214102060-214102082 CAGCACAAAGGCACAGAGGTGGG + Intergenic
921364470 1:214360666-214360688 CAGAGCACAGGCTCTGAGTAAGG + Intronic
922204129 1:223431894-223431916 AAGGGCAAAGGCCCTGAGGTAGG + Intergenic
922507476 1:226134899-226134921 CAGTGCAGAGGCCCTGAGGTAGG - Intergenic
922731016 1:227948704-227948726 CAGGACACAGGCTCTGAGAAGGG - Intergenic
923091429 1:230744120-230744142 GAGGGAAAGGGCTCTGAGCTTGG - Intergenic
923150025 1:231224584-231224606 CAGTGCAAGGGCCCTGAGGCAGG - Intronic
923404254 1:233644685-233644707 GAGTGCAAAGGCCCTGAGCTAGG + Intronic
923610907 1:235492842-235492864 AAATGCAAAGGCCCTGAGGTAGG + Intronic
923620559 1:235575846-235575868 CAGGACACAGGCTCTCAGGCGGG - Intronic
923636364 1:235701163-235701185 CATCACAAAGGTTCTGAGGTGGG + Intronic
923676577 1:236085618-236085640 CAGTGCAAAGGCCCTGGGGCAGG + Intergenic
923850699 1:237790983-237791005 AAGGGCAGAGGCCCTGAGTTAGG - Intronic
924331357 1:242943910-242943932 AAGTGCAAAGGCTCTGAGGTGGG - Intergenic
924606144 1:245537233-245537255 CTGTGCAAAGGCCCTGAGATGGG + Intronic
924650025 1:245917531-245917553 CAGTGCACAGGCCTTGAGGTAGG - Intronic
924706799 1:246508878-246508900 CAGAGCCAAGGCCCTGAGGTGGG + Intergenic
1063285728 10:4685724-4685746 AAGCACAAAGGCTCTGAGGCTGG + Intergenic
1063439403 10:6060256-6060278 CAGGGGAAAGGGTGCGAGGTGGG + Intronic
1063639683 10:7817686-7817708 CTGGGAGAAGGCTCTGGGGTAGG + Intergenic
1063805330 10:9632772-9632794 CAGGGCAAATGCCCTAAGGCAGG + Intergenic
1063987958 10:11527264-11527286 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1064325175 10:14343733-14343755 CAGTGCAAAGGCTCTGAGGCAGG - Intronic
1064773608 10:18751104-18751126 CAGTGTACAGGCCCTGAGGTGGG - Intergenic
1065285247 10:24181366-24181388 CTGTAGAAAGGCTCTGAGGTGGG + Intronic
1065415737 10:25483336-25483358 CAGTGCAAGCGCTTTGAGGTGGG - Intronic
1065694860 10:28370342-28370364 GAGTGCAAAGGCCCTGGGGTAGG + Intergenic
1065890234 10:30115030-30115052 TGGGGCAGTGGCTCTGAGGTTGG - Intronic
1066482385 10:35809479-35809501 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1066654801 10:37687506-37687528 CAGAGCAAAGGCCCTGTGGCAGG + Intergenic
1066784423 10:38987439-38987461 CAGGGGAAAGGCTGGGAGGAGGG - Intergenic
1067039752 10:42942976-42942998 CAGAGCAAAGGCCCTGTGGCAGG + Intergenic
1067051276 10:43022788-43022810 AAGAGCACAGGCCCTGAGGTGGG + Intergenic
1067231878 10:44417857-44417879 TTGTGCAAAGGCCCTGAGGTAGG + Intergenic
1067462297 10:46466670-46466692 CACGGCAAAAGCCCTGAGGCTGG + Intergenic
1067624900 10:47917967-47917989 CACGGCAAAAGCCCTGAGGCTGG - Intergenic
1069507552 10:69014440-69014462 TGGAGCAAAGGCTGTGAGGTTGG + Intronic
1069557532 10:69407778-69407800 CAGGGGCCAGGCTCTGAGGAGGG - Intronic
1069623443 10:69852044-69852066 AAGTGCAAAGGCCCTGGGGTGGG - Intronic
1069717640 10:70531202-70531224 TTGGGCAGAGGCCCTGAGGTGGG + Intronic
1069891060 10:71652781-71652803 CAGGGCCACAGCTCTGAGGGTGG - Intronic
1069899418 10:71698601-71698623 TCGTGCAAAGGCTCTGAGCTGGG - Intronic
1069914738 10:71780488-71780510 AAGTGGAAAGGCACTGAGGTTGG + Intronic
1070546394 10:77456234-77456256 CAGTGCAAAGTCCCTGGGGTGGG - Intronic
1070645306 10:78198043-78198065 ATGTGCAAAGGCCCTGAGGTAGG + Intergenic
1070693957 10:78548032-78548054 CAGGGCAGAAGGTTTGAGGTAGG - Intergenic
1071010799 10:80938115-80938137 CAGGAAACAGGCTCTGAGATGGG - Intergenic
1071172146 10:82878929-82878951 CAGGACAAAGGCCCTGGGGTAGG - Intronic
1071203640 10:83249655-83249677 GAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1071416205 10:85444343-85444365 CAGGGCAAAGGCCCTGACCCAGG + Intergenic
1071476710 10:86031865-86031887 CAGTGCAAAGACTCTGAGCAGGG - Intronic
1071809900 10:89168075-89168097 CTGGGCAAAGGCTGTGAGTTGGG - Intergenic
1071987516 10:91067337-91067359 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1072235265 10:93448149-93448171 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1072547175 10:96448735-96448757 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1072658258 10:97345791-97345813 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1072728089 10:97827087-97827109 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1072728830 10:97831178-97831200 CCCAGCAAAAGCTCTGAGGTTGG - Intergenic
1072740694 10:97907390-97907412 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1072787405 10:98293646-98293668 CAGAGCAATGGCACCGAGGTTGG + Intergenic
1072868350 10:99088355-99088377 CAGGGGAAAGGGTAGGAGGTAGG - Intronic
1072897835 10:99382082-99382104 CAGGGCGAAGCCCCTGTGGTTGG + Intronic
1073082168 10:100867130-100867152 AAGGGCAAGTTCTCTGAGGTTGG - Intergenic
1074049017 10:109865975-109865997 GATGGCAAAAGCTCTGAGGCAGG + Intronic
1074828706 10:117233029-117233051 CTGAGCAAAGGCCCTGGGGTAGG + Intergenic
1074859028 10:117496254-117496276 GAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1074936909 10:118190815-118190837 CATTGCAAAGGCTCTAGGGTGGG + Intergenic
1075114398 10:119613764-119613786 AAGGGCAAAGGCCCTGGGGTGGG - Intergenic
1075220654 10:120581639-120581661 CTGTGGAAAGGCTCTGAGGTGGG - Intronic
1075302277 10:121335585-121335607 AAGTGCAAAGGCCCTGGGGTGGG - Intergenic
1075341919 10:121653782-121653804 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1075495634 10:122916396-122916418 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1075851885 10:125595651-125595673 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1076356214 10:129855568-129855590 CAAGGCGGAGGTTCTGAGGTCGG + Intronic
1076741673 10:132488713-132488735 CATGGCAGAGGCTCAGTGGTGGG + Intergenic
1077046959 11:551008-551030 CAGGGCAGGGGCCCAGAGGTGGG - Intronic
1077383296 11:2257423-2257445 CAGGGCCAAGGCTGTGGGGAGGG - Intergenic
1077465049 11:2729970-2729992 CACAGCAAAGGCCCTGAAGTGGG + Intronic
1077694228 11:4379016-4379038 CATGGAAATGACTCTGAGGTGGG - Intergenic
1078401252 11:11029301-11029323 CAGGGAAGAGGCTCTGAAGAGGG + Intergenic
1078458802 11:11497072-11497094 AGGTGCAAAGGCCCTGAGGTGGG - Intronic
1078838552 11:15055875-15055897 AAGTGCAAAGGCTCTGGAGTGGG + Intronic
1078885565 11:15496516-15496538 AAGTGCAAAGGCCTTGAGGTAGG - Intergenic
1079085596 11:17442736-17442758 GATGGCAAAGGCCCTGAGGCTGG + Exonic
1079153141 11:17919728-17919750 CAGTGCAAAGGCCCTAAAGTGGG - Intronic
1079299370 11:19263950-19263972 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1079300848 11:19277695-19277717 GAGGGCAAAGGGTGTCAGGTCGG + Intergenic
1079341820 11:19617880-19617902 AAGTGCAAAGGCCCTGAAGTGGG - Intronic
1079364072 11:19793829-19793851 CAAGGCAAAGGCCCTGAGGTGGG - Intronic
1080169323 11:29280513-29280535 CAGGGAAAAGGGACTGAGGCTGG + Intergenic
1080368666 11:31608967-31608989 CAGGGCCAAGGAGCTGTGGTAGG + Intronic
1080371855 11:31657197-31657219 CTGTGCAAAGGCACTGAGGCAGG - Intronic
1080461022 11:32455144-32455166 CATGTCAAAGGCCCTGAGGCAGG + Intergenic
1080516384 11:33025196-33025218 AAGAGCAAATGCCCTGAGGTGGG - Intronic
1080616479 11:33949111-33949133 CAGTGCAGAGGCCCTGAGATAGG + Intergenic
1080799635 11:35598292-35598314 AAGGGCAAAAGCCCTGAGATGGG - Intergenic
1080851535 11:36074457-36074479 GAGTGCAAAGGCCCTGAGGTGGG + Intronic
1080954882 11:37081816-37081838 AAGGGCAAAAGCTCTAAGGTGGG + Intergenic
1081109506 11:39117249-39117271 AAGTGCAAAGGCTCTGAGACAGG - Intergenic
1081274343 11:41129049-41129071 CCTGACAAATGCTCTGAGGTGGG + Intronic
1081607134 11:44534397-44534419 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1081686472 11:45046768-45046790 CTGACCAAAGGCTCAGAGGTGGG + Intergenic
1081750877 11:45510394-45510416 AAGAGCAAAGGCTCAGAGGGAGG + Intergenic
1082743223 11:56934473-56934495 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1082762477 11:57141271-57141293 CAGTGCATAGGCCCTGGGGTAGG + Intergenic
1082765180 11:57162066-57162088 AGGTGCAAAGGCTCTGAGATGGG - Intergenic
1082842174 11:57698736-57698758 CAGGGCACAGGCTTTGAGCTGGG + Exonic
1082851762 11:57771518-57771540 AAGTGCAAAGGCCCTGAGGCTGG + Intronic
1082913227 11:58400948-58400970 AAGTGCACAGGCCCTGAGGTTGG + Intergenic
1083228504 11:61300087-61300109 CAGGGCAAAGCCTTTGGGGAGGG + Exonic
1083253104 11:61481189-61481211 CTCTGCAGAGGCTCTGAGGTCGG - Exonic
1083275039 11:61592125-61592147 CAGTGCAAAGGCTGTAGGGTGGG + Intergenic
1083328860 11:61887631-61887653 TAGAGCAAAGGCTCAGAGGTGGG - Intronic
1083339619 11:61950560-61950582 CTGTGCAAATGCCCTGAGGTGGG + Intronic
1083346779 11:61999186-61999208 AGGGGCAAAGGCTGTGAGCTGGG - Intergenic
1083613029 11:64013436-64013458 CAGGGCAAAGGCCCGGAGGCAGG + Intronic
1083647957 11:64184067-64184089 CAGTGCAAAGGGCCTGGGGTGGG - Intergenic
1083661638 11:64254194-64254216 CTGGGAAGAGGCTTTGAGGTAGG + Intronic
1083904371 11:65660487-65660509 AAGTGCAAAGGCCTTGAGGTGGG - Intronic
1083944825 11:65917982-65918004 CAGCCCACAGGCTCTGAGTTGGG + Exonic
1083968700 11:66059083-66059105 CAGGGAAGGGGCTCAGAGGTGGG + Intronic
1084107299 11:66988452-66988474 AAGTGCAAAGGTCCTGAGGTGGG - Intergenic
1084294430 11:68202347-68202369 AAGTGCAAAGGCCCTGTGGTGGG - Intronic
1084315176 11:68341677-68341699 CTGGGCAAAGGTCCTGGGGTGGG - Intronic
1084360051 11:68663420-68663442 CAGGGCTGAGGCCCTGAGGAGGG - Intergenic
1084430535 11:69108311-69108333 CTGGACAAAGGCCCTGAGGCTGG - Intergenic
1084493730 11:69491938-69491960 CAGTGCAAAGGCCCCGAGGCAGG + Intergenic
1084512941 11:69617428-69617450 CAGTGCAAGGGCCCTGAGGCAGG + Intergenic
1084639027 11:70413414-70413436 CAGGGCCAGTGCTTTGAGGTAGG + Intronic
1084767889 11:71324313-71324335 CTGTGCAAAGGCCCTGAGGCTGG + Intergenic
1084977520 11:72810755-72810777 CAGGGCAAAGCCTCCAAGGTGGG + Intergenic
1085044564 11:73345472-73345494 GAGGGCAAGGGATCTGAAGTGGG + Intronic
1085272225 11:75277204-75277226 CAGGGCAAAGCTTTTGAGTTGGG - Intronic
1085376826 11:76071333-76071355 AAGGGCAAAGTCCCTGAGGTAGG + Intronic
1085447009 11:76607647-76607669 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1085469732 11:76749871-76749893 CATGGTAAAGGCTCTAAGGTGGG - Intergenic
1085477224 11:76796215-76796237 CAGGGGCAAGTCTCGGAGGTTGG - Exonic
1086271929 11:85078399-85078421 AAGTGTAAAGGCTTTGAGGTAGG + Intronic
1086701085 11:89901040-89901062 CAGGGCAGAGGCTCTGGGTTGGG + Intergenic
1086705082 11:89943487-89943509 CAGGGCAGAGGCTCTGGGTTGGG - Intergenic
1087006532 11:93477396-93477418 CAGGGCAGATGCTGTGAGGATGG - Intergenic
1087218466 11:95520101-95520123 CTGTGCAAAGGCCCTGTGGTGGG - Intergenic
1087266457 11:96066880-96066902 AAGAGCAAAGACTCTGAGATGGG + Intronic
1088706528 11:112468916-112468938 AAGAGCAAAGACGCTGAGGTGGG - Intergenic
1088891050 11:114044464-114044486 AAGTGCCAAGGCCCTGAGGTGGG + Intergenic
1088979403 11:114848302-114848324 CAGGGCAGAGGCTGTGAAGTAGG + Intergenic
1089221157 11:116873151-116873173 CTGGGAGAAGGCTCTGAGTTAGG + Intronic
1089338486 11:117741987-117742009 CTGGGCAAATGCTCTCAGGGAGG + Intronic
1089409911 11:118232173-118232195 TGGTGCAAAGGCTCTGAGGAGGG - Intronic
1089676329 11:120092492-120092514 CAGAGCAAAGGCTCTGAGAAGGG + Intergenic
1090109205 11:123886710-123886732 CTGGGAAAAGGCTCTGAGGCAGG + Intergenic
1090589717 11:128252157-128252179 AAGTACAAAAGCTCTGAGGTGGG - Intergenic
1091267385 11:134281834-134281856 CTGTGCAGAGGCTCTGAGGCTGG + Intronic
1091275146 11:134344843-134344865 CTGTGCAGAGGCTCTGAGGCTGG + Intronic
1091813966 12:3422044-3422066 TAGGGAAAAGGCTCTGATCTGGG + Intronic
1091906045 12:4189835-4189857 AGGGGCAAAGGCCCTGAGATGGG + Intergenic
1091978300 12:4844526-4844548 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
1091979274 12:4852651-4852673 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1092056991 12:5515711-5515733 CAGTGCAAAGGCACTAAGGTAGG - Intronic
1092173729 12:6389262-6389284 CAGTGCAAAGACCCTGAGGCAGG + Intronic
1092182008 12:6452437-6452459 CAGGGGAAAGGCTCAGCGGCTGG + Intronic
1092219282 12:6701578-6701600 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1092236790 12:6815437-6815459 CAGGGGACAGGATCTGGGGTAGG - Intronic
1092269641 12:7013212-7013234 GTGTGCAAAGGCTCTGAGGTAGG + Intronic
1092387178 12:8044757-8044779 CAGGGCACAGGATCTGTGGATGG + Exonic
1092459960 12:8677728-8677750 AAGGGCAAAGGTTCTGGGGTGGG - Intergenic
1092762228 12:11820586-11820608 AAGTCCAAAGGCCCTGAGGTGGG + Intronic
1092896039 12:13011283-13011305 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
1092953546 12:13529362-13529384 CAGTGCAAAGGCTCTGTGAAAGG - Intergenic
1093234588 12:16591249-16591271 CAGTACAAAGGCCCTGAGGTGGG - Intronic
1093778049 12:23100167-23100189 CAGGGCAAAGGCCCTGCCTTGGG + Intergenic
1093959893 12:25260672-25260694 AGGTGCAAAGGCCCTGAGGTAGG - Intergenic
1094213984 12:27921373-27921395 CAGAGCAAAGATGCTGAGGTGGG - Intergenic
1094314990 12:29129870-29129892 CAGGGCACAGGATGTGAAGTTGG + Intergenic
1094449295 12:30567291-30567313 AAGGGCAAAGTCCCTGAGGCTGG - Intergenic
1094493346 12:30975040-30975062 CAGGGCAAAGGCCCAAAGGCTGG + Intronic
1094756247 12:33472118-33472140 TTAGGCAAAGACTCTGAGGTTGG + Intergenic
1095335951 12:41026627-41026649 CAGGGCATAGGTTCTGAGTAAGG + Intronic
1095882286 12:47150693-47150715 AAGTACAAAGGCACTGAGGTAGG + Intronic
1095926380 12:47583718-47583740 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1096150091 12:49304126-49304148 TAGGGGGCAGGCTCTGAGGTTGG + Intergenic
1096330482 12:50707958-50707980 AAGCGAAAAGGTTCTGAGGTAGG - Intronic
1096551065 12:52371935-52371957 CAGGGCACAGGCCCTGAGTCAGG - Intergenic
1097072021 12:56362012-56362034 CAGGACAAGGGGTCTGAGGAGGG + Exonic
1097226822 12:57481855-57481877 CAGGGCACAGGATCTCAGATAGG - Intronic
1097341327 12:58441677-58441699 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1097626211 12:62003406-62003428 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
1097790104 12:63806510-63806532 AAGAGCAAAGGCCCTGAGGCAGG + Intronic
1098249973 12:68559444-68559466 AAGGACAAAGGCCCTGAGGTAGG + Intergenic
1098307939 12:69119985-69120007 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1098358310 12:69631380-69631402 CAGAGCAGAGGCTCTGAGTCAGG - Intergenic
1098855632 12:75650289-75650311 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1099085029 12:78235287-78235309 AAGGGCAAAGGCCCTAAGTTTGG + Intergenic
1099928721 12:89049515-89049537 AAATGCAAAGGCCCTGAGGTAGG - Intergenic
1100230008 12:92597456-92597478 GCTGGAAAAGGCTCTGAGGTGGG + Intergenic
1100364151 12:93903983-93904005 GAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1100364261 12:93904684-93904706 GAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1101008598 12:100426942-100426964 AAGGGCAAAGGCCCTGAAGGGGG + Intergenic
1101139722 12:101782844-101782866 CATTGCAAAGGCCCTGAGGCAGG - Intronic
1101362867 12:104044146-104044168 CGTGGCCAAGGCTCTGAGGCAGG - Intronic
1101407133 12:104438600-104438622 CAGCACAAAGGCTCTAAGGCAGG - Intergenic
1101422368 12:104560073-104560095 AAGGACAAAGGCTCAGAGTTGGG + Intronic
1101563145 12:105879375-105879397 AAGTGCAGATGCTCTGAGGTAGG + Intergenic
1101565616 12:105902186-105902208 CAGGGAAAAGCCCATGAGGTTGG - Intergenic
1101680984 12:106965173-106965195 AAGAGCAAAGGCCCTGATGTGGG - Intronic
1101690812 12:107078917-107078939 AAGGGGAAAGGCTATGAGGAAGG - Intronic
1101718851 12:107334007-107334029 CAGTGTAAGGGCACTGAGGTGGG + Intronic
1101725655 12:107386104-107386126 CAGGGCAAAGGCCCTGAGGCAGG - Intronic
1101733200 12:107443506-107443528 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1101772660 12:107765940-107765962 AAGAGCAAAGGCCCTGAGGCAGG + Intergenic
1101788573 12:107908387-107908409 CAGAGCACAGGCTCTGGGGCAGG - Intergenic
1101804506 12:108051663-108051685 CAGTGCAAATGCCCTGAGGCAGG - Intergenic
1101876961 12:108602510-108602532 GCGTGCAAAGGCCCTGAGGTGGG + Intergenic
1102029817 12:109733768-109733790 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1102158129 12:110746727-110746749 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1102189565 12:110976773-110976795 AAGTGCAAAGGCTCAGAGGCAGG + Intergenic
1102199553 12:111047978-111048000 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1102207297 12:111099240-111099262 CTGGCCAAAGGCTCGGAGGTGGG + Intronic
1102234904 12:111288208-111288230 TCGTGCAAAGGGTCTGAGGTGGG + Intronic
1102278684 12:111601145-111601167 GAGGGCAAAGGCTCTGAGGGGGG + Intergenic
1102330050 12:112021257-112021279 AAGTGCAAAAGCTCTGAGGCAGG - Intronic
1102380927 12:112466311-112466333 AAGTGCAAAGGCCCTGAAGTGGG + Intronic
1102396365 12:112589460-112589482 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1102400831 12:112628267-112628289 AAGTGCAAAGGCCCTGAGGTTGG + Intronic
1102454023 12:113060513-113060535 CAGTGCAAAGGCCCTGGGGTAGG + Intronic
1102459072 12:113089144-113089166 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1102477456 12:113197880-113197902 AGGTGCAAAGGCCCTGAGGTAGG + Intronic
1102523837 12:113496788-113496810 CAGTGCAAAGGCCCAGAGGTAGG - Intergenic
1102527682 12:113523684-113523706 AAGGGCAAAGGCCCTGAGGTAGG - Intergenic
1102528307 12:113527748-113527770 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1102544343 12:113643779-113643801 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1102553924 12:113713333-113713355 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1102555440 12:113723793-113723815 CAGTGCAAAGGCCCTGCGGTGGG + Intergenic
1102570844 12:113826060-113826082 CAGGTGCAAGGCCCTGAGGTGGG - Intronic
1102633798 12:114304816-114304838 AAGTGCAAAGTCCCTGAGGTGGG - Intergenic
1102636787 12:114331567-114331589 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1102807456 12:115794470-115794492 CAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1102914045 12:116739643-116739665 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1102987623 12:117291319-117291341 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1103015986 12:117494904-117494926 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1103197394 12:119056638-119056660 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103201667 12:119092970-119092992 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1103219179 12:119229316-119229338 CAGTGCAAAAGCCCTGAGGTAGG + Intergenic
1103361034 12:120353777-120353799 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1103499210 12:121387964-121387986 CTGTGCAAAGGCCCAGAGGTAGG + Intronic
1103697767 12:122830964-122830986 ATGTGCAAAGGCTCTGAGGTGGG + Intergenic
1103719847 12:122967340-122967362 AAGTTCAAAGGCTCTGAGGTGGG + Intronic
1103799599 12:123529080-123529102 TAGTGCAAAGGTCCTGAGGTAGG - Intronic
1103937312 12:124483471-124483493 TCGGGCAAAGGCTTGGAGGTGGG - Intronic
1103943745 12:124514848-124514870 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1103955731 12:124575807-124575829 CAGTGCAAAGGCCCTGGGGTGGG + Intergenic
1103956119 12:124577844-124577866 AAGTGCAAAGGCCCTCAGGTAGG + Intergenic
1103994309 12:124819273-124819295 CTGTGCAAAGGCCCTGTGGTAGG + Intronic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1104047022 12:125170676-125170698 GAGTGCAAAGGCCCTGATGTGGG + Intergenic
1104085803 12:125473173-125473195 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1104247457 12:127057240-127057262 CAGTGCAGAGGCCCTGGGGTTGG + Intergenic
1104386508 12:128355741-128355763 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1104475333 12:129066419-129066441 ATGGGCAAAGGCCTTGAGGTGGG + Intergenic
1105039386 12:132949788-132949810 CAGAGCAAGGACACTGAGGTAGG + Intronic
1105210746 13:18255434-18255456 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1105899085 13:24741267-24741289 CAGGGCAGGGGCTGTGAGGATGG + Intergenic
1106555821 13:30807618-30807640 AAGTGCAAAGGCACTGGGGTAGG + Intergenic
1106756929 13:32830888-32830910 GAGGGCAGAGGCCTTGAGGTGGG + Intergenic
1106795236 13:33198369-33198391 TAGGGCCAAGGCTCTGATGCTGG - Intronic
1106898966 13:34334858-34334880 CAGGGCAAAGGCCATGTGGTAGG + Intergenic
1106920077 13:34553734-34553756 CAGGGCACAGGCTCTGGAGTGGG + Intergenic
1106991924 13:35429768-35429790 CAGGGGAAAGGGTGGGAGGTGGG - Intronic
1107149880 13:37098808-37098830 AAGGGCAAAGGCTCTGAAACAGG - Intergenic
1107349952 13:39503272-39503294 CAGTGCAAAGGCACAAAGGTGGG - Intronic
1107409180 13:40142538-40142560 AAGTGCAAAGGTCCTGAGGTAGG - Intergenic
1107666622 13:42697337-42697359 AAGTGCAAAGGCTCTAAGGCAGG + Intergenic
1108081507 13:46741907-46741929 CAAGGCAAAGGCTCAAAGGTAGG - Exonic
1108224063 13:48269614-48269636 AAGTGCAAAGGCTCTGAAGCAGG - Exonic
1108974800 13:56425868-56425890 AAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1109292200 13:60490370-60490392 CATGGCAAAGGCTCTAAAGCAGG + Intronic
1109689537 13:65867618-65867640 AAAGGCAAAGGATCTGAGGCAGG + Intergenic
1110270494 13:73584194-73584216 CAGCATAAAGGCCCTGAGGTAGG + Intergenic
1111690434 13:91556814-91556836 CAGGGGAAAGGGTGTGAGGGGGG + Intronic
1113295140 13:108951426-108951448 GAGGGCAAAGGCTGTGGGGTTGG + Intronic
1113466974 13:110519824-110519846 AGGGGCAATGGCTCTGAGCTCGG - Intergenic
1113788836 13:113016693-113016715 CTGTGCAAAGGCCCCGAGGTTGG - Intronic
1113979371 13:114260900-114260922 CATGCCATAGGCTCTGAGCTAGG + Intronic
1114297134 14:21340120-21340142 AAGTGTAAAGGCCCTGAGGTAGG + Intronic
1114734830 14:25033572-25033594 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1115044096 14:28968626-28968648 AGGTGCAAAGGCACTGAGGTAGG + Intergenic
1115160110 14:30384267-30384289 CAGATCACAGGCTCAGAGGTTGG + Intergenic
1116076645 14:40119505-40119527 CCTGGCAGGGGCTCTGAGGTGGG - Intergenic
1116385764 14:44327803-44327825 TAGGGCAAAGGGAGTGAGGTGGG + Intergenic
1117012328 14:51483507-51483529 CAGGGCAAAGTCTCTAAGATTGG + Intergenic
1117099649 14:52333412-52333434 CAGGGCAATGACCCTGAGATGGG - Intergenic
1117292219 14:54344829-54344851 AAGTGCAAAGCCTCTGAGGAAGG - Intergenic
1117336228 14:54759364-54759386 AAGGGCAAAGGCTCTGAGGGGGG - Intronic
1117339920 14:54784119-54784141 CGGTGCAAAGGCCGTGAGGTAGG + Intronic
1117555606 14:56880046-56880068 GAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1117573966 14:57079007-57079029 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
1117742228 14:58830664-58830686 AAGTGCAAATGCTCTGAGGTGGG + Intergenic
1117828711 14:59729169-59729191 TAATGCAAAGGCTCAGAGGTGGG + Intronic
1117830051 14:59741219-59741241 CAGTGCAAAGGCCCTGAGCTGGG - Intronic
1117830868 14:59748365-59748387 TAGTGCAAAGCCGCTGAGGTAGG - Intronic
1118031521 14:61822576-61822598 CAGTGCAACAGCTCTCAGGTTGG - Intergenic
1118163462 14:63313679-63313701 AAGTGCAAAGGCCCTGAGCTGGG - Intronic
1118438497 14:65792241-65792263 CTGGGCAAAGCCCCTGAGGTGGG + Intergenic
1118701459 14:68437940-68437962 TTGAACAAAGGCTCTGAGGTGGG + Intronic
1118978017 14:70694017-70694039 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1119433077 14:74581001-74581023 AAGTGCCAAGGCCCTGAGGTGGG + Intronic
1119521287 14:75287755-75287777 CAGTGCAAAGTCTCTGAAGGGGG + Intergenic
1119557586 14:75565549-75565571 ATGTGCAAAGGCTCTGAGGTAGG - Intergenic
1119617167 14:76106531-76106553 TAGTGCAAAGGCCCTGGGGTGGG - Intergenic
1119644241 14:76337053-76337075 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1119891956 14:78189547-78189569 CGGGACAAAGGCTTGGAGGTGGG - Intergenic
1119897245 14:78230654-78230676 AATTGCAAAGACTCTGAGGTTGG + Intergenic
1119935112 14:78585268-78585290 CAGTGCAAAGGACCTGAGGTGGG + Intronic
1120109775 14:80540416-80540438 CAGGGCCAAGGCCCTAAGGAGGG + Intronic
1120823635 14:88935542-88935564 AAGTGCAAAGGCCTTGAGGTAGG - Intergenic
1121008775 14:90507666-90507688 CTGAGCAGAGGCACTGAGGTGGG - Intergenic
1121241941 14:92437264-92437286 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1121307874 14:92918170-92918192 CAGTGCAAAGGCCCTGGGGCGGG - Intergenic
1121307886 14:92918203-92918225 CAGTGCAAAGGCCCTGGGGTGGG - Intergenic
1121490619 14:94356546-94356568 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1121502921 14:94452728-94452750 CAGAGCAAAGGCACTGAGCAGGG + Exonic
1121554278 14:94824534-94824556 AAGTGCAAAGGCCCTGAGGGAGG + Intergenic
1121598086 14:95181121-95181143 CAGTGCAAAGGCACTGAGGCAGG - Intergenic
1121613325 14:95295774-95295796 AAGTGCAAAGGTCCTGAGGTAGG - Intronic
1121740970 14:96252194-96252216 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
1121824218 14:96997492-96997514 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1121827002 14:97018614-97018636 GAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1121849193 14:97203986-97204008 CCATGCAAAGGCTCTGAGGCGGG - Intergenic
1121851920 14:97229102-97229124 CAGAACAAAGTCTCTGAGTTAGG + Intergenic
1122283298 14:100636814-100636836 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1122289408 14:100672118-100672140 GCGTGCAAAGGCCCTGAGGTGGG + Intergenic
1122354157 14:101113276-101113298 CAGGGCAGAAGCTCAGAGCTGGG + Intergenic
1123110921 14:105866519-105866541 CAAGGCAAAGGCTGGGAGGCTGG + Intergenic
1123450488 15:20356806-20356828 CAGGGCGAAGGCCCGGAGGAGGG - Intergenic
1124720089 15:32104275-32104297 CAGTGCAAAGGCCCTGAGGGGGG - Intronic
1124720361 15:32106174-32106196 CAGGGCCAGGGTTCTGAGGGGGG + Intronic
1124893411 15:33754442-33754464 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1125076735 15:35628155-35628177 CAATGCAAAGGCCCTGATGTGGG + Intergenic
1125179904 15:36870800-36870822 ATGTGCAAAAGCTCTGAGGTAGG + Intergenic
1125325207 15:38529414-38529436 AAATGCAAAGGCCCTGAGGTAGG - Intronic
1125335598 15:38623186-38623208 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1125354725 15:38804969-38804991 CAATGCAAAGGCTCTGAGCCTGG + Intergenic
1126534579 15:49747521-49747543 CAGTACAAAGGCTCTGAGGCAGG + Intergenic
1126758246 15:51945400-51945422 AAGTGCATAGGCCCTGAGGTGGG - Intronic
1127146290 15:56027504-56027526 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1127248996 15:57209892-57209914 AAATGCAAAGGCCCTGAGGTAGG - Intronic
1127381023 15:58430597-58430619 CTGTGCAAAGGCCCTGAGGTAGG - Intronic
1127917009 15:63463184-63463206 CAGGACAAAGGAGCTGGGGTGGG + Intergenic
1128317574 15:66670952-66670974 AAGGGCAAAGGCCCTGAGGTGGG + Intronic
1128368580 15:67022778-67022800 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1128369862 15:67032766-67032788 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1128425437 15:67537942-67537964 AAATGCAAAGGCCCTGAGGTGGG + Intergenic
1128515671 15:68340410-68340432 TTGTGCAAAGGCTCTGAGGCTGG + Intronic
1128705185 15:69832932-69832954 CAGTGCAAAGGCCCTGAGCTGGG - Intergenic
1128727626 15:69999550-69999572 AAAGGCCAAGGCCCTGAGGTGGG - Intergenic
1128765460 15:70248490-70248512 GAGGACAAAGGCTCTTAGGCAGG - Intergenic
1128946179 15:71823242-71823264 CAGCCCACAGGCACTGAGGTGGG + Exonic
1129052391 15:72793310-72793332 CAGAGCAAAGACTCTTAGGAAGG - Intergenic
1129064022 15:72885953-72885975 CAGAGCAACGGTTCAGAGGTTGG + Intergenic
1129168491 15:73793375-73793397 CAGTGCAAAGGCCGAGAGGTGGG - Intergenic
1129266035 15:74393627-74393649 CAGGGCAAAGGCCCGGGGCTGGG - Intergenic
1129516654 15:76161374-76161396 GTGGGCAGAGGCACTGAGGTGGG + Intronic
1129666063 15:77579992-77580014 AAGTGCAAAGGCCCTGAGGCGGG - Intergenic
1129703775 15:77783030-77783052 CAAGGCAAAGGCTGGGAGGTGGG - Intronic
1129756052 15:78099829-78099851 CAGTGCAGAGGCCCTGAGGTGGG - Intronic
1129938816 15:79476151-79476173 CAGTGAAAAGGTCCTGAGGTGGG + Intergenic
1130059285 15:80558054-80558076 ATGTGCAAAGGCCCTGAGGTTGG - Intronic
1130905150 15:88234929-88234951 CAGTGCAACGCCTCTCAGGTTGG - Intronic
1131078334 15:89513280-89513302 CAGAGCAAAGGCCCTGAGAGGGG + Intergenic
1131246213 15:90795976-90795998 TAGAGCAAAGGCCCTAAGGTGGG + Intronic
1131255313 15:90858245-90858267 CAGTGCAAAGGCCCTGTGGCAGG + Intergenic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1131380697 15:91961599-91961621 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1131439275 15:92446802-92446824 AAGTGCAAAGGCCTTGAGGTAGG + Intronic
1131451007 15:92539906-92539928 CAGTGCCAAGGCCCTGAGGCAGG + Intergenic
1131625303 15:94112218-94112240 AAGCGCATAGGCTCTGAGGCGGG - Intergenic
1132465265 16:74553-74575 CTGGACACAGGCTCTGAGCTGGG - Intronic
1133420385 16:5641676-5641698 CAGGGCAAAGGCCTGGAGGCGGG + Intergenic
1133467928 16:6045897-6045919 CAGGGCAAAGGCCCTGAAGTAGG + Intronic
1133568982 16:7023087-7023109 CAGTGCAAAGGCACTGAGGTAGG + Intronic
1133815314 16:9192893-9192915 CAGGACAAAGGCACTCATGTGGG + Intergenic
1133906957 16:10031261-10031283 AATGGCAAAGACCCTGAGGTGGG - Intronic
1134030885 16:10991455-10991477 CAGTGCAAAGGCCCTGCGGTGGG + Intronic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1134071041 16:11259965-11259987 CAGTGCAAAGGCCCTGTGGTGGG + Intronic
1134092770 16:11400263-11400285 CCGTGCAAAGGCCCTGTGGTGGG - Intronic
1134103765 16:11470915-11470937 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1134174830 16:11997237-11997259 AAGGGGAGAGGCTCGGAGGTAGG - Intronic
1134369984 16:13614375-13614397 CATGCAAAAGGCCCTGAGGTAGG + Intergenic
1134402826 16:13926183-13926205 GAGGGCACAGGCCCTGGGGTGGG - Intronic
1134559141 16:15192720-15192742 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1134657150 16:15955601-15955623 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1134678886 16:16110037-16110059 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1134739364 16:16529122-16529144 CAGTGCAAAGGTCCTGAGGTGGG + Intergenic
1134919677 16:18104333-18104355 AAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1134928136 16:18183029-18183051 CAGTGCAAAGGTCCTGAGGTGGG - Intergenic
1135052701 16:19205322-19205344 TAGTGCAAAGGCCCTGAGGTAGG - Intronic
1135123321 16:19785343-19785365 CTTAGCAAAGGCCCTGAGGTGGG + Intronic
1135159241 16:20078864-20078886 CAGTGCAAAGGCCCTGGGGTGGG + Intergenic
1135180468 16:20269343-20269365 AAGAGCAAAGGCCCTGAGATGGG + Intergenic
1135345990 16:21688860-21688882 CAGCACAAAGGCTCTGAGCCTGG + Intronic
1135535941 16:23294569-23294591 AAGGGCAAAGGCCCTGCAGTGGG - Intronic
1135818803 16:25660641-25660663 AAGTGCAAAGGCATTGAGGTAGG - Intergenic
1135830835 16:25771449-25771471 CTGTGCAAAGGCCCTGGGGTAGG - Intronic
1135962890 16:27012476-27012498 GACTGCAAAGGCCCTGAGGTGGG - Intergenic
1135981864 16:27154031-27154053 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1136015738 16:27399633-27399655 AAGTGCAAAGGCACTGAGGTAGG - Intergenic
1136026599 16:27472691-27472713 CAGGGCAAAGGCCCCAAGGCAGG - Intronic
1136097268 16:27966053-27966075 CAGTGCGAAGGCCCTGAGGCAGG - Intronic
1136101712 16:28001626-28001648 CAGGTCAAAGCCTCTGATCTTGG + Intronic
1136378057 16:29877005-29877027 CAGAGCAAAGCCTCCGAGGCTGG - Intronic
1136412989 16:30087694-30087716 ACGTGCAAAGGCCCTGAGGTGGG - Intronic
1136454247 16:30371372-30371394 CAGGGCACTGGATCTGTGGTGGG - Intronic
1137524950 16:49226803-49226825 AAAGCCAAAGGCTCTGAGCTTGG - Intergenic
1137919715 16:52474957-52474979 CAGTGCAAAGGCCCTGGGGTGGG - Intronic
1138060219 16:53882525-53882547 CACTGCAAAGGCTGTGTGGTGGG + Intronic
1138107502 16:54296710-54296732 AAGTGCAAAGGCCCTGTGGTAGG + Intergenic
1138124644 16:54428790-54428812 CAGGGCAAAGGCTTGATGGTGGG - Intergenic
1138182991 16:54955447-54955469 CAGTACAAAGGGACTGAGGTGGG + Intergenic
1138211201 16:55164626-55164648 CAAGGCAAGGGCTTAGAGGTGGG + Intergenic
1138245464 16:55463809-55463831 AAGTGCAAAGGCCCTGGGGTGGG - Intronic
1138335347 16:56248723-56248745 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1138457885 16:57131797-57131819 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
1138549331 16:57739007-57739029 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1138679154 16:58672483-58672505 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1139923347 16:70472973-70472995 CAGGTCCCAGGCTCTGATGTGGG - Exonic
1140128132 16:72134682-72134704 AAGTGCAAAGGCACTGAGGTGGG - Intronic
1140140539 16:72252464-72252486 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1140250499 16:73290426-73290448 CTGTGCAAAGGCCCTGGGGTGGG + Intergenic
1140483344 16:75274866-75274888 CAGTGCAAAGGCCCTGGGGCAGG - Intergenic
1140508743 16:75492163-75492185 CAGGGCAGTGGCTCTGAGCCAGG - Intronic
1140529357 16:75650361-75650383 CAGGGCAATCGCCCTTAGGTGGG + Intronic
1140551410 16:75870173-75870195 AATTGCAAAGGCCCTGAGGTGGG + Intergenic
1141112157 16:81278702-81278724 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1141115864 16:81308837-81308859 CAGTGCAAAAGCCCTGAGGTGGG + Intergenic
1141157226 16:81605650-81605672 CAGTGCAAAGGCTCAGAGGTGGG - Intronic
1141188525 16:81806820-81806842 CAGGACAAAGCCTTCGAGGTGGG + Intronic
1141478319 16:84288766-84288788 CTGTGCAAAGGCCCTGGGGTGGG + Intergenic
1141481033 16:84307065-84307087 CAGTGCAAAGGCCCAGAGGTGGG + Intronic
1141641430 16:85343953-85343975 CAGTGCAAAGGCCCTGAGACGGG - Intergenic
1141687515 16:85578745-85578767 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1141801372 16:86311605-86311627 CAGGCCCAGGGCTCTGGGGTAGG + Intergenic
1141926082 16:87170528-87170550 CAGTGCAAAGGCCCTGGGGTAGG - Intronic
1142138287 16:88461331-88461353 CGGGGCAAAGCCCCTGCGGTGGG - Intronic
1142175114 16:88641635-88641657 CAGGACAGAGGCTCTGGGGGAGG + Intergenic
1142308152 16:89297081-89297103 CAAGGCAGAGACCCTGAGGTTGG + Intronic
1203149723 16_KI270728v1_random:1827112-1827134 CAGGCCACAGGATCTGATGTTGG - Intergenic
1142476930 17:194209-194231 CAGTGGAAAGGCCCCGAGGTAGG - Intergenic
1142808651 17:2385091-2385113 CAGGGCTCAGCCTCTGAGGATGG + Exonic
1142893512 17:2960200-2960222 CTGGGCAGTGGCTCTGCGGTAGG + Intronic
1143014770 17:3885810-3885832 CAGGGCAAAGGCATGGAGGTGGG - Intronic
1143297775 17:5883969-5883991 AAGGGCAAAAGCCCTGAGGCAGG - Intronic
1143327161 17:6106887-6106909 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1143332768 17:6149571-6149593 CTGTGAAAAGGCCCTGAGGTTGG - Intergenic
1143458498 17:7083686-7083708 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1143660278 17:8320451-8320473 CAGTGCAAAGGCCCTGCGGCTGG + Intronic
1143777708 17:9210188-9210210 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1144379974 17:14685096-14685118 CAGTACAAAGGCCCTGGGGTGGG - Intergenic
1144581328 17:16461089-16461111 TGATGCAAAGGCTCTGAGGTGGG - Intronic
1144628686 17:16858581-16858603 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1144652716 17:17017519-17017541 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1144707826 17:17381004-17381026 CTTGGCAAAGGCCCTGAGGAAGG - Intergenic
1144761028 17:17707492-17707514 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1144762008 17:17712375-17712397 TAGTGCAAAGGCCCTGAGGTGGG + Intronic
1144823201 17:18089780-18089802 TAGTGCAAAGGCCCTGAGGCAGG + Intronic
1144961120 17:19044749-19044771 CAGTGCCAAGGCTCTGAGGTGGG + Intronic
1144974041 17:19129775-19129797 CAGTGCCAAGGCTCTGAGGTGGG - Intronic
1144998685 17:19288554-19288576 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1145110011 17:20154445-20154467 AAGTGCAAAGGCCCTGAGATGGG + Intronic
1145160271 17:20569152-20569174 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1145240283 17:21236944-21236966 GAGGGCATAGCCTCTGAGGTGGG + Intergenic
1145241921 17:21245178-21245200 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1145253161 17:21307485-21307507 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1145259803 17:21347912-21347934 CAGTGCAAATGCCCTGTGGTTGG + Intergenic
1145262710 17:21364401-21364423 AAGTGCAAAGGCCCTGGGGTAGG + Intergenic
1145266399 17:21381533-21381555 ATGTGCAAAGGCCCTGAGGTAGG - Intronic
1145316812 17:21740026-21740048 CAGTGCAAATGCCCTGTGGTCGG - Intergenic
1145323410 17:21780433-21780455 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1145764936 17:27452089-27452111 ATGTGCAAAGGCCCTGAGGTAGG - Intergenic
1146173801 17:30652001-30652023 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1146347257 17:32068022-32068044 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1146442338 17:32908018-32908040 CTGAGCAAAGGCCCTGAGGCAGG + Intergenic
1146486607 17:33248222-33248244 AAATGCAAAGGCCCTGAGGTAGG + Intronic
1146710853 17:35040198-35040220 CAGCAAAAAGGCTTTGAGGTAGG - Intronic
1146842550 17:36166038-36166060 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146854862 17:36253997-36254019 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146865758 17:36334379-36334401 CAGAGGCAAGGCCCTGAGGTGGG - Exonic
1146870762 17:36377889-36377911 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146878120 17:36428970-36428992 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1146882061 17:36450074-36450096 CAGAGGCAAGGCCCTGAGGTGGG + Intergenic
1146897765 17:36557708-36557730 TAGTGTAAAGGTTCTGAGGTTGG + Intronic
1146927341 17:36754178-36754200 CAGCACAAAGGCCCTGAGGAAGG + Intergenic
1147068628 17:37934991-37935013 CAGAGGCAAGGCCCTGAGGTGGG - Exonic
1147073645 17:37978513-37978535 CAGAGGCAAGGCCCTGAGGTGGG + Intronic
1147080150 17:38014528-38014550 CAGAGGCAAGGCCCTGAGGTGGG - Intronic
1147085167 17:38058051-38058073 CAGAGGCAAGGCCCTGAGGTGGG + Exonic
1147096099 17:38138488-38138510 CAGAGGCAAGGCCCTGAGGTGGG - Intergenic
1147101113 17:38182017-38182039 CAGAGGCAAGGCCCTGAGGTGGG + Intergenic
1147185016 17:38708462-38708484 CTGGGCAGAGGCACAGAGGTGGG + Intronic
1147218930 17:38916945-38916967 AAGTGCAAAGGCTCTGAGGCAGG + Intronic
1147444185 17:40464752-40464774 ACGTGCAAAGGCCCTGAGGTTGG - Intergenic
1147479520 17:40745992-40746014 TAGCGCAGAGGCTCTGAGGCAGG + Intergenic
1147659042 17:42107519-42107541 CAGGGCACAGGCGCCAAGGTCGG - Intronic
1147776709 17:42907055-42907077 CAATGCAAAAGCCCTGAGGTGGG + Intronic
1147845947 17:43403910-43403932 CAGGGCAGAGGATAGGAGGTAGG + Intergenic
1147997359 17:44367931-44367953 CAGTGAAAAGGCCCTGAGGTAGG - Intergenic
1148126186 17:45238334-45238356 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1148758923 17:49989437-49989459 CAGGGAAAAGGCTCTGAGTCAGG + Intergenic
1148761976 17:50009150-50009172 TGGTGCAAAGGGTCTGAGGTGGG + Intergenic
1148972104 17:51492569-51492591 CAGTGCAAAGGCCCTTAGGTGGG + Intergenic
1149455612 17:56785776-56785798 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
1149681454 17:58510352-58510374 AAGTGCAAAGGCCTTGAGGTGGG - Intronic
1149702893 17:58670035-58670057 ACAGGCAAAGGCTCTGAGGCTGG - Intronic
1150149816 17:62799880-62799902 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1150201886 17:63365691-63365713 AAGTGCAAAGGCCCAGAGGTGGG - Intronic
1150443752 17:65212505-65212527 GTGGGCAAAGGCTCAGAGCTGGG + Intronic
1150470530 17:65433446-65433468 CAATGCAAAGGCTTTGTGGTGGG + Intergenic
1150596469 17:66610260-66610282 CAGGGCAAGGGATGTGAGGAGGG + Intronic
1150624374 17:66832227-66832249 AAAGGCAAATGGTCTGAGGTAGG - Intergenic
1150634853 17:66905706-66905728 CATGGGAAAGGCTCTGAGGTGGG + Intergenic
1150805566 17:68316127-68316149 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1150908206 17:69361254-69361276 AAGTGCAAAGGCCCTGAGGAGGG + Intergenic
1150911494 17:69392385-69392407 CAGGGGAAAGGGTGAGAGGTGGG - Intergenic
1151204851 17:72498954-72498976 CAAGCCTAAGGCTCTGATGTTGG - Intergenic
1151252267 17:72845389-72845411 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1151284553 17:73100567-73100589 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1151714296 17:75823617-75823639 CTGGGCAGAGGCTCTCAGGAGGG - Intronic
1151893145 17:76963037-76963059 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1152460342 17:80439061-80439083 CAGGACACAGGCCCTGGGGTGGG - Intergenic
1152555699 17:81052166-81052188 CAGGGCAAAGGCCCCGAGGCAGG - Intronic
1153030173 18:706469-706491 CTGGGAAAAGGCACTGAAGTTGG - Exonic
1153080228 18:1214599-1214621 AAGTGGAAAGGCTCTGAGGCAGG - Intergenic
1153147989 18:2055593-2055615 AAGTGCAAAGGCTCTGAGGCAGG + Intergenic
1153273152 18:3342863-3342885 GAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1153501226 18:5751968-5751990 AAGGGGAAAGGCACTGAGGAAGG + Intergenic
1154000951 18:10482041-10482063 CAAGGCAAAGGCTCGGGGGAGGG - Intronic
1155288843 18:24320514-24320536 TGATGCAAAGGCTCTGAGGTAGG + Intronic
1155557373 18:27034655-27034677 GAGTGCAAAGGCCCTGAGGCAGG - Intronic
1155920664 18:31599950-31599972 AAGGGCAAAGGTATTGAGGTGGG + Intergenic
1156091868 18:33481135-33481157 CAATGCAAAGGGTCAGAGGTGGG - Intergenic
1156218889 18:35030899-35030921 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1156505240 18:37586557-37586579 CAGGGCAAAGGGTTTGAAATAGG - Intergenic
1156516208 18:37682823-37682845 CAGAACAAAGGCCCTAAGGTAGG + Intergenic
1156569832 18:38240808-38240830 AAGTGCAAAGGCTCTGGGGTGGG + Intergenic
1157156805 18:45276072-45276094 AAGTGCAAAGGCCCTGAGGCTGG + Intronic
1157508371 18:48248381-48248403 AAGTGCAAAGGCCCTGAGATGGG - Intronic
1157583497 18:48786969-48786991 CAGGGCACAGGCTGAGTGGTGGG - Intronic
1157635425 18:49148798-49148820 GAGTGCAAAGGCTTTGAGGCAGG - Intronic
1158193361 18:54856279-54856301 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1158261378 18:55609744-55609766 AAGTGCAAAGGCCCTGAGGAAGG - Intronic
1158555667 18:58472695-58472717 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1158828883 18:61256430-61256452 CAGGGTAAAAGCGCTGAGATAGG + Intergenic
1158852511 18:61509448-61509470 CAGTGCAAAGGCTTTGAGGTGGG + Intronic
1158925459 18:62253217-62253239 AAGAACAAAGGCCCTGAGGTGGG + Intronic
1159943458 18:74426306-74426328 CCTGGCAAAGGCTGTGAGGCTGG - Intergenic
1159959803 18:74546589-74546611 CAGGACACAGGCTCTGAAGCAGG - Intronic
1160036982 18:75310515-75310537 CAGGGCAGAGGCCATGAGGCTGG - Intergenic
1160688169 19:446952-446974 CATGGCAAAGCCTATGAGGTGGG - Intronic
1160729613 19:635165-635187 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1160752040 19:738917-738939 CTGTGCAAAGGCCCTGAGGCTGG + Intronic
1160752539 19:741324-741346 CCCTGCAAAGGCCCTGAGGTAGG + Intronic
1160875438 19:1294432-1294454 CAGGGCAAAGGCCTGGAGGCAGG + Intronic
1160978581 19:1806272-1806294 GGGGGCAAAGGCCCGGAGGTGGG - Intronic
1161213312 19:3079706-3079728 CTGTGCAAAGGCCCTGGGGTAGG + Intergenic
1161235596 19:3196560-3196582 CGGTGCAAAGGCCCTGGGGTGGG - Intronic
1161240837 19:3222881-3222903 CCGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161246794 19:3257226-3257248 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1161274277 19:3406912-3406934 CCGTGCAAAGGCCCTGAGGCAGG + Intronic
1161274888 19:3410445-3410467 CCGTGCAAAGGCCCTGAGGCAGG + Intronic
1161302111 19:3547784-3547806 CAGAGCAAAGGCCCTGTGGGTGG + Intronic
1161307654 19:3576825-3576847 CCGGGCAAAAGCCCGGAGGTAGG + Intronic
1161331998 19:3692871-3692893 CTGTGCAAAGGCTCTGGGGCAGG - Intronic
1161435113 19:4258450-4258472 CGGGGCAGAGGCTGCGAGGTGGG - Intronic
1161496751 19:4590783-4590805 CCGTGCAAAGGCCCTGAGGCAGG - Intergenic
1161497732 19:4596791-4596813 CAGTGCAAAGGCCCTGAGTCAGG - Intergenic
1161533842 19:4806587-4806609 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161536360 19:4821477-4821499 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1161544225 19:4870208-4870230 CCGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161621443 19:5299347-5299369 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1161623220 19:5310128-5310150 CCGTGCAAAGGCCCTGAGGCAGG - Intronic
1161629367 19:5344554-5344576 CAGTGCAAAGGCTCTGTGGCAGG - Intergenic
1161634203 19:5377106-5377128 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161635306 19:5384966-5384988 CAGAGCAAAGGCCCTGCGGCAGG - Intergenic
1161640329 19:5418728-5418750 CAGGGCAAGGACCCTGAGGCTGG + Intergenic
1161650345 19:5480482-5480504 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161658830 19:5533446-5533468 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161664234 19:5565216-5565238 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1161700691 19:5793392-5793414 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161741082 19:6021618-6021640 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1161747261 19:6068648-6068670 CAGTACAAAGGCCCCGAGGTGGG + Intronic
1161761409 19:6175604-6175626 CAGTCCAAAGGCCCTGAGGCTGG + Intronic
1161772259 19:6237181-6237203 CAAGGCAAAGGCCCTGTGGCCGG + Intronic
1161820886 19:6530900-6530922 GAGGGGAAAGGCTCTGGGCTGGG + Intergenic
1161858151 19:6777601-6777623 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1161859212 19:6785065-6785087 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1161869124 19:6856952-6856974 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1161963029 19:7533404-7533426 AAGTGCAAAGGCCCGGAGGTGGG + Intronic
1162080701 19:8215971-8215993 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162110337 19:8396626-8396648 CCGTGCAAAGGCCCTGAGGCAGG + Intronic
1162126200 19:8500635-8500657 CAGGGCAGAGGCCCCGAGGTCGG - Intronic
1162156370 19:8680860-8680882 CTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1162400657 19:10444635-10444657 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1162418154 19:10550639-10550661 AAGCGCAAAGGCCCTGAGGTGGG - Intronic
1162442175 19:10699725-10699747 AGGTGCAAAGGCCCTGAGGTTGG + Intergenic
1162446233 19:10724570-10724592 CAGTGCAAAGGTCCTGATGTGGG + Intronic
1162449807 19:10747953-10747975 CTGGGCAAAGGCCCTGGGGCAGG + Intronic
1162456517 19:10788323-10788345 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1162466783 19:10846968-10846990 GTGTGCAAAGGCCCTGAGGTTGG + Intronic
1162518980 19:11167858-11167880 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162520680 19:11177826-11177848 GTGGGTAAAGGCTCAGAGGTGGG - Intronic
1162528970 19:11224618-11224640 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1162554782 19:11380048-11380070 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1162568716 19:11458399-11458421 CTGGGCAAAGGCAGTCAGGTGGG - Intronic
1162747901 19:12809391-12809413 CAGTACAAAGGCCCTGAGCTGGG - Intronic
1162766518 19:12923093-12923115 CAGTTCAAAGGCCCAGAGGTGGG - Intronic
1162819375 19:13213239-13213261 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162837887 19:13333282-13333304 AAGTGCAAAGGCCCTGAGCTAGG - Intronic
1162839584 19:13346311-13346333 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1162850983 19:13430954-13430976 CTGTGCAAAGGCCCTGAGGCTGG + Intronic
1162853507 19:13450290-13450312 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162857111 19:13477142-13477164 TGGTGCAAAGGCCCTGAGGTAGG - Intronic
1162857399 19:13479415-13479437 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1162869705 19:13576208-13576230 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1162871645 19:13591031-13591053 CAGTGCAAAGGCCCTGAGGCTGG + Intronic
1162897962 19:13776643-13776665 CAGTGCAAAAGTTCTCAGGTGGG - Intronic
1162910575 19:13845949-13845971 CAGTGCACAGGCTTTGCGGTAGG + Intergenic
1162950106 19:14066358-14066380 CAGTGCAAAGACCCTGAGGTGGG + Intergenic
1162988615 19:14288039-14288061 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1163157453 19:15447255-15447277 CAGTGCAAAGGCCCTGTGGTGGG - Intronic
1163253099 19:16138432-16138454 ACGGGCAAAGGCCCTGTGGTAGG - Intronic
1163447188 19:17353563-17353585 CAGGGCAAAGGCCCCAAGGTGGG - Intronic
1163468553 19:17483813-17483835 CAGTGCAAAGGCCCTGGGGTGGG - Intronic
1163484105 19:17576406-17576428 ATGTGCAAAGGCCCTGAGGTAGG + Intronic
1163500423 19:17672936-17672958 CAGGGAAAGTGCTTTGAGGTGGG - Intronic
1163505449 19:17703295-17703317 GTGTGCAAAGGCTCTGAGATTGG + Intergenic
1163546107 19:17942337-17942359 CAGTGCAAAGGCGCCGAGGCAGG - Intronic
1163561216 19:18020667-18020689 TGGTGCAAAGGCCCTGAGGTGGG - Intergenic
1163568873 19:18068570-18068592 CAGTGCAAAGGTGCAGAGGTGGG - Intronic
1163576506 19:18113986-18114008 AAGTGCAAAGGCCCTGAGGCTGG - Intronic
1163581037 19:18138892-18138914 CAGGGCAAAGGCTCTGAGGTGGG - Intronic
1163626079 19:18390544-18390566 AAGTGCAAAGGCCCTGAGATGGG + Intergenic
1163629683 19:18411660-18411682 CAATGCAAAGGCCCTGGGGTGGG + Intergenic
1163630675 19:18416695-18416717 AAGGGCCAAGGCCCTGAGGTGGG - Intergenic
1163685923 19:18711605-18711627 CAGGTTACAGGCTCTGACGTGGG + Intronic
1163703512 19:18798999-18799021 AGGGGCAAAGGCCCAGAGGTGGG + Intergenic
1163720872 19:18897632-18897654 TAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1163730805 19:18948219-18948241 ATGGGCAAAGGCCCTGAGGTGGG + Intergenic
1163766347 19:19165485-19165507 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1163844508 19:19630641-19630663 CAGTGCAAAGGCCCTGAGGTAGG + Intronic
1163844867 19:19632855-19632877 CAGTGCAAAGGCCCTGAGGTAGG - Intronic
1164426774 19:28148570-28148592 GAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1164514329 19:28921369-28921391 AAGGGCAAAGGCCCTGGGGTGGG + Intergenic
1164700117 19:30279042-30279064 AAGTGCAAAGGCCCTGAGGTTGG - Intronic
1165093532 19:33398485-33398507 CCGGGCACAGCCTCTCAGGTGGG - Intronic
1165162612 19:33826638-33826660 CAAGGCAAAGGCCTCGAGGTAGG + Intergenic
1165323888 19:35102868-35102890 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1165391963 19:35543949-35543971 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1165463920 19:35960786-35960808 CAGTGCAAAGGCCCTGGGGTAGG - Intergenic
1165476019 19:36031567-36031589 CTGGGTAAAGGATCTGAGGTAGG - Intronic
1165476612 19:36034304-36034326 CAGTGCAAAGGTCCTGGGGTAGG - Intergenic
1165700445 19:37933235-37933257 CAGGGCAAAGTCTCCGAGGGAGG - Intronic
1165729361 19:38134860-38134882 GAGGGCAAAGGCCCTTAGCTTGG + Intronic
1165761740 19:38325749-38325771 CAGTGCAATGGCCCTGGGGTGGG + Intronic
1165773768 19:38393100-38393122 CAGTGCAAAGGCGCTGGGGCAGG - Intronic
1165791972 19:38498091-38498113 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1165807277 19:38588160-38588182 CTGTGCAAAGGATTTGAGGTGGG + Intronic
1165844596 19:38810024-38810046 CAGTGCAAAGGCCCTGAGACAGG - Intronic
1165853879 19:38868758-38868780 CAGTGCAAAGGCCCAGAGGTAGG - Intronic
1165866596 19:38943098-38943120 CCGCGCAAAGGCCCTGAGGTGGG + Intronic
1165950587 19:39472222-39472244 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1165958737 19:39517633-39517655 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1166007338 19:39916544-39916566 CAATGCAAAGGCCCTGAGGTGGG - Intronic
1166066376 19:40361625-40361647 CAGTACAAAGGCCCTGAGGGAGG - Intronic
1166097301 19:40548985-40549007 AAAGGCAAAGGCTCCGAGGCAGG + Intronic
1166109999 19:40616077-40616099 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1166197111 19:41214325-41214347 CAGTGCAAAGGCCCAGAGGCAGG - Intergenic
1166203419 19:41253315-41253337 ATAGGCAAAGGCTCGGAGGTGGG + Intronic
1166220292 19:41359954-41359976 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1166321944 19:42024063-42024085 ATGTGCAAAGGCTCTGAGGCGGG - Intronic
1166399971 19:42471403-42471425 AAGGACACAGGCTCTGAGGTTGG - Intergenic
1166500390 19:43336708-43336730 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1166509788 19:43397303-43397325 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1166545518 19:43632604-43632626 AAGGGAAAAGGCCCTGTGGTGGG - Intronic
1166658425 19:44628969-44628991 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1166672537 19:44719507-44719529 CAGTGCAAAGGCCCCGAGGAAGG - Intergenic
1166690087 19:44817300-44817322 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1166745443 19:45139893-45139915 CTGTGCAAAGGCTGTGAGGCAGG - Intronic
1166760899 19:45224074-45224096 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1166780542 19:45340479-45340501 CAAGGAAAAGGCTCTGGGGCAGG + Intronic
1166807405 19:45495714-45495736 CAGTGCAAAGGCCCTGAGCCAGG + Intronic
1166865009 19:45830490-45830512 CCAGGCAAAGGCCCTTAGGTGGG + Intronic
1166879891 19:45922334-45922356 CAGTGCAAAGGCCCTGAGGTTGG + Intergenic
1166886089 19:45961864-45961886 GAGTGCAAAGGCCCTGAAGTGGG + Intronic
1166929187 19:46291098-46291120 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1166936592 19:46337213-46337235 AAGTGCAAAGGCCCTTAGGTGGG + Intronic
1166946904 19:46402952-46402974 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1166952482 19:46438803-46438825 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1166952677 19:46440217-46440239 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1166959874 19:46490943-46490965 CAGTGCAAAGGCCATGAGGCAGG + Intronic
1167090337 19:47339715-47339737 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1167150612 19:47707249-47707271 CAGTGCAAAGGCCCTGTGGCAGG + Intergenic
1167257018 19:48436778-48436800 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1167277855 19:48549842-48549864 AAGGGCAAAGGCCCTGCAGTAGG + Intergenic
1167284029 19:48588825-48588847 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1167347790 19:48957098-48957120 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1167408106 19:49327498-49327520 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1167417287 19:49381629-49381651 AAGTGCAAAGGTCCTGAGGTTGG + Intergenic
1167444738 19:49530910-49530932 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1167485183 19:49758604-49758626 CAGGGCAAAGAGTCTGGGCTGGG - Intronic
1167487891 19:49773836-49773858 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1167552493 19:50170528-50170550 TAGAGCACAGGCTCTGAGGCCGG - Intergenic
1167555547 19:50192989-50193011 CCGTGCAAAGGCCCTGAGGTGGG + Intronic
1167562228 19:50232788-50232810 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1167569484 19:50277997-50278019 CAGTGCAAAGGCCCTGAGATGGG + Intronic
1167637498 19:50663381-50663403 CAGTTCAAAGGCCCTGAGGTGGG - Intronic
1167687269 19:50964159-50964181 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1167702070 19:51054712-51054734 TAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1167793374 19:51693918-51693940 CAGGGCAAAGACTCAGAGAGGGG + Intergenic
1168237764 19:55074353-55074375 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1168332024 19:55576147-55576169 AGGGGCAAAGGCTAGGAGGTAGG - Intergenic
1168335717 19:55596502-55596524 AAGTGCAAAGGCCCTGAGGAAGG - Intronic
1168678700 19:58297930-58297952 CAGGGCAGTAGCCCTGAGGTTGG + Exonic
926079740 2:9975353-9975375 CAGGTCATAGCCTGTGAGGTGGG + Intronic
926189960 2:10721313-10721335 TCGGGAAAAGGCTCTGAGCTCGG - Intergenic
926429576 2:12772356-12772378 AGGAGCCAAGGCTCTGAGGTGGG + Intergenic
926764619 2:16313416-16313438 CATTGCAAAGTCTCGGAGGTGGG + Intergenic
926783174 2:16494403-16494425 AAGTGCAAAGGCCTTGAGGTGGG - Intergenic
926812977 2:16772829-16772851 CAGCGCAAAGGCTCTGAGCAGGG - Intergenic
926907169 2:17816644-17816666 CCGGGGAAAGGCTCTGAGAGGGG - Exonic
927241895 2:20926515-20926537 AAATGCAAAGGCCCTGAGGTAGG - Intergenic
927323789 2:21779533-21779555 CAGGGCAGGGGCTGAGAGGTGGG - Intergenic
927865774 2:26586297-26586319 CCGTGCAAAGGCCCTGAGGCAGG - Intronic
928173218 2:29016776-29016798 GAGTGCAAAAGCTCTGAGGCCGG - Intronic
928256018 2:29723259-29723281 CAGTGCAAAGGCCCTGGGGTGGG - Intronic
928666240 2:33553182-33553204 GTGAGCAAAGGCACTGAGGTGGG - Intronic
929005923 2:37392647-37392669 CTGTGCAAAGGTCCTGAGGTAGG - Intergenic
929059123 2:37905252-37905274 CAGGGCAAAGGTGCTGTGGTGGG - Intergenic
929336511 2:40754016-40754038 CAGTGCAAATATTCTGAGGTAGG - Intergenic
929611221 2:43272142-43272164 TACTGCAAAGGCCCTGAGGTTGG + Intronic
929758431 2:44786971-44786993 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
929870891 2:45758467-45758489 AAGTGCAAAGACTCTGAGGTAGG - Intronic
929988934 2:46767903-46767925 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
930049738 2:47205752-47205774 CAGGGCAAAGGCGGAGAGGAGGG + Intergenic
930065422 2:47324080-47324102 ATGCTCAAAGGCTCTGAGGTGGG + Intergenic
930122622 2:47772227-47772249 CAGTGCAGAGGCTCTGAGATGGG + Intronic
931131421 2:59340834-59340856 GAGTGCAAAGGCCCTGAGGCAGG + Intergenic
931625087 2:64250216-64250238 TAGTGCAAAGGCCCTGTGGTAGG + Intergenic
931798785 2:65737926-65737948 CAGGCAAAAGGCTCTGGGGTGGG - Intergenic
931807868 2:65825504-65825526 AAGTGCAAAAGCCCTGAGGTTGG - Intergenic
932746054 2:74334384-74334406 AAGTGCAAAGGTCCTGAGGTGGG - Intronic
933583795 2:84158339-84158361 AAGTGCAAAGGCGCTGAGGCTGG + Intergenic
933714389 2:85349550-85349572 CATGGAAAAGGCACTGTGGTTGG + Exonic
933726115 2:85428291-85428313 TAGGGCACAGGCTCTGGGGCAGG + Intronic
933771588 2:85748083-85748105 CAATGCAAAGGCCCTGAGGTGGG + Intergenic
934657002 2:96121630-96121652 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
934747083 2:96766407-96766429 CAGGGCAAAGGCCCCATGGTGGG - Intronic
935121283 2:100185667-100185689 AAGTGCAAAGGCCCTGGGGTGGG + Intergenic
935553975 2:104486622-104486644 GAGTGCAAAAGCCCTGAGGTGGG - Intergenic
935688335 2:105706889-105706911 CTGGGCAAAGGCACTGGGGCAGG - Intergenic
935692089 2:105741213-105741235 CAAGGCACAGGCTCCAAGGTAGG + Intergenic
935743678 2:106172869-106172891 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
936044356 2:109174692-109174714 TAGGGCACATGCACTGAGGTGGG + Intronic
936376975 2:111949033-111949055 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
936456744 2:112681090-112681112 CAGGTCACAGGTTCTGTGGTAGG - Intergenic
936628542 2:114175024-114175046 TTGTGCAAAGGCTCTGAAGTGGG + Intergenic
936637241 2:114272782-114272804 AAGTGCAAAGGCCCTGAGGAAGG + Intergenic
936789946 2:116139751-116139773 GAGGGCCCAGGCTCTGAGGAGGG + Intergenic
937126761 2:119479602-119479624 CAGGGCAGTGGCTCTGAGTGTGG - Intronic
937152685 2:119696763-119696785 AAGGGCAGAGGCCCTGAGGCAGG + Intergenic
937232588 2:120406759-120406781 TTGGGCAAAGGCTCAGAGGCGGG + Intergenic
937466155 2:122134908-122134930 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
937478152 2:122233518-122233540 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
938032810 2:128009810-128009832 GAGCGCAAAGGCTCTGAGACAGG - Intronic
939413872 2:141866935-141866957 CATGGCAAAAACTCTGAGTTTGG - Intronic
939716337 2:145588853-145588875 CCAGGCAAAGGTCCTGAGGTCGG - Intergenic
939734008 2:145820851-145820873 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
939753664 2:146082171-146082193 CAGTGCAGAGGCCCTAAGGTGGG - Intergenic
939781050 2:146448200-146448222 CAGGGCACAGGTTCTGAGACAGG + Intergenic
939892886 2:147758179-147758201 CAGTGCAAAGGCCTTGAGGTGGG - Intergenic
940300510 2:152172302-152172324 CAGGCCAAAGGCTAGGAAGTAGG - Intronic
940689899 2:156903136-156903158 CAGTGCAAAGGCCCTAAGTTGGG + Intergenic
940748293 2:157595787-157595809 AAGAGCAAAGGCCATGAGGTGGG - Intronic
941005765 2:160245356-160245378 CAGTGCAAAGGCCCTGAGATGGG - Intronic
941047708 2:160695349-160695371 CAATGCAAAGGCCCTGAAGTAGG + Intergenic
941162983 2:162055978-162056000 AAGTGCAAAGTCTCTGAGGCAGG - Intronic
941702803 2:168622659-168622681 CAATGCAAAGTCTTTGAGGTTGG - Intronic
941721954 2:168821766-168821788 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
941858319 2:170252831-170252853 AAGTGCAAAGGTCCTGAGGTGGG + Intronic
941920969 2:170850440-170850462 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
942118997 2:172758197-172758219 CAGTGCAAAGGCTCAGGTGTGGG + Intronic
942147852 2:173043834-173043856 CAAGCCAGAGGCTCTGAGGCCGG - Intronic
942619093 2:177828671-177828693 CAGTGCAAAGCCCCTGAGGTGGG + Intronic
942665330 2:178311221-178311243 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
942741169 2:179179902-179179924 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
942752080 2:179299604-179299626 AAGAACAAAGGCTCTGAGGTGGG - Intergenic
943290497 2:186065115-186065137 CAGTGCAAAGGTCCTGAGGGAGG + Intergenic
943745642 2:191460204-191460226 CAGGACTAACACTCTGAGGTAGG - Intergenic
944668545 2:201976381-201976403 CAGTGCAAAGGCCCTGAGGCTGG + Intergenic
945181242 2:207093414-207093436 CAGTGCAAAGGCCTCGAGGTGGG - Intronic
945324133 2:208463265-208463287 ACAGGCAAAGGCCCTGAGGTGGG - Intronic
945550657 2:211218059-211218081 CAGGGGAAAGGATAGGAGGTGGG + Intergenic
945809196 2:214527562-214527584 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
945932807 2:215872695-215872717 AATTGCAAAGGCTCTGAGCTGGG + Intergenic
946106689 2:217376565-217376587 CAGAGCAAAGGCCCTGAGACGGG + Intronic
946146583 2:217735581-217735603 AGGAGCAAAGGCCCTGAGGTGGG - Intronic
946235159 2:218319973-218319995 ATAGGCAAAGGCCCTGAGGTGGG + Intronic
946328128 2:218995307-218995329 AAATGCAAAGGCTCTGAGATGGG - Intergenic
946861410 2:224003178-224003200 CAGGGCCGAGGCCCTGACGTGGG + Intronic
946872895 2:224100844-224100866 ATGTGCAAAGACTCTGAGGTGGG - Intergenic
947288292 2:228542895-228542917 GAGTGCAAAGACTCTGAGCTGGG - Intergenic
947666452 2:231908984-231909006 AAGTGCAAAGGCCCTGCGGTAGG + Intergenic
948023662 2:234758302-234758324 CAGTGCAAAGGTACTGAGGCAGG - Intergenic
948333888 2:237193046-237193068 CCGTGCAAGGGCCCTGAGGTAGG + Intergenic
948446778 2:238039362-238039384 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
948599779 2:239101613-239101635 CAGGGCAAAGGCACAGAAGATGG + Intronic
949014359 2:241701483-241701505 CAGGGCCCAGGCCCTGAGGGAGG + Intergenic
1168742294 20:202078-202100 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1168763358 20:365002-365024 AAGGGCAAAGGCCCTGGGGCAGG + Intronic
1168807239 20:679003-679025 AAGTTCAAAGGCTCTGAGGCAGG + Intergenic
1168832405 20:853791-853813 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1168951440 20:1804679-1804701 AAGGGCAAAGGCCTTGAGGTGGG + Intergenic
1168952771 20:1813849-1813871 AAGGGCAAAGGCCCTGAGGTAGG + Intergenic
1168957491 20:1844613-1844635 AAGTGCAAAGTCCCTGAGGTGGG + Intergenic
1168962933 20:1881281-1881303 AAGCACAAAGGCTCTGAGGCTGG - Intergenic
1168964000 20:1887940-1887962 CCGTGCAAAGGCCCTGAGGTAGG + Intergenic
1168966802 20:1903673-1903695 CAGTGCAAAGGCCCTCGGGTGGG - Intronic
1168968517 20:1914742-1914764 CTGGGCAAAGACTCAGAGGTAGG - Intronic
1168978289 20:1984198-1984220 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
1169006541 20:2212099-2212121 CTGTGCAGAGTCTCTGAGGTAGG + Intergenic
1169035987 20:2452479-2452501 AATGGCAAAGGCATTGAGGTGGG - Intergenic
1169539326 20:6582104-6582126 CAGTGCAAAGGCCCTGTGGTAGG + Intergenic
1169667824 20:8058045-8058067 TGGGGCAGAGGCTCTGAGGCTGG + Intergenic
1169723208 20:8701324-8701346 CTGTGCAAAGGCTGTGAGGCGGG - Intronic
1169763046 20:9117739-9117761 CAATGCAAAGGCCCTGGGGTAGG - Intronic
1169970379 20:11263568-11263590 CAAGGCAGAGGTTCTGAGGTGGG - Intergenic
1170301188 20:14886254-14886276 AAGTGCAAAGGCCCTGAGATAGG + Intronic
1170426741 20:16242702-16242724 CAGTGCAAAGGTCCTGGGGTAGG + Intergenic
1170810603 20:19671221-19671243 CAGTGCAAAGGCTCTGGGAGAGG + Intronic
1170911454 20:20574297-20574319 TAGAGCAAAGGCTGTGAGATAGG + Intronic
1171250012 20:23639677-23639699 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171256112 20:23690192-23690214 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171263462 20:23752102-23752124 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171266755 20:23777401-23777423 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171272515 20:23827874-23827896 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171276301 20:23859045-23859067 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1171284058 20:23923422-23923444 CAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1171291888 20:23987123-23987145 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1171956551 20:31468243-31468265 AAGGGCCAAGGCCCTGAGGCAGG - Intronic
1171976135 20:31595946-31595968 AAGGGCAAGGGCCCTGAGGCAGG + Intergenic
1171987764 20:31672500-31672522 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1172014119 20:31862879-31862901 CATGGCAAAGGCCTGGAGGTGGG - Intronic
1172107509 20:32525394-32525416 CAGGGCACAGGCTCTGGGGTGGG + Intronic
1172212924 20:33213651-33213673 GAGGGCAAAGGCCCTCAGGTGGG - Intergenic
1172226476 20:33308322-33308344 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1172291473 20:33780206-33780228 CAGTGCCAAGGCCCTGAGGTGGG + Intronic
1172313894 20:33938772-33938794 AAGTGCAAAAGCCCTGAGGTAGG - Intergenic
1172563250 20:35907633-35907655 CAGAACAAACCCTCTGAGGTGGG + Intronic
1172624386 20:36338891-36338913 CATGGCAAAGGCACCGAGGCAGG + Intronic
1172626330 20:36349563-36349585 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1172700587 20:36851510-36851532 AAGGCCAAAGGCTTTGAGGTGGG - Intronic
1172784172 20:37455453-37455475 AAGTGCAAAGGCTCTAAGGTGGG - Intergenic
1173081457 20:39872053-39872075 AAGAGCACAGGCTCTGGGGTAGG + Intergenic
1173154313 20:40595034-40595056 CAGGTCAGAGGCACTCAGGTCGG - Intergenic
1173288644 20:41694962-41694984 AAGTGCAAAGGCTCTGAGCGGGG + Intergenic
1173373232 20:42459178-42459200 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1173385209 20:42581106-42581128 CATTGCAAAGGCCCTGAGGCAGG - Intronic
1173598676 20:44277394-44277416 GAGGGCAAAGGCCCTGTGGTAGG + Intronic
1173802907 20:45905983-45906005 ATGAGCAAAGGCCCTGAGGTGGG + Intronic
1173850369 20:46214125-46214147 AGGTGCAAAGGCCCTGAGGTGGG + Intronic
1173916289 20:46710665-46710687 CAGTGCAAAGGCCCTCAGGCAGG + Intronic
1173919084 20:46730561-46730583 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1174043253 20:47714818-47714840 AAGGGCAAAGGCCCTGGGGCAGG - Intronic
1174047103 20:47741322-47741344 CAGGGCACAGGTTCTGGGATGGG - Intronic
1174052005 20:47773434-47773456 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1174054846 20:47791402-47791424 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1174110712 20:48195993-48196015 AAATGCAAAGGCCCTGAGGTGGG - Intergenic
1174114049 20:48214748-48214770 CAGTGCAAAGGCCCTGGGGCAGG - Intergenic
1174120819 20:48263997-48264019 AAGTACAAAGGCTCTGAGATGGG - Intergenic
1174121482 20:48268924-48268946 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
1174126316 20:48309494-48309516 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1174163898 20:48571155-48571177 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1174165875 20:48583339-48583361 CAGGGGAGAGGCTGGGAGGTCGG - Intergenic
1174170652 20:48616220-48616242 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1174177880 20:48656529-48656551 TAGGGCAGAGGCCCTGAAGTGGG - Intronic
1174187912 20:48720066-48720088 CAGTGCAAAGGCCCTGGGGCAGG - Intronic
1174189645 20:48731165-48731187 GTGTGCAAAGGCCCTGAGGTAGG - Intronic
1174201371 20:48808812-48808834 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1174225315 20:48994117-48994139 GAGTGCCAAGGCCCTGAGGTGGG + Intronic
1174264966 20:49324712-49324734 CAGTGCAAAGTCGCTGAGGCAGG - Intergenic
1174268478 20:49349267-49349289 AAGCGCAAAGGCCCTGAGGCAGG + Intergenic
1174268846 20:49351985-49352007 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1174277396 20:49413868-49413890 AAGTGCAAAGGCCCTGAGGCTGG - Intronic
1174280713 20:49437240-49437262 AAGTGCAAAGGCCCTGGGGTGGG + Intronic
1174285632 20:49471090-49471112 AAGTGCAAAAGCCCTGAGGTGGG + Intronic
1174292712 20:49520160-49520182 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1174293010 20:49522185-49522207 AAGTGCAAAGGCCCTGGGGTTGG - Intronic
1174302920 20:49595160-49595182 GTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1174360899 20:50028376-50028398 CAGTGCAAAGGCCCTGAGGCTGG - Intergenic
1174373556 20:50110843-50110865 TAGTGCAAAGGCCCTGTGGTGGG - Intronic
1174385370 20:50185653-50185675 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1174390113 20:50213810-50213832 AAGTGCAAAGGCTCTGAGATGGG + Intergenic
1174394693 20:50239723-50239745 AAGTGCAAAGGCTCTGAGGCAGG + Intergenic
1174397687 20:50258056-50258078 CAGTGCAAAGGCCCTGAGGCGGG + Intergenic
1174428284 20:50448844-50448866 AAGTGCAAAGGCCCTGAGGTTGG - Intergenic
1174447968 20:50602911-50602933 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1174503025 20:50999541-50999563 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1174566110 20:51465573-51465595 CAGTACAAAGGCCCTGAGGCAGG - Intronic
1174586031 20:51609075-51609097 CAGTGCAAAGGCACTGAGGCGGG + Intronic
1174624674 20:51904181-51904203 CAGGGCAAAGGCTCTGGTGCAGG + Intergenic
1174670730 20:52305458-52305480 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1174703988 20:52637147-52637169 CTGGGCAAAGGTGTTGAGGTGGG + Intergenic
1174774874 20:53334410-53334432 AAGTGCACAGGCCCTGAGGTGGG + Intronic
1174786825 20:53440871-53440893 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1174872831 20:54199495-54199517 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1174887186 20:54348785-54348807 AAGGTCAAAGACCCTGAGGTAGG + Intergenic
1175040040 20:56040349-56040371 AAGTGCAAAGGCCCTGAGGTAGG - Intergenic
1175110829 20:56646776-56646798 ATGTGCAAAGGCCCTGAGGTGGG + Intergenic
1175136650 20:56829277-56829299 AAGGGTAAACGCCCTGAGGTGGG - Intergenic
1175227378 20:57452496-57452518 CAGTGCAAAGGCCTTGAGGCAGG + Intergenic
1175261780 20:57679236-57679258 AAGTGCAAATGCCCTGAGGTAGG + Intronic
1175327101 20:58137502-58137524 AAGTGCAAAGGCGCTGAGGTGGG + Intergenic
1175384445 20:58585192-58585214 CAGTGCCAAGGCCCTGAGGCAGG + Intergenic
1175419291 20:58821242-58821264 CAGTGGAAGGGCCCTGAGGTGGG - Intergenic
1175464005 20:59177420-59177442 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1175669506 20:60889979-60890001 AAGTGCAAAGGCCCTGAGATGGG + Intergenic
1175799232 20:61791810-61791832 AAGTGCAAAGGCCCTGGGGTAGG + Intronic
1176425136 21:6544073-6544095 CCATGCAAAGGCCCTGAGGTAGG + Intergenic
1176717525 21:10365753-10365775 CACTGCAAAGGCCCTGAGGCAGG + Intergenic
1177832038 21:26149911-26149933 CAGTGTAAAGGCTGTGAGGTGGG - Intronic
1178139653 21:29668425-29668447 AAGTGCAAAGGCTATGATGTGGG + Intronic
1178415398 21:32400807-32400829 CAATGCAAAAGCACTGAGGTGGG + Intergenic
1178516231 21:33249819-33249841 AAGTTCAAAGGCTCTGAGGCTGG + Intronic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1179638656 21:42732188-42732210 CAGGCCCCAGGCTCTGAGGCTGG + Intronic
1179700627 21:43152390-43152412 CCATGCAAAGGCCCTGAGGTAGG + Intergenic
1180226265 21:46394165-46394187 CAGGGCCTAGGCTCTGACGGTGG + Intronic
1180298752 22:11018673-11018695 CACTGCAAAGGCCCTGAGGCAGG + Intergenic
1180765509 22:18343983-18344005 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1180780808 22:18518409-18518431 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1180813521 22:18775716-18775738 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1180929410 22:19578840-19578862 CAGTGCAAAGGCCCTGTGGCAGG - Intergenic
1181199705 22:21210046-21210068 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181274162 22:21677962-21677984 CAGTGCAAAGACCCTGAGGTGGG + Intronic
1181400057 22:22645812-22645834 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181409852 22:22711214-22711236 CAGAGCAAAGGCAGGGAGGTGGG - Intergenic
1181649307 22:24249978-24250000 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1181702031 22:24626910-24626932 CAGTGCAAAGGCCCTGAGGCAGG - Intronic
1181770214 22:25119780-25119802 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1181774113 22:25147518-25147540 CAGGGCAAAGGACTGGAGGTGGG - Intronic
1181796120 22:25312326-25312348 CAGGGCAAAGACCCTGAGCCTGG + Intergenic
1181811710 22:25407084-25407106 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1181836665 22:25615936-25615958 CAGGGCAAAGACCCTAAGGCTGG + Intronic
1181888498 22:26040720-26040742 CAATGCAAAGGCCCTGAGGTAGG + Intergenic
1181970204 22:26684120-26684142 AGGGGCAAAGGTACTGAGGTGGG + Intergenic
1181971724 22:26695670-26695692 AGGAGCAAAGGCCCTGAGGTGGG + Intergenic
1181978237 22:26747721-26747743 AGGTGCAAAGGCTCTGAGGCAGG + Intergenic
1182404894 22:30118298-30118320 CAATGCAAAGGCTCTGAAGTGGG - Intronic
1182738475 22:32548203-32548225 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1182880898 22:33732429-33732451 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1182924161 22:34107110-34107132 AAATGCAAAGGCCCTGAGGTGGG + Intergenic
1182936475 22:34227506-34227528 CAGTGCGAAGGCTGTGAGATAGG - Intergenic
1183086035 22:35487812-35487834 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1183090365 22:35518257-35518279 CTGAGCAAAGGCTGGGAGGTAGG + Intergenic
1183154405 22:36063959-36063981 CAGTGCAATGGCCCTGAGGTAGG - Intergenic
1183252880 22:36742851-36742873 CTGGGCAAGGGCCCTGAGGAGGG + Intergenic
1183253082 22:36744032-36744054 CAGGCCAGAGACCCTGAGGTGGG - Intergenic
1183354847 22:37352654-37352676 AAGTGCAAAGGCCCTGAGGCTGG + Intergenic
1183691895 22:39394888-39394910 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1183900269 22:41000382-41000404 AAGGGCAAAGTCCCTGTGGTAGG - Intergenic
1184059488 22:42073638-42073660 AAGGGCAAAGGCTCTGAGGCGGG + Intergenic
1184088049 22:42277542-42277564 ATGGGCAAAGGCCCTGCGGTAGG + Intronic
1184099085 22:42332277-42332299 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1184104589 22:42360079-42360101 GTGGGCAAAGGCCCCGAGGTGGG - Intergenic
1184196417 22:42932205-42932227 ATGTGCAAAGGCTCTGAGGCAGG - Intronic
1184272759 22:43394021-43394043 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1184406248 22:44302617-44302639 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406262 22:44302657-44302679 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406276 22:44302697-44302719 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406290 22:44302737-44302759 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406304 22:44302777-44302799 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406318 22:44302817-44302839 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406332 22:44302857-44302879 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184406346 22:44302897-44302919 AGGGGCAAAGGCCCTGGGGTGGG + Intronic
1184482938 22:44758702-44758724 CAGGGCAAAGGCAGTGGGGTGGG + Intronic
1184582408 22:45426484-45426506 AAGGGCAAAGGCCTTGAGGCAGG + Intronic
1185330907 22:50251634-50251656 CAGGGCAAAGGCCACGAGGCGGG + Intronic
1203227130 22_KI270731v1_random:84873-84895 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1203263621 22_KI270734v1_random:1398-1420 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
949337134 3:2987132-2987154 AAGTGCAAAGGCCCTGAAGTGGG + Intronic
949367715 3:3301184-3301206 ACGGTCAAAGGCTCTGAGGTAGG - Intergenic
949489373 3:4573670-4573692 GAGGACAAAGGCCCTGAGGCAGG - Intronic
949530867 3:4953862-4953884 AAGGACAAAGGTGCTGAGGTGGG - Intergenic
949879467 3:8650031-8650053 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
949909490 3:8889615-8889637 AAGTTCAAAGGCTCTGTGGTGGG + Intronic
949961107 3:9313174-9313196 AAGTGCAAAGGCTCTTAGGCGGG - Intronic
950016925 3:9760963-9760985 AAGTGCAAAGGCCCTGAGGAGGG - Intronic
950100909 3:10356193-10356215 CCAGGCAAAGGCCCTGAGGCAGG + Intronic
950112605 3:10429101-10429123 GTGGGCAAAGGCTGGGAGGTGGG - Intronic
950122167 3:10489074-10489096 CAGTGCAAAGGCCCTGACATGGG - Intronic
950196324 3:11011522-11011544 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
950426604 3:12927854-12927876 GAGGACAAAGGTGCTGAGGTGGG + Intronic
950456988 3:13098622-13098644 CAGTGGAAAGGCTCTGAGCTAGG + Intergenic
950475441 3:13211722-13211744 CAGGGCAAAGGCCTGGAGGCTGG - Intergenic
950525891 3:13523031-13523053 AAGTGCAAAGGCCCTGAGGCGGG - Intergenic
950533895 3:13568620-13568642 CAGGGCCAAGGGGCTGAGGCCGG - Intronic
950548736 3:13654086-13654108 AAGTGCAAAGGCCCCGAGGTGGG - Intergenic
950566194 3:13771074-13771096 AGGGGCAAAGGCCCTGAGGCAGG - Intergenic
950640863 3:14347173-14347195 CAGTGTAAAGGCCCTGAGGTGGG + Intergenic
950665147 3:14490732-14490754 TAGTGCAAAGGCCCTGAGATAGG - Exonic
950670170 3:14521197-14521219 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
950682751 3:14596180-14596202 CCTGAGAAAGGCTCTGAGGTAGG + Intergenic
950719279 3:14871010-14871032 AATGGCAAAGGGTCTGAGGTGGG - Intronic
951217288 3:20037409-20037431 AAATGCAAAGGCCCTGAGGTAGG + Intergenic
951414541 3:22407996-22408018 CAGGGAGAAGACTTTGAGGTGGG + Intergenic
951467081 3:23013288-23013310 CAGTGCAAAGACTCCGAGGCTGG - Intergenic
951478562 3:23134904-23134926 CAAGGCAATGGCTGTGAGGATGG + Intergenic
951595872 3:24317564-24317586 CAGTGCAATGGCTCTGAGTGTGG - Intronic
951655735 3:25006008-25006030 GAGTGCAAAAGCCCTGAGGTGGG - Intergenic
951678441 3:25268640-25268662 CAGTGCAAAGGTGCTGAGGCAGG - Intronic
952038579 3:29234197-29234219 CCATGCAAAGGCTCTGAGGTAGG + Intergenic
952418328 3:33109275-33109297 CTGGGCAAAGGCTCTTTGGCAGG + Intergenic
952834097 3:37589691-37589713 CGGTGCAAAGGCCCTGAGGCAGG + Intronic
952970020 3:38644883-38644905 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
952996723 3:38890177-38890199 TAGGGCAAAAGCTCTGGGGGTGG + Intronic
953170276 3:40500862-40500884 CAGGGTAAATTCTCTGATGTTGG - Intergenic
953442315 3:42928932-42928954 CAGGGGAAAGGCTCTGGTTTCGG - Intronic
953447047 3:42977268-42977290 AAGTGCAAAGGTCCTGAGGTGGG + Intronic
953691145 3:45120763-45120785 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
953718435 3:45335340-45335362 AGGAGCAAAGGCCCTGAGGTGGG + Intergenic
953787919 3:45924466-45924488 CAGGGCCAGGGCTCAGAGGGAGG + Intronic
954008643 3:47614992-47615014 CAGTGCAGAGGCCCTGAGGCAGG - Intronic
954123027 3:48511496-48511518 CAATGCAAAGGCTCTGAGTGTGG - Intergenic
954652680 3:52174988-52175010 CTGTGCAAAGGCCCTGAGGAGGG - Intergenic
954678805 3:52330491-52330513 CAGTGCAGAGGCTCTGCCGTGGG + Intronic
954687263 3:52377663-52377685 AAGGGCAAAGGCCTGGAGGTGGG - Intronic
954772416 3:52983694-52983716 AAGAGCAAAGTCTCTGAAGTGGG + Intronic
955017813 3:55088941-55088963 CAGTGCCAAGGCCCTGGGGTAGG - Intergenic
955093326 3:55773251-55773273 CAGTGCAAAGGCCCTAAGGTGGG - Intronic
955337078 3:58095637-58095659 ATGTGCAAAGGCTCTGAGGGAGG - Intronic
955964085 3:64370159-64370181 AAGTGCAAGGGCTCTGAGGCTGG + Intronic
955969641 3:64425471-64425493 AAGGGCAAATGCCCTGAGGTAGG + Intronic
956000423 3:64724210-64724232 AAGTGCAAAGGCCCTGAGTTTGG + Intergenic
956030313 3:65030202-65030224 CTGTGCAAAGGCCCTGTGGTAGG + Intergenic
956444114 3:69308786-69308808 CAGTGCAAAAGTCCTGAGGTGGG - Intronic
956791418 3:72683099-72683121 CAGGACAAGGGCCCTGGGGTGGG - Intergenic
956897979 3:73683319-73683341 AAGTGCAAAGTCTCTGAGGCAGG + Intergenic
957660764 3:83148883-83148905 AAGTGCAAAAGATCTGAGGTGGG + Intergenic
957764403 3:84603345-84603367 CAGGGCATAGTCACTGATGTTGG + Intergenic
957957142 3:87202049-87202071 CAGGGAAAAGCCACTGAGGAGGG + Intergenic
958053853 3:88384444-88384466 CAAGTAAAAGGCTCTGAGGCTGG + Intergenic
959983035 3:112539401-112539423 GAGTGCAAAGGTACTGAGGTGGG - Intronic
960117021 3:113905409-113905431 CAGAACAAAGGCTCTGCAGTAGG - Intronic
960139687 3:114140080-114140102 CAGGGCAGAGGCTCCCAGGAGGG + Intronic
960300497 3:115997604-115997626 AAGTGCAAAGGCCCTGAGGTTGG + Intronic
960622579 3:119651187-119651209 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
960735907 3:120780440-120780462 TAATGCAAAGGCCCTGAGGTAGG + Intronic
960883069 3:122365779-122365801 CAGGGCAAAGGCTGTTAAATTGG - Intronic
961002290 3:123382105-123382127 CAGATCAAAGGCCCTGGGGTGGG - Intronic
961314667 3:126026336-126026358 CAGGGCAAAGGCTGCAAGGAAGG + Exonic
961370371 3:126424912-126424934 AGGTGCAAAGGCACTGAGGTGGG + Intronic
961391973 3:126557711-126557733 CAGGGCAAAGGCCCTCTGGATGG - Intronic
961744755 3:129057406-129057428 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
961751922 3:129101622-129101644 CAGGACAAAGGCTCAGAGGCAGG + Intronic
961788021 3:129359131-129359153 CAGGGCAAAGGCCCGGAGGCTGG + Intergenic
961796508 3:129412682-129412704 GAAGGCAAAGGCCCTGGGGTAGG - Intronic
962159679 3:132985754-132985776 AAATGCAAAGGCCCTGAGGTGGG - Intergenic
962302372 3:134253658-134253680 CAGTGCAAAGGCCCTGAGGTAGG - Intergenic
962396020 3:135015897-135015919 CAGGACAAAGGCCCTGAGGTGGG + Intronic
962408900 3:135124158-135124180 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
962924636 3:139980315-139980337 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
963043200 3:141083933-141083955 GAGGGGAAAGACTCTGAAGTTGG + Intronic
963225169 3:142855023-142855045 CTGTGCAAAGGCCCTTAGGTGGG - Intronic
963282621 3:143400530-143400552 CAGGGCAAAGGCTGGCAGGTGGG + Intronic
964093969 3:152910216-152910238 CAGTGCAAATGGACTGAGGTGGG - Intergenic
964419688 3:156488453-156488475 CAGTGCAAAGGCCCTGAGATGGG + Intronic
964424027 3:156533378-156533400 CAGTGGAAAGGCCCTGAGATGGG + Intronic
964515946 3:157507792-157507814 GAATGCAAAGGCTCTGTGGTGGG - Intronic
964721078 3:159767648-159767670 AAGGGCAAAAGCCCTGAAGTAGG - Intronic
964746847 3:160020499-160020521 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
964842289 3:161007393-161007415 AAGGGCAAAGGCCCAGAGGCAGG + Intronic
965079314 3:164018123-164018145 TAGGGCAAAGGCTGGAAGGTGGG + Intergenic
965688354 3:171328943-171328965 AAGTACAAAGGCCCTGAGGTGGG - Intronic
965859123 3:173125559-173125581 CAGTGCAAAGGTTCTGAGTTGGG - Intronic
966052724 3:175640884-175640906 CATTGCAAAGGCTCTTAAGTAGG + Intronic
966599792 3:181763777-181763799 AAGTGCAAAGGCTCTGTGGTAGG + Intergenic
966892236 3:184415962-184415984 CATCGTAAAGGCTCTGAGGATGG - Intronic
967300177 3:188004865-188004887 CAGGGCAATGTCTCTGATGTTGG + Intergenic
967385307 3:188905280-188905302 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
967896383 3:194399372-194399394 CAGAACAAGGGCTCTGAGATAGG - Intergenic
967907033 3:194509963-194509985 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
967934200 3:194713629-194713651 CAGGGTAAAACCTCTGAAGTGGG + Intergenic
967937918 3:194743941-194743963 AAGTGCAAAGGCTCTGAGCCAGG - Intergenic
968016385 3:195337974-195337996 CAGTGCAAAGGCATTGAGGTGGG - Intronic
968750325 4:2385617-2385639 GAGGGCAAAGGCTCAGATGCAGG - Intronic
968808469 4:2789530-2789552 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
969119753 4:4899491-4899513 CAGGGCCAAGGCACAGAGGAAGG - Intergenic
969213220 4:5703964-5703986 CCGTGCAAGGGCCCTGAGGTGGG + Intronic
969317795 4:6392558-6392580 ACGAGCAAAGGCCCTGAGGTAGG + Intronic
969441386 4:7219003-7219025 CCAGGCATGGGCTCTGAGGTAGG - Intronic
969503854 4:7571361-7571383 AAGGGCAAAGACTCAGAGGTGGG + Intronic
969544551 4:7816760-7816782 GAAGGCACAGGCTCTGAGGACGG - Intronic
969625677 4:8304137-8304159 CTGGGCAAAGGCTCAGGGGAGGG + Intronic
969828122 4:9774377-9774399 ACGGGCAAAGGCTCAGAGGCAGG - Intronic
970400130 4:15709288-15709310 AATTGCAAAGGCCCTGAGGTGGG + Intronic
971414665 4:26413203-26413225 CAGTGCAAAGGTTCTCAGATAGG - Intronic
971423094 4:26491638-26491660 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
971551802 4:27966620-27966642 CAGGGCAAAGGCTTAGAATTTGG + Intergenic
972205420 4:36766169-36766191 CAGAGAGAAGGCTCTGAGATGGG + Intergenic
972557557 4:40195992-40196014 ATGTGCAAAGGCCCTGAGGTGGG - Intronic
972633243 4:40859845-40859867 CAGTGCAAAGGCTCTGAGGTGGG - Intronic
972703795 4:41520305-41520327 CAGCAGAAAGGCTTTGAGGTAGG - Intronic
973111302 4:46401459-46401481 CAGGTCAAAGTCTCTAGGGTTGG - Intronic
973192996 4:47408269-47408291 AAGTGCATAGGCTCTGAGGCAGG + Intronic
973333164 4:48930521-48930543 AAGTGCAAAGACCCTGAGGTTGG + Intergenic
973533614 4:51858326-51858348 ACGTGCAAAGGCGCTGAGGTGGG + Intronic
973644572 4:52937204-52937226 AAGTGCAAAGGCTCTGAGGCAGG + Intronic
973794049 4:54405875-54405897 AAGGGCAAAGGCCCTGAGGTAGG - Intergenic
973816420 4:54623482-54623504 AAGGGGAAAGGCCCTGAGCTTGG - Intergenic
973855399 4:55006071-55006093 CTGAGCAAAGGCCCTGAGGCAGG + Intergenic
974839985 4:67288387-67288409 AAGGGCAAAGGCCTTGAGATAGG - Intergenic
975166823 4:71187050-71187072 CGGGGCAAAGGCGCTGGGGCGGG - Intergenic
975270677 4:72428990-72429012 CATGGAAAAGTCTCTGAGGTTGG - Intronic
975353372 4:73370514-73370536 GAGTGCAAAGGCTCTGCGATGGG - Intergenic
975855982 4:78624842-78624864 AAGTGCAAAGACCCTGAGGTGGG - Intergenic
976106617 4:81625796-81625818 AAGGGCAAAGGCTCTGAGGCAGG - Intronic
976592585 4:86863708-86863730 AAGAGCAAAGGCTCTAAGGTGGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977312005 4:95399615-95399637 AAGAGCAAAGGCCCTGAGGCAGG - Intronic
978788959 4:112640923-112640945 AAGGGCAAAGGCCCTGAAGTGGG + Intronic
978874248 4:113619586-113619608 AAGTGCAAAGGCTCTGAGACAGG - Intronic
980108054 4:128607425-128607447 ATGGGCAAAGGCTCTGTGGTAGG + Intergenic
980501833 4:133666060-133666082 CAGTGGAAAGGCCCTGAGGTAGG - Intergenic
980971015 4:139567293-139567315 AAATGCAAAGGCCCTGAGGTAGG - Intronic
981145905 4:141323820-141323842 CAGAGCAAAGGCTATGACTTGGG + Intergenic
981339163 4:143600319-143600341 CAGGAAAAAGGCTGGGAGGTAGG + Intronic
981585652 4:146299570-146299592 CAGTGCAAAGGTTCTAAGGCAGG + Intronic
981680792 4:147395416-147395438 CAGGGGAAAGGGTGGGAGGTGGG + Intergenic
982090346 4:151875106-151875128 CAGGGCAAAGGCTCAAAGGTGGG + Intergenic
982091225 4:151881594-151881616 CAGTGCAAAGGCCCTGAGGTAGG + Intergenic
982387832 4:154831844-154831866 CAGGGCAAAAGCTCTGCAGATGG + Intergenic
982445786 4:155489405-155489427 CAGTGCAAAGGCCCTGAAGTGGG + Intergenic
983653979 4:170062457-170062479 CAGAGTAAAGGCCCTGAGATGGG + Intronic
985631866 5:1018048-1018070 CACTGCAAAGGCCCTGAGGCAGG + Intronic
985723103 5:1501042-1501064 CAGAGCTGAGGGTCTGAGGTGGG + Intronic
985731277 5:1550417-1550439 CCGGGCAAAGGCCCTGGGGCAGG - Intergenic
985937612 5:3108770-3108792 CAGTGCAAAGGTCCTGGGGTGGG - Intergenic
986026611 5:3857405-3857427 CAGCACCAAGGTTCTGAGGTTGG + Intergenic
986082492 5:4409340-4409362 CAGCACAAAGGCCCTGAGGCAGG + Intergenic
986170960 5:5314166-5314188 CAGGGCAGAAGCTCTAAGCTGGG + Intronic
986330001 5:6711088-6711110 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
986595389 5:9416510-9416532 CAGGTGAGAGGCTCTGGGGTAGG - Intronic
986764823 5:10915855-10915877 CTGGGCAAAGCCCCTGAGCTGGG + Intergenic
987039892 5:14052574-14052596 AAGGGCAAAGGCCCTGAGGCGGG + Intergenic
987342241 5:16949300-16949322 AAGTGCAAAGGCCCTGAGATAGG - Intergenic
987492957 5:18604349-18604371 CAGAGCAAAATCCCTGAGGTGGG + Intergenic
987783875 5:22473104-22473126 CAGTGCAAAGGCACAGATGTGGG - Intronic
987858288 5:23450074-23450096 TAGGGCAAAGACTTTGAAGTTGG + Intergenic
988865947 5:35335241-35335263 AAGGGCAAAGACCCTGAGGTGGG - Intergenic
989110610 5:37903533-37903555 CAGTGGAAAGGCCCTGAGGTGGG + Intergenic
990487546 5:56274150-56274172 CAGAGCAAAGGCACCCAGGTGGG - Intergenic
991155133 5:63425349-63425371 CAGGGAAAAGGATGGGAGGTGGG - Intergenic
991915016 5:71597180-71597202 CAGTGCAAAGGCCCTGAGGTGGG + Intronic
991960358 5:72038159-72038181 ATGGGCAGAGACTCTGAGGTTGG - Intergenic
992042008 5:72844424-72844446 CTATGCAAAGGCTCAGAGGTAGG + Intronic
992066852 5:73117286-73117308 AGGTGCAAAGGCCCTGAGGTAGG - Intergenic
992679612 5:79141009-79141031 CAGTGCCAAGGCTCTGAGGTAGG - Intronic
992940947 5:81760725-81760747 CAAGGCAAAGGCCCTGAGGCTGG - Intergenic
993693493 5:91032161-91032183 CAGTGCAAAGGCCCTAAGGCGGG + Intronic
993752111 5:91682958-91682980 CAGGTCAAGGCCTATGAGGTTGG + Intergenic
994128440 5:96196614-96196636 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
994151942 5:96457579-96457601 AAGGGCGAAGGCACTGAGGTAGG - Intergenic
994278691 5:97871873-97871895 CATGGGAAAGGCTCTGAGGCAGG + Intergenic
995069941 5:107908697-107908719 CGGGGCAAAGGCCCTTGGGTGGG + Intronic
995112689 5:108445295-108445317 ATGGGCAAAGGCCCTGAAGTAGG + Intergenic
995542402 5:113197833-113197855 CAGAGCACAGGCTCTGGAGTTGG - Intronic
996060903 5:119032198-119032220 CAGTGCAAAGGCCCTGAGTGTGG - Intergenic
996087777 5:119322004-119322026 GTGTGCAAAGGCTCTGAAGTAGG - Intronic
996570149 5:124924891-124924913 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
996628066 5:125594295-125594317 CAAGGCAAAGGCCCTGAGGCAGG + Intergenic
997214571 5:132100139-132100161 CAGCGCAAAGGCTCTGAGGCTGG - Intergenic
997376794 5:133403282-133403304 CAGGGCACACGCTCTGAAGCAGG - Intronic
997434940 5:133867233-133867255 AAGGACAAAGGCTCAGAGATAGG - Intergenic
997677680 5:135725428-135725450 ACGTGCAAAGGCCCTGAGGTGGG + Intergenic
997791719 5:136767986-136768008 AGGTGCAAAGGCCCTGAGGTAGG + Intergenic
998007035 5:138663859-138663881 CAAGGCAAGAGCACTGAGGTAGG + Intronic
998078182 5:139253320-139253342 CAGTGCAAAGGACCTGAGGCAGG - Intronic
998155533 5:139784682-139784704 CAGTGCAAAGGCCCTGGGGTGGG - Intergenic
998159546 5:139805725-139805747 TGGTGCAAAGGCCCTGAGGTGGG + Intronic
998368841 5:141648440-141648462 GAGTGCAAAGGGTCTGAGGTGGG - Intronic
998375315 5:141686833-141686855 GAGTGCAAAGGCCCTGAGGTAGG + Intergenic
998389017 5:141774957-141774979 AAGTGCAAAGGTTCTGAGGTGGG - Intergenic
998391792 5:141791809-141791831 CAGTGCAAAGGCTCTGAGGTGGG + Intergenic
998533265 5:142904642-142904664 CTGGGGAAAGGCTCTGTGATGGG + Intronic
998547289 5:143040753-143040775 TGGAGCAAAGGCTATGAGGTGGG + Intronic
998586659 5:143433999-143434021 CAGTAGAAAGGCCCTGAGGTAGG - Intronic
998879593 5:146632810-146632832 ATGTGCAAAGGCCCTGAGGTGGG + Intronic
998882316 5:146656322-146656344 AAATGCAAAGGCACTGAGGTTGG + Intronic
999250807 5:150181195-150181217 AAGTGCAAAGGCCCCGAGGTGGG - Intronic
999307021 5:150526082-150526104 AAGTGCAAAGGCCCTGAGGTAGG - Intronic
999437799 5:151577690-151577712 CAACGCAAAGGCCCTGAGATGGG + Intergenic
999480183 5:151940962-151940984 CAGGGCAAAGGGGCGGGGGTGGG + Intergenic
999537151 5:152529676-152529698 CAAGGCAAAGGCTTGGAGGCAGG + Intergenic
999591903 5:153157495-153157517 AAGGTCAAAGGCCCTGAGCTCGG + Intergenic
999816922 5:155186391-155186413 TAATGCAAAGGCTCTGAGGTGGG + Intergenic
999922439 5:156336186-156336208 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
999966997 5:156820495-156820517 CAGTGGAAAGGCGCTGAGGCTGG + Intergenic
999988948 5:157031963-157031985 GAGTGCAAAGGCACTGAGGTAGG - Intronic
999992696 5:157063886-157063908 AAGGGCAAAGGCCCTAAGGCAGG + Intergenic
1000036062 5:157448894-157448916 TAGGCCAAAGGCCCTGAGGTGGG - Intronic
1000098786 5:157994650-157994672 AAGTGCAAAGGCTCCGAGGTGGG + Intergenic
1000235557 5:159356386-159356408 AAGGGCAAAGGCTCTGAGACAGG - Intergenic
1000244945 5:159441608-159441630 CAGAGCTGTGGCTCTGAGGTCGG + Intergenic
1000286784 5:159833709-159833731 AAGAGCAAAGGCACTGAGGAAGG + Intergenic
1001197005 5:169682369-169682391 AGGTGCAAAGGCCCTGAGGTAGG + Intronic
1001288020 5:170437819-170437841 CTGTGCAAAGGCCCAGAGGTAGG - Intronic
1001300837 5:170532611-170532633 CAGGCCAATGGATCTGAGGCAGG - Intronic
1001328354 5:170745471-170745493 CAGGGGACAGCCTCTTAGGTGGG - Intergenic
1001483064 5:172101848-172101870 CAGTGCCAAGGCCCTGAGGCAGG + Intronic
1001544556 5:172563008-172563030 CAATGCAAAGGCCCTGGGGTAGG + Intergenic
1001589917 5:172858200-172858222 ATGGGCAAAGGCCCTGAGGTGGG + Intronic
1001590484 5:172861188-172861210 CTTGGCCAAGACTCTGAGGTGGG - Intronic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1001753762 5:174150725-174150747 CAGGGCAAAGGCATTGAGTTGGG - Intronic
1002063173 5:176638628-176638650 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1002068714 5:176665696-176665718 CAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1002207049 5:177570091-177570113 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1002367203 5:178722974-178722996 CAGGGCAGAGGCCCTGAGTGGGG + Intronic
1002386543 5:178871302-178871324 CAGGGCAGAGGCCCTGAGTGGGG - Intronic
1002592890 5:180303422-180303444 CAGCGCAAAGGCCCGGAGGCGGG + Intronic
1002691657 5:181054185-181054207 AAGGGGAAAGACTCTCAGGTTGG - Intronic
1002711700 5:181198809-181198831 CAGGACAAGGGCTCTGAGAAGGG + Intronic
1002979731 6:2124682-2124704 CTGGAGAAAGGCTATGAGGTGGG - Exonic
1003238059 6:4316398-4316420 CAAATCAAAGTCTCTGAGGTGGG + Intergenic
1003268628 6:4588480-4588502 CTGAGCAAATGCTCTGAGGATGG - Intergenic
1003276515 6:4658604-4658626 AAGTGCGAAGGCCCTGAGGTGGG + Intergenic
1003408404 6:5841600-5841622 CATGGAAAAAGCTCTGAGGCAGG - Intergenic
1003727636 6:8783575-8783597 CTGGGTAAAGGCTGGGAGGTGGG - Intergenic
1003853590 6:10250248-10250270 AAGTGCAAAGGCCCTGATGTTGG - Intergenic
1004078469 6:12367533-12367555 AAGTGCAAATGCCCTGAGGTAGG + Intergenic
1004700959 6:18079066-18079088 AAGGGCAAAGGCCCTGAGCTGGG + Intergenic
1004761488 6:18671539-18671561 AAGGGCAAGGACTCTGAGGCAGG - Intergenic
1004827272 6:19436654-19436676 AAGTGCAAAGGTCCTGAGGTAGG + Intergenic
1004927876 6:20432855-20432877 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1005199991 6:23333996-23334018 CAGTGCAAAGGTTCTGAGACAGG - Intergenic
1005468964 6:26143143-26143165 CAGGAGAAAGGCTCTGTGGTAGG - Intergenic
1006333075 6:33405936-33405958 CCAGGCAAAGGCCCTGAGATGGG - Intronic
1006362898 6:33597057-33597079 AAGGGCAAAGGCCCTGAGACAGG - Intergenic
1006427794 6:33976964-33976986 CAGTGCAGAGGCCCTGAGGCAGG - Intergenic
1006430847 6:33994870-33994892 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1006440393 6:34050166-34050188 AAGTGCAAAGGCCCTGGGGTGGG - Intronic
1006451186 6:34106615-34106637 CAGTGCAAAGGCCCTGAGGTGGG - Intronic
1006457479 6:34140234-34140256 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1006805651 6:36787385-36787407 CAGTGCAAAGGCCCTGGGGCAGG - Intronic
1006809974 6:36813727-36813749 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1006835521 6:36996734-36996756 AAGAGCAAAGGCCCTGAGGTGGG + Intergenic
1006844790 6:37054743-37054765 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1006845288 6:37057277-37057299 GAGTGCAAAGGCCCTGGGGTGGG + Intergenic
1006913305 6:37578308-37578330 CGGAGCAAAGGCCCTGGGGTAGG + Intergenic
1006929405 6:37678651-37678673 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1007110005 6:39307911-39307933 AAGTGCAAAGGCCCTGAGATGGG - Intronic
1007116111 6:39344529-39344551 CAGAGCAAAGGCCCTGAGGCTGG - Intronic
1007416068 6:41691940-41691962 AAGTGCAAAGGTCCTGAGGTGGG - Intronic
1007499906 6:42288746-42288768 ATGGGCAAAGGCTCTGTGGCAGG + Intronic
1007511847 6:42380130-42380152 AAGTGCAAAGGCCCCGAGGTGGG + Intronic
1007667863 6:43526503-43526525 AAGTGCAAAGGCTTGGAGGTGGG + Intronic
1007705543 6:43788553-43788575 CAGTGCAAAGGCCCTGTGGCAGG - Intergenic
1007718873 6:43873579-43873601 AAGCGCAAAGGCTCTGAGGCAGG + Intergenic
1007768174 6:44173403-44173425 AGGTGCAAAGGCCCTGAGGTGGG - Intronic
1007926475 6:45653499-45653521 AAGTGTAAAGGCACTGAGGTGGG + Intronic
1008147001 6:47903991-47904013 AAGGGCAAAGGCACTGAAGCAGG + Intronic
1008147703 6:47911645-47911667 CATGGAAAGGGCTCTGAGGATGG + Intronic
1008348019 6:50453473-50453495 CTTGGCAAAGGCCCTGAGGTAGG - Intergenic
1008483087 6:52006837-52006859 CAGGGGAAAGGGTGGGAGGTGGG - Intronic
1009423226 6:63486540-63486562 CAGGGCAAAGATGCAGAGGTAGG + Intergenic
1010302138 6:74273572-74273594 CAGGGCATAGGCTTGGGGGTGGG - Intergenic
1010752463 6:79631097-79631119 CCGGGCAGAAGCTGTGAGGTGGG - Intergenic
1010999392 6:82570764-82570786 AAGTGCAAAGGCTGTGAGGTAGG + Intergenic
1011289590 6:85762858-85762880 CAGGGGAAAGGGTGGGAGGTTGG - Intergenic
1011497447 6:87950499-87950521 CAGGGCAATGGCACTGAGATGGG - Intergenic
1011554915 6:88564143-88564165 CGGAGCAAAGGCCCTGAGGTGGG - Intergenic
1011662772 6:89608606-89608628 GAGGGCAAAGCCACTGAGGTGGG - Intronic
1012412205 6:98971364-98971386 CAGGGCAAAGACTCTACTGTGGG + Intergenic
1012840835 6:104326985-104327007 AAGAGCAAAGGCCCTGAGGCCGG - Intergenic
1013292706 6:108732709-108732731 CAGGGCAAGGCCTCTGAGATGGG - Intergenic
1013369219 6:109455462-109455484 CAGGACAAAGGCTGTGAGAGGGG + Intronic
1013415609 6:109921752-109921774 CAGGGCAAGGTCTGGGAGGTGGG + Intergenic
1013608829 6:111775089-111775111 CAGAGGAAAGGCTGTGGGGTGGG + Intronic
1013947257 6:115736144-115736166 CAGTGCAAAGGCTCTGTGTAGGG - Intergenic
1014897652 6:126922878-126922900 CATGGGAAAGGCCCAGAGGTAGG - Intergenic
1015069094 6:129067760-129067782 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1015074501 6:129139180-129139202 CAGAGTAAAGGCTCTGAGTCTGG - Intronic
1015823081 6:137283446-137283468 AAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1015863219 6:137702066-137702088 CAGGGCAGCTGCTCTGAGCTGGG - Intergenic
1015932584 6:138376164-138376186 CAGTGCAAAGGCCCTGAAGCAGG - Intergenic
1016213982 6:141573017-141573039 CAGTGCAAAGTCTCTGGGGAAGG + Intergenic
1016662808 6:146600435-146600457 AAGTGCAAAGGCCCTGCGGTGGG - Intronic
1016678954 6:146805647-146805669 GAGGTCAAAGGCCCAGAGGTGGG - Intronic
1016762314 6:147751111-147751133 CAGTGCAAAGGCCCTGAGATGGG - Intergenic
1017043411 6:150325578-150325600 AAGTGCAAAGGCCCTGAGGTAGG + Intergenic
1017208267 6:151826956-151826978 CAGGGAAGAGGCCCTGATGTGGG + Intronic
1017291828 6:152746022-152746044 CAGGGAAGAGCCTCTGAGATGGG - Intergenic
1017752396 6:157500211-157500233 TAGTGCAAAGGCCCTGAGGTGGG + Intronic
1017995923 6:159531560-159531582 CAGGGCAAAGGTGCAGGGGTAGG + Intergenic
1018152816 6:160956164-160956186 AAGGGCAAGGGCCCTGAGGCAGG + Intergenic
1018777523 6:167031254-167031276 CATGTGAAAGGCCCTGAGGTGGG - Intronic
1018932407 6:168250032-168250054 GACGGGAAAGGCTCTGAGATGGG - Intergenic
1019062222 6:169264791-169264813 CAGGGCAGGGGCTCTGAGGATGG + Intergenic
1019345286 7:526734-526756 CAGGGGAAGCGCTCTGGGGTTGG - Intergenic
1019551386 7:1604374-1604396 CAGAGCCGAGGCCCTGAGGTGGG + Intergenic
1019552661 7:1610785-1610807 GGGGGCAATGGCTCTGAGGGTGG + Intergenic
1019639279 7:2094630-2094652 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1019714222 7:2530915-2530937 CTGGGCAAAGGTGCAGAGGTGGG + Intergenic
1019949907 7:4362960-4362982 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1020125617 7:5531114-5531136 CAGGGCAGTTGCTCTGAAGTCGG - Intronic
1020862963 7:13517790-13517812 AAGTGCAAAGGCCCTAAGGTGGG - Intergenic
1020909613 7:14112111-14112133 CAATGCAAAGGCTCTGATGTGGG - Intergenic
1021225136 7:18017913-18017935 AAGAGCAAAGGCTTTGAGGTGGG - Intergenic
1021377298 7:19923787-19923809 AAATGCAAAGCCTCTGAGGTAGG + Intergenic
1021543395 7:21785998-21786020 CAGGGCAAACACTTTGAGGCAGG - Intronic
1021621322 7:22553323-22553345 CTGGGTAGAGGCTCTGCGGTAGG - Intronic
1022315148 7:29238810-29238832 CAGGACAAAGACCCTGAGGTGGG + Intronic
1022505728 7:30907822-30907844 CAGGGCAGAGGGGCTGAGGCGGG - Intergenic
1022523598 7:31023230-31023252 CAGGGCAAATGCGCTGGGATAGG - Intergenic
1022542609 7:31152785-31152807 CATTGCAAAGGCCCTGATGTGGG - Intergenic
1022806769 7:33830505-33830527 ACGTGCAAAGGCCCTGAGGTCGG + Intergenic
1022865739 7:34417955-34417977 CCAGGCTAAGGCTCTGATGTGGG - Intergenic
1022911432 7:34902667-34902689 CAGGGCAGATCCTCTGCGGTAGG + Intergenic
1023101208 7:36720560-36720582 CAGGGCAGAGGCTCATAGCTTGG - Intronic
1023119047 7:36890949-36890971 CAGGGCAAAGGCCCTGAGGTTGG - Intronic
1023241374 7:38151322-38151344 CAGGGCAGAAGCTATGAGGAGGG - Intergenic
1023890815 7:44390768-44390790 CAGGGCAAAGGTTCAAAGGCTGG + Intronic
1024005494 7:45222437-45222459 CTGTGCAAAGGCCCTGGGGTTGG - Intergenic
1024343812 7:48292637-48292659 AAGTGCAAAGGCCCTGAGGTGGG - Intronic
1025238142 7:57248737-57248759 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1025247893 7:57331201-57331223 CAGCGCAAAGGCCCTGAGGCAGG - Intergenic
1025256292 7:57385772-57385794 AAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1025924522 7:65946250-65946272 CAAGTCAAAGGCCTTGAGGTAGG - Intronic
1025931843 7:66001479-66001501 CAAGTCAAAGGCCTTGAGGTAGG - Intergenic
1026444124 7:70469430-70469452 AAGAGCAAAGGCCCTGAGGCTGG + Intronic
1026518311 7:71092410-71092432 GAGGGCAAAGGCTGGGAGGAGGG + Intergenic
1027416777 7:77982687-77982709 CACGGCAAAGGGTCTGATGTGGG - Intergenic
1028130809 7:87170508-87170530 AAGTGCAAAGGCTCTGAGACAGG - Intronic
1028233765 7:88335980-88336002 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1029572509 7:101379510-101379532 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1030278581 7:107745378-107745400 AAGTGCGAAGGCACTGAGGTAGG + Intronic
1031070471 7:117155900-117155922 CAGTGTAAAGTTTCTGAGGTGGG - Intronic
1031686997 7:124742946-124742968 GGGGGAAAAGGTTCTGAGGTAGG - Intergenic
1031771428 7:125848805-125848827 CAGGGCAAAGCCTGGGAAGTGGG + Intergenic
1032396161 7:131591658-131591680 CAGGGCACAGGCTCTGGTCTTGG - Intergenic
1032527430 7:132589920-132589942 CAGTGCAAAGGCTGTGAGGTGGG + Intronic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1032863605 7:135904503-135904525 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
1033399409 7:141007653-141007675 CACAGCAAAGGCCTTGAGGTGGG - Intronic
1033830286 7:145243078-145243100 AATTGCAAAGGCTCTGAGGTAGG - Intergenic
1034081164 7:148278934-148278956 CAGTCCAAAGGCTGTGAGGTAGG + Intronic
1034188123 7:149195052-149195074 CAGTGCAAAAGCTCTGGGATGGG + Intergenic
1034355992 7:150451127-150451149 CAGGGCACAGGATGTGAGGAAGG - Exonic
1034553046 7:151833292-151833314 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1034934720 7:155191357-155191379 CAGGGCACAGGGTCAGGGGTCGG + Intergenic
1036971734 8:13362787-13362809 CGGGGCAAAGGCCCTGAGACAGG - Intronic
1037476501 8:19262922-19262944 CAGTGCAAAGGCCCTGGGGAAGG - Intergenic
1037499227 8:19469589-19469611 AAGGGCAGAGGTTCTGAAGTGGG - Intronic
1037638905 8:20724881-20724903 ATGGACAAAGGCCCTGAGGTAGG + Intergenic
1037708552 8:21336235-21336257 TAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1037788480 8:21917265-21917287 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1038131327 8:24734808-24734830 CAGGGCAAAGGTTGTGATCTGGG + Intergenic
1038190476 8:25315247-25315269 CTGTGCAAAGGCCCAGAGGTAGG - Intronic
1038194008 8:25349761-25349783 CCGGGGAAAGGCTAAGAGGTGGG + Intronic
1038360744 8:26873490-26873512 CAGGGCAAAGGTTCTAATGCAGG + Intergenic
1038898108 8:31810525-31810547 CTGTGCAAAGGCCCTGAGGTGGG - Intronic
1039119109 8:34126048-34126070 AAGTGCAAAGGCACTGAGGTAGG - Intergenic
1039290570 8:36089932-36089954 AAGTGGAAAGGCTCTGAGATAGG - Intergenic
1039483441 8:37892848-37892870 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1039566499 8:38555810-38555832 CAGGGCAAAGGGGCTGATGGCGG - Intergenic
1039719478 8:40147178-40147200 CTGTGCAAAGGCCCTGTGGTAGG - Intergenic
1039800231 8:40948197-40948219 TAGTGCAAAGGCCCAGAGGTGGG - Intergenic
1041569150 8:59316938-59316960 AAGTGCAAAGCCCCTGAGGTAGG - Intergenic
1041780024 8:61567991-61568013 AAGAGCAAAGGCTTGGAGGTAGG + Intronic
1041780624 8:61575008-61575030 CAAGTCAAAGGCTTTGAGGCAGG - Intronic
1041982079 8:63873630-63873652 CAGTGCAGGAGCTCTGAGGTGGG - Intergenic
1042864250 8:73343781-73343803 CAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1043475319 8:80600075-80600097 TAAGACAAAGGCTCTGAGGCTGG - Intergenic
1043963347 8:86443815-86443837 CAAGACAAAGGCTCTAATGTGGG + Intronic
1044387889 8:91611693-91611715 TTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1044457271 8:92403049-92403071 TAGGAGAAAGGCTTTGAGGTAGG + Intergenic
1044720484 8:95140752-95140774 CAGGGCCAAGGAGTTGAGGTGGG - Intronic
1044934487 8:97279587-97279609 CAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1044958113 8:97503098-97503120 CAGAGCAAGGGGTCTGGGGTGGG - Intergenic
1044966101 8:97575425-97575447 TAGGGCAAAGGTTCTGAGGTGGG + Intergenic
1045036579 8:98180881-98180903 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1045181003 8:99782593-99782615 CAGAGGGAAGGCTCTGAGGCAGG + Intronic
1045254254 8:100506401-100506423 TAGAGCAGAGGCTCTCAGGTGGG - Intergenic
1045358060 8:101406695-101406717 AAGGGCAAAGGCTGTGAGGCAGG - Intergenic
1045432728 8:102128424-102128446 CAGTGCAAAGGCTCTAACTTGGG + Intergenic
1046516792 8:115272525-115272547 AAGTGCCAAAGCTCTGAGGTGGG - Intergenic
1047275164 8:123400287-123400309 AAGTGCAAAGGCCCTGAGGTAGG + Intronic
1047372181 8:124265259-124265281 AACTGCAAAGGCCCTGAGGTAGG - Intergenic
1047668471 8:127118627-127118649 CAGGGCAAAGCCTCTGAAGCAGG - Intergenic
1047724514 8:127672240-127672262 CAGTGCATAGGCCCTGAGGTGGG - Intergenic
1048046962 8:130781662-130781684 CAGGACAAAGGCACAAAGGTGGG - Intronic
1048221201 8:132543711-132543733 GAGAGCAAAGGCCCTGTGGTGGG - Intergenic
1048791354 8:138106997-138107019 CCAGGCAAAGGCTCTGGGGTGGG + Intergenic
1048965589 8:139612176-139612198 ACGGGCAAAGGCGCAGAGGTAGG + Intronic
1049122858 8:140755465-140755487 CAGTGCAAAGGCCATGAGGCGGG - Intronic
1049215472 8:141405881-141405903 CAGTGCAAGGGCTCGGAGGCAGG + Intronic
1049224352 8:141442522-141442544 CTGGGCAAGGGCACAGAGGTGGG + Intergenic
1049406501 8:142453906-142453928 CAGTGCAAAGGCCCTGGGGCAGG + Intronic
1049536901 8:143186609-143186631 CAGGGTAGAGACGCTGAGGTAGG - Intergenic
1049540736 8:143207697-143207719 GAAGGCTGAGGCTCTGAGGTTGG + Intergenic
1049829934 8:144694021-144694043 CAGTACAAAGGCCCTGAGGCAGG + Intergenic
1049938647 9:523652-523674 CAGTGCAAAGGCCCTAAGGGAGG - Intronic
1050163021 9:2737540-2737562 CAGGGCGACGATTCTGAGGTTGG - Intronic
1050272350 9:3959638-3959660 CATGTGAAAGGCCCTGAGGTGGG - Intronic
1050957323 9:11681267-11681289 GAGGGCAAAGGGTGTGAGGAGGG + Intergenic
1051145543 9:14023483-14023505 AAGTGCAAAGGCCCTGTGGTAGG - Intergenic
1051247652 9:15127782-15127804 CAGGGAACAGGCAGTGAGGTAGG - Intergenic
1051260719 9:15261657-15261679 CAGTGCAGAGGGTCAGAGGTGGG - Intronic
1051476630 9:17516042-17516064 CAGTGCAAAGGTACTGAGTTGGG - Intergenic
1052023096 9:23546825-23546847 AAGTGCAAAGGCCCTGAGGTGGG + Intergenic
1052319898 9:27156546-27156568 AACAGCAAAGGCTTTGAGGTAGG + Intronic
1052564446 9:30129554-30129576 CAAGGTAAAAGGTCTGAGGTAGG + Intergenic
1052744191 9:32423749-32423771 CAGGGCAAAGGGTGGGAGGGAGG + Intronic
1053416880 9:37952361-37952383 AAGTGCAAAGGTCCTGAGGTAGG + Intronic
1054891513 9:70257401-70257423 AAGGACAAAAGCTCTGAGGTGGG - Intergenic
1054938021 9:70710076-70710098 GGGTGCAAAGGCTCTGAGGCAGG - Intronic
1054939712 9:70728069-70728091 GGGTGCAAAGGCTCTGAGGCAGG - Intronic
1055270050 9:74547646-74547668 CTGTGCAAAGGCCCTGAGGTAGG + Intronic
1055488589 9:76781426-76781448 CAGTGCAAAGGCTCTGAAGTGGG - Intronic
1055493320 9:76828252-76828274 CTGTGCAAAGGCACTGAGGTGGG + Intronic
1055874379 9:80924561-80924583 CTGGGCAAAGGCCCTGAGGCAGG + Intergenic
1055971734 9:81918790-81918812 CAGTGAAATGGCTCTGAGGTTGG - Intergenic
1055973486 9:81933862-81933884 CAGTGAAATGGCTCTGAGGTTGG - Intergenic
1055975240 9:81948954-81948976 CAGTGAAATGGCTCTGAGGTTGG - Intergenic
1055980274 9:81994118-81994140 CAGTGAAATGGCTCTGAGGTTGG - Exonic
1056032164 9:82564321-82564343 TAGTGCAAAGGCTCAGAGGCAGG - Intergenic
1057297666 9:93859030-93859052 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1057390893 9:94640616-94640638 CAGTGCACAGGCCCTGGGGTAGG + Intergenic
1057428813 9:94976192-94976214 CTGGGCAAAGGTTCTGTGGAAGG - Intronic
1057831258 9:98409059-98409081 CAGGGCCAAGTCCCTCAGGTGGG + Intronic
1057853054 9:98580171-98580193 AAGTGCAAAGGCCCAGAGGTGGG - Intronic
1057960725 9:99454194-99454216 CAGTGCAAAGGCTGTCAGGTGGG + Intergenic
1058348625 9:103994777-103994799 CAGGGGAAAGGGTGTGGGGTGGG + Intergenic
1058504593 9:105655350-105655372 CAGTGAAAAGGCTCTGAGGAAGG + Intergenic
1058805168 9:108583520-108583542 GAGGGCGAAGGCACTGAGCTGGG - Intergenic
1058903337 9:109460591-109460613 CAGTGCAAAGGCCCTGAGGCTGG - Intronic
1059286100 9:113172928-113172950 CTGGGCAAAGGCACTGAGATAGG - Intronic
1059308918 9:113375267-113375289 AAGTGCAAAGGCCCTGAGGCAGG + Intronic
1059421376 9:114194553-114194575 CATGGCAAAGGCAGGGAGGTGGG + Intronic
1059427364 9:114229553-114229575 CCTGGCAAGTGCTCTGAGGTGGG - Intronic
1059687756 9:116653853-116653875 CAGATCAAAGGCTCTGGGGGAGG + Intronic
1060104321 9:120863971-120863993 CTGAGCAAAGGCTATGAGGTAGG + Intronic
1060290566 9:122299003-122299025 AAGTGCAAAGGCCCTGAGGTGGG + Intronic
1060295127 9:122338177-122338199 CGGGGCAAAGGAGCAGAGGTGGG - Intergenic
1060342504 9:122789672-122789694 CATGGCCACGGCTGTGAGGTGGG - Exonic
1060383791 9:123203557-123203579 AAGTGGAAAGGCTCTGAGGTGGG - Intronic
1060602171 9:124885664-124885686 AAGTGCCAAGGCCCTGAGGTTGG + Intronic
1060663679 9:125419809-125419831 CCAGGCAAAGGCTCGGAGGTGGG + Intergenic
1060758557 9:126229792-126229814 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1060765434 9:126292174-126292196 CTGTGCAAAGGCCCTGAGGCTGG - Intergenic
1060975864 9:127764610-127764632 AAGTGCAAAGACCCTGAGGTGGG - Intronic
1061242873 9:129384351-129384373 TCGTGCAAAGGCCCTGAGGTAGG - Intergenic
1061372827 9:130207402-130207424 AGGGGCAGAGGCTCTGAGGTGGG - Intronic
1061671893 9:132193478-132193500 AGGAGCACAGGCTCTGAGGTGGG + Intronic
1061675603 9:132213994-132214016 CACGGCAATGGCTCTGAACTGGG - Intronic
1061750425 9:132773191-132773213 CAGTGCAAAGGCCCTGAGTTAGG - Intronic
1061959790 9:133982174-133982196 CAGGGGAAAGGCCCTGAACTGGG + Intronic
1062267474 9:135693899-135693921 CAGGGCAGACGGACTGAGGTGGG - Intronic
1062282738 9:135759252-135759274 AAGGGGCAAGGCTCTGAGATGGG + Intronic
1186092299 X:6062956-6062978 CAGTGCCAAGGCTCTGGGGTAGG - Intronic
1186515581 X:10164250-10164272 CAGTGCAAAGGCCCTGAGGCAGG + Intronic
1186515753 X:10165172-10165194 CAGTGCAAAGGCCCTGGGGCAGG - Intronic
1186672223 X:11779659-11779681 CAGGGCCAAGACCCTGAGGCAGG + Intergenic
1186892385 X:13971772-13971794 CAGTGCAAAGGCCCTGAGGCAGG - Intergenic
1187237049 X:17477323-17477345 AAGTGCAAAGGCCCTGAGGCTGG + Intronic
1187277141 X:17826152-17826174 CAGTACAAAGGCCCTGAGGCAGG - Intronic
1187410811 X:19049092-19049114 AAAGGCAAAGGCCCTGAGGTGGG - Intronic
1187452556 X:19411737-19411759 AAGTGCAAAGGCCCTGAGGAGGG + Intronic
1188286084 X:28326995-28327017 AAGTGCAAACTCTCTGAGGTGGG - Intergenic
1189095146 X:38130548-38130570 CCTGGCAAAGGCCATGAGGTGGG - Intronic
1189200405 X:39190684-39190706 CAGTGCAAAGGCCATGAAGTAGG - Intergenic
1189227278 X:39423310-39423332 CAGTGCAAAGGCCTTGAGGCAGG - Intergenic
1189278601 X:39805140-39805162 AAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1189301846 X:39957979-39958001 CAGTGCAAGGGCCCTGAGGCAGG + Intergenic
1189305782 X:39985683-39985705 CAGTGCAAAGGCCCTGAGGGAGG + Intergenic
1189327377 X:40121003-40121025 CAGTGCAAAGGCCCTGTGGTAGG + Intronic
1189709415 X:43794222-43794244 CAGTGCCAAGGCACTGAGGTGGG - Intronic
1189926178 X:45957984-45958006 TAGTGCAAAGGCCCTGAGGCAGG + Intergenic
1190062928 X:47222584-47222606 CAGTGTAAAGGCCCCGAGGTGGG + Intronic
1190119226 X:47646915-47646937 CAGTTCAGAGGCCCTGAGGTGGG - Intronic
1190119436 X:47648604-47648626 CAATGCAAAGGCCCTGAGGCTGG + Intronic
1190220761 X:48511107-48511129 CAGGGCAAAGGCCTTCAGGCTGG - Intronic
1190221794 X:48516677-48516699 CAGTGGAAAGGCCCTGAGGTAGG + Intronic
1190336805 X:49267519-49267541 CAGGGCAAAGGTCCTGAGGTGGG + Intergenic
1190525678 X:51327375-51327397 TAGAGCAAAGGCCCTGAGGAGGG + Intergenic
1190543808 X:51504297-51504319 TAGAGCAAAGGCCCTGAGGAGGG - Intergenic
1190711544 X:53075180-53075202 CAGAGCAAAGGCCCTGAGGTGGG - Intronic
1191666062 X:63703918-63703940 CAGTGCAAAGGCTCTAAGGGAGG + Intronic
1191718604 X:64210313-64210335 CAGTGCAAAGGCCCTGAGGTGGG - Intergenic
1192157022 X:68754250-68754272 CAGTGCAAAGACCCTGAGGCAGG - Intergenic
1192223543 X:69213400-69213422 CAATGCAAAGGCTCTGAGGCAGG + Intergenic
1192461417 X:71320467-71320489 CTGGACAAAGGCACAGAGGTGGG - Intergenic
1193078430 X:77380807-77380829 CAGGGTAAAGAGTCAGAGGTGGG + Intergenic
1193330571 X:80231812-80231834 GAGGGCCAAGGCTCTGTGGTGGG + Intergenic
1193367027 X:80646960-80646982 CAGGGCAATGGCACTGAAGCTGG - Intergenic
1194602191 X:95935807-95935829 CAGGGGAAAGGGTGGGAGGTGGG - Intergenic
1194937267 X:99965864-99965886 GAGGGCAAATCGTCTGAGGTCGG - Intergenic
1195220022 X:102737985-102738007 CAGGGCTAAGCCTGTTAGGTGGG - Intronic
1195304154 X:103562652-103562674 ATGTGCAAAGGCCCTGAGGTGGG - Intergenic
1195402102 X:104472040-104472062 CTGGTCAAAGGCCCAGAGGTGGG + Intergenic
1195408594 X:104544391-104544413 AAATGCAAAGGCTCTCAGGTGGG - Intergenic
1195731527 X:107973175-107973197 TAGCGCAAAGTCTCTGAAGTAGG + Intergenic
1195767472 X:108311580-108311602 GAGGGCAGAGGCCCTGAGGCAGG - Intronic
1196003773 X:110813800-110813822 AAGTGCAAAGGCCCTAAGGTAGG + Intergenic
1196064902 X:111453400-111453422 TAGTGAAAAGGCTCTGAGGCGGG + Intergenic
1196196217 X:112840812-112840834 CTGGGCAAAGGATGGGAGGTAGG + Intronic
1196402244 X:115328958-115328980 AAGTGCAAATGCTCTGAGGCAGG - Intergenic
1196824625 X:119731467-119731489 AGGTGCAAAGGCCCTGAGGTGGG + Intergenic
1196848802 X:119918073-119918095 AAGTGCAAAGGCCCTGAGGCAGG - Intronic
1196865185 X:120065011-120065033 CAGTGCAAAGGCCCCAAGGTGGG + Intergenic
1196877908 X:120171269-120171291 CAGTGCAAAGGCCCCAAGGTGGG - Intergenic
1196890240 X:120284355-120284377 AAGTGCAAAGGTTCTGAGGCAGG - Intronic
1197306976 X:124854349-124854371 CAGGGGAAAGGGTAGGAGGTGGG + Intronic
1197704459 X:129623725-129623747 AAATGCAAAGGCCCTGAGGTAGG + Intergenic
1197809515 X:130428969-130428991 AAGTGCAAAGACCCTGAGGTGGG + Intergenic
1197969134 X:132096620-132096642 CAGGGCACAAGGACTGAGGTGGG + Intronic
1198453846 X:136795697-136795719 AAGTGCAAAGGCCCTGAGGTTGG - Intergenic
1198633657 X:138672006-138672028 CAGTGCAAAGGCTCTAAAGCAGG + Intronic
1198657109 X:138926619-138926641 CAGTGCAAAGGCTCTAATGTAGG + Intronic
1198802322 X:140460405-140460427 CAGGGCAAAGGCCTTGAAATAGG + Intergenic
1198975083 X:142327406-142327428 CATGGCAATGGCACTGGGGTAGG + Intergenic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1201228698 Y:11843045-11843067 AAGTGCAAAGGCTCTGAGGTGGG - Intergenic
1201504887 Y:14687310-14687332 CAGTGCCAAGGCCCTGGGGTGGG + Intronic