ID: 1163584514

View in Genome Browser
Species Human (GRCh38)
Location 19:18156539-18156561
Sequence CAGGAGGACCAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1612
Summary {0: 1, 1: 0, 2: 15, 3: 159, 4: 1437}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163584514 Original CRISPR CAGGAGGACCAGAGGGAGGA AGG Intronic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
900367525 1:2317360-2317382 CAGGAGGGGCACAGGGAGGTAGG + Intergenic
900391497 1:2435937-2435959 GAGGAGGAGAGGAGGGAGGAAGG - Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900471953 1:2859453-2859475 GAGGAAGACAAGAGGGAGGAAGG + Intergenic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900554040 1:3270879-3270901 GAGGAGGACCGTTGGGAGGAGGG + Intronic
900746557 1:4364854-4364876 CAGGAGGAAGACAGAGAGGAGGG - Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
900932829 1:5747619-5747641 AGGGAGGAGCAGAGGGAGGGAGG + Intergenic
900932844 1:5747664-5747686 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
901056144 1:6449368-6449390 GAGGAGGCCCAGAGAGGGGAGGG - Intronic
901264406 1:7899071-7899093 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
901305879 1:8232361-8232383 GAGGAGGACGAAAAGGAGGAGGG + Intergenic
901403863 1:9032949-9032971 CAGGAATAGCAAAGGGAGGAAGG + Intergenic
901419722 1:9142895-9142917 AAGGAGGAAGGGAGGGAGGAAGG - Intergenic
901419733 1:9142931-9142953 AAGGAGGAAGGGAGGGAGGAGGG - Intergenic
901536066 1:9883667-9883689 CAGGAGGACCATGAGGAGGGAGG - Intronic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
901794196 1:11671174-11671196 CAGGAGGGCGGGAGGGAGGGTGG - Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902398294 1:16144135-16144157 CAGGAGGGAGAGAGGGAGGGAGG + Intronic
902421923 1:16287688-16287710 CAGGAGGCTGAGTGGGAGGATGG - Intronic
902489009 1:16766898-16766920 TAGGAGGTCCTCAGGGAGGAGGG - Intronic
902541098 1:17155382-17155404 CAGGAGGACCAGAGAGACCTTGG + Intergenic
902691538 1:18112937-18112959 AAGGAGGTGGAGAGGGAGGATGG - Intronic
902782472 1:18713305-18713327 CAGTAGGACCACAGGCAGCATGG + Intronic
902789403 1:18756416-18756438 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
903396176 1:23003417-23003439 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
903480887 1:23652471-23652493 CGGGAGGACTGAAGGGAGGAGGG + Intergenic
903567202 1:24276893-24276915 CGGGAGGAACAGAGCGAGCATGG + Intergenic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904335413 1:29794107-29794129 CAGGAGGGAGAGAGGGAGGGAGG - Intergenic
904463118 1:30692274-30692296 AAGGAAGCCCAGAGGGAGGAGGG + Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904817094 1:33212128-33212150 CAGGAGGAACAGAGAGAAGGCGG - Intergenic
905117832 1:35657934-35657956 CAGGAGGCCCTGAGAGAGCAAGG - Intergenic
905120215 1:35676062-35676084 GAGGAAGAAGAGAGGGAGGAAGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
906072842 1:43029640-43029662 GAGGAGGAGGACAGGGAGGAGGG - Intergenic
906073508 1:43035115-43035137 CAGGAGGAAAATAGGCAGGAGGG + Intergenic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906270344 1:44472892-44472914 AAGAAGGATCAGAGGGAGAAAGG - Intronic
906403393 1:45521955-45521977 CCGGAGGAGGAGAGAGAGGAGGG + Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906744675 1:48213464-48213486 AAGGAGGACTGGAGGGTGGAAGG + Intergenic
906835342 1:49077813-49077835 AAAGATGACCAAAGGGAGGAGGG + Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907952302 1:59195594-59195616 AAGAAGGAAGAGAGGGAGGAAGG - Intergenic
908478040 1:64508096-64508118 CAGGAGGACAAGAGAGAGAAGGG + Intronic
908936018 1:69376501-69376523 GAGGAGGAGGAGAGGAAGGAAGG + Intergenic
908947427 1:69516524-69516546 CACAAGAACCAGAGGCAGGAGGG - Intergenic
909157025 1:72091363-72091385 AAGGAGGAACGGAGGGAGGGAGG - Intronic
909288733 1:73854915-73854937 CGGGAGGGAGAGAGGGAGGAAGG + Intergenic
909345760 1:74584509-74584531 CAGAAAGACCACAGGGAGCAGGG - Intronic
909434016 1:75619226-75619248 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
909533348 1:76706212-76706234 CAGGAAGAAAGGAGGGAGGAAGG - Intergenic
909954000 1:81754653-81754675 AAGGAGGAAGGGAGGGAGGAAGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
910554604 1:88517477-88517499 GAGGAGGAGAAGAGGAAGGAAGG + Intergenic
910701941 1:90084960-90084982 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
910701947 1:90084987-90085009 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
910952650 1:92667177-92667199 CAGGAGGCTCAGGGGGAAGACGG + Intronic
911224547 1:95290899-95290921 GAGAAGTAACAGAGGGAGGACGG - Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911630212 1:100174995-100175017 CAGGAGCAAAAGAGGGAGCAGGG - Intronic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
912390656 1:109300382-109300404 GAGGAGGCCCAGAGGGAAGGCGG + Intronic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
912794949 1:112687618-112687640 CAGGAGGAGCAGAGGTGGGCAGG - Intronic
912953312 1:114135472-114135494 TAGGAGGAGGAGATGGAGGAGGG + Intronic
913380085 1:118201161-118201183 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
913458209 1:119055724-119055746 GAGGAGGAGAAGAGGGAGGGAGG + Intronic
914191869 1:145419066-145419088 AAGGAGGAAGGGAGGGAGGAAGG + Intergenic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915312761 1:155012531-155012553 CAGGAGGATTAAAGGGAGCAGGG + Intronic
915366716 1:155320979-155321001 CAGGAGGACCCTGGTGAGGAGGG + Exonic
915431814 1:155872583-155872605 CAGAAGGACAAGGGGGAGAAAGG - Intronic
916512120 1:165481816-165481838 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
917059150 1:171017822-171017844 CAGGAAGACCCCAGCGAGGAGGG - Intronic
917157383 1:172019028-172019050 AAGGAGGAAGGGAGGGAGGAAGG - Intronic
917871881 1:179249368-179249390 AAGGAAGACCAGAGGGAGCATGG + Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
919055572 1:192565762-192565784 GAGGAGGTGGAGAGGGAGGAAGG + Intergenic
919091079 1:192979579-192979601 AAGGAGGAACGGAGGGTGGAAGG + Intergenic
919236391 1:194849830-194849852 AAGGAAGAAAAGAGGGAGGAGGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919817858 1:201452944-201452966 CAGGATGCCCTGAGGTAGGAAGG + Intergenic
920080574 1:203369836-203369858 CAGGAGGAAAAGAGGAAGCAGGG + Intergenic
920110505 1:203583869-203583891 AAGGAGGAAGGGAGGGAGGAAGG + Intergenic
920110531 1:203583974-203583996 AAGGAGGAAGGGAGGGAGGAAGG + Intergenic
920166457 1:204039674-204039696 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
920910031 1:210207674-210207696 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
922151401 1:223008052-223008074 AATGAAGACTAGAGGGAGGAGGG + Intergenic
922213268 1:223501218-223501240 GAGGAGGAGGAGAGGGAGGAGGG - Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
922724937 1:227918318-227918340 GAGGAGGACCCTGGGGAGGAGGG - Intergenic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
922859568 1:228804643-228804665 GAGGAAGAAAAGAGGGAGGAAGG - Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923113675 1:230914099-230914121 CAGGAGGCCCAGAGCAAGGGAGG + Intronic
923344594 1:233039246-233039268 GGGAAGGAACAGAGGGAGGAAGG - Intronic
923482334 1:234397209-234397231 GAGGAGGAGGAGGGGGAGGAGGG + Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923531427 1:234815626-234815648 TAGGAGGTCCTCAGGGAGGAGGG + Intergenic
923621739 1:235585133-235585155 AAGGAAGACCAGAGGGAGGGAGG - Intronic
923774395 1:236965791-236965813 AAGGAGGAAGAGAGGGAGGGAGG - Intergenic
923877275 1:238062833-238062855 GAGAAGGAGCAGAGGAAGGATGG - Intergenic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924269506 1:242318249-242318271 AAAGAGGACCAGAGGTGGGATGG + Intronic
924461465 1:244263356-244263378 GAGAAGGAAGAGAGGGAGGAGGG + Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063194406 10:3727742-3727764 CAGGAGGGAGAGAGGGAGAAAGG - Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063290268 10:4738628-4738650 AAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1063525273 10:6778937-6778959 AAGGAAGAAGAGAGGGAGGAAGG + Intergenic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1063907063 10:10792032-10792054 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1063929292 10:11013015-11013037 CAGGAAGAGGAGGGGGAGGATGG - Intronic
1063999827 10:11654222-11654244 GAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1064002621 10:11676108-11676130 CAGGAGGAAGAGAGCGAGGCAGG - Intergenic
1064213884 10:13383570-13383592 CAGGAGGACCTGAGAGTGGCCGG + Intergenic
1065261369 10:23926792-23926814 GAGGAAGAAAAGAGGGAGGAAGG - Intronic
1065565545 10:27004173-27004195 CAGGAGGAGAAGGGGGAGAAAGG + Intronic
1065625200 10:27623107-27623129 CAGGAGGCTGAGTGGGAGGATGG - Intergenic
1065738536 10:28775730-28775752 CAGGAGGAAGAGAGAGAGGCAGG + Intergenic
1065742850 10:28812795-28812817 AAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1065821568 10:29530364-29530386 CAGGTGGGCCAGAGGCAGGAGGG + Intronic
1065872932 10:29971480-29971502 CAGGAGCACGAGAGAGAGGGGGG + Intergenic
1065894927 10:30154815-30154837 CAGGAGGAAGAGAGGGAGTGGGG + Intergenic
1065963866 10:30755048-30755070 CAGGAGGAGCACAGGGATGGAGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066715396 10:38280522-38280544 AAAGAGGACCAGAGGTGGGATGG - Intergenic
1066782699 10:38970190-38970212 AAAGAGGACCAGAGGTGGGATGG + Intergenic
1067191676 10:44075109-44075131 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1067461593 10:46462231-46462253 CACGAGGACGAGCGAGAGGATGG + Exonic
1067625601 10:47922370-47922392 CACGAGGACGAGCGAGAGGATGG - Intergenic
1067808538 10:49409683-49409705 CAGGAGGGCAGGAAGGAGGAAGG - Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1068803870 10:61172757-61172779 AAGGAGGGACGGAGGGAGGATGG + Intergenic
1068948662 10:62755351-62755373 AAGGAGGAAGAAAGGGAGGAGGG + Intergenic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069824079 10:71244661-71244683 CAAGAGGAGAGGAGGGAGGAGGG + Intronic
1070001150 10:72378427-72378449 CAGGAGGAAGAGAGAGAGGTGGG - Intronic
1070324309 10:75377982-75378004 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070555338 10:77523003-77523025 CAGGAGGACTACATAGAGGAGGG - Intronic
1070599083 10:77853379-77853401 GAGGAGGACCAGAAGGAGATCGG - Exonic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1070975786 10:80604487-80604509 CAGGAGGGCCAGAGGCTGGGTGG + Intronic
1071431882 10:85612928-85612950 CAGGAGGAATATAGGGAGAAAGG + Intronic
1071600375 10:86956007-86956029 CCGGTGGACGGGAGGGAGGAGGG - Intronic
1071602072 10:86963171-86963193 CAGAAGGACCAGAGGGTGGGTGG - Exonic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1071961378 10:90811403-90811425 CAGGTGGATCAGAGAGATGAAGG - Intronic
1072195733 10:93116027-93116049 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1072917237 10:99545556-99545578 GAGGGGGAGCAGTGGGAGGAGGG + Intergenic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073065578 10:100757215-100757237 CAAGAGGAGAAAAGGGAGGAAGG + Intronic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073191859 10:101657071-101657093 CGGGAGGATTGGAGGGAGGAGGG - Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073352511 10:102830119-102830141 CAGGAGGCCAGGAGGGAGGTTGG - Intergenic
1073439267 10:103543152-103543174 CTGCAGGACTACAGGGAGGAGGG - Intronic
1073512706 10:104052632-104052654 AAGGAGGCCAAGAGGGAGGTGGG - Intronic
1073597706 10:104817372-104817394 GAGGAGGAGGAGGGGGAGGAAGG - Intronic
1073773274 10:106758857-106758879 CAAGAGCACCAGAGGGAGAGAGG + Intronic
1073894927 10:108144343-108144365 GGGGACTACCAGAGGGAGGAGGG - Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074306928 10:112287679-112287701 CCAGAAGCCCAGAGGGAGGAAGG + Intronic
1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG + Intronic
1074803056 10:117021251-117021273 AAGGAGGAAGGGAGGGAGGAAGG - Intronic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1074909990 10:117899718-117899740 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1074969651 10:118525630-118525652 CAGGAGGAAGAGAGAGAGGAAGG - Intergenic
1075032023 10:119030030-119030052 CAGGACGACGAGGAGGAGGAGGG - Exonic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075202052 10:120412671-120412693 CAGGAGCTCCAGAGAGACGAAGG + Intergenic
1075221230 10:120586582-120586604 CAGGAGGACCAGAATGGGAAAGG + Intronic
1075678333 10:124313409-124313431 GAGGAGGAAAAGAGGCAGGAAGG + Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075963025 10:126585560-126585582 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1076120483 10:127933028-127933050 CAGGAGAGCCAGAGAGATGAGGG - Intronic
1076201546 10:128562771-128562793 GAGGAGGAAGAGAGGAAGGAAGG + Intergenic
1076316653 10:129546613-129546635 AAGAAGGACCAGAGAGAGAATGG + Intronic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076813958 10:132905317-132905339 CAGGAGGACCCTGGGGAGGGCGG - Intronic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1077008216 11:369102-369124 CAGGCGGACAACACGGAGGAGGG - Intergenic
1077048278 11:555599-555621 CTGGAGGACCAGGGGGCGGCCGG + Intronic
1077137175 11:1006270-1006292 CAGGAGGGGCCGAGGGAGGAGGG + Intronic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077499744 11:2903764-2903786 CAGGAGGAACAGCGCTAGGAAGG - Intronic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1077829653 11:5852533-5852555 GAGGACTACTAGAGGGAGGAGGG - Intronic
1077847944 11:6045887-6045909 CAGGAGGACTAAAGGGATGAAGG + Intergenic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078059224 11:8032666-8032688 CGGGAGGTGCAAAGGGAGGAGGG - Intronic
1078076531 11:8166928-8166950 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1078987034 11:16607004-16607026 GAGGAGGAGGAGCGGGAGGAGGG - Intronic
1079370552 11:19848440-19848462 GAGGAGGACCAGAGAAAGGAGGG - Intronic
1079816925 11:25072921-25072943 CAGGAGGACCAGAGAGACCTTGG + Intronic
1079817197 11:25076565-25076587 AAGGAGGAAGGGAGGGAGGAAGG + Intronic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080117324 11:28635507-28635529 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1080127527 11:28754454-28754476 AGGGAGGAACAGAGGGAAGAAGG + Intergenic
1080318150 11:30973301-30973323 CAGGAGGAAGAGAGAGAGGGGGG - Intronic
1080419163 11:32094803-32094825 AATGGGGACCAGAGGCAGGACGG + Intronic
1080812189 11:35715843-35715865 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1081197673 11:40181177-40181199 AAGGAGGATGGGAGGGAGGAAGG - Intronic
1081259846 11:40946089-40946111 GAGGACTACTAGAGGGAGGAGGG - Intronic
1081279449 11:41190236-41190258 ACGGAGGACAAGAGAGAGGAAGG + Intronic
1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG + Intronic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1081783808 11:45732425-45732447 CAGGAGGAAGAGAGAGAGGGTGG + Intergenic
1082192569 11:49265242-49265264 AAGGAGGAAGAGAGGGAGAAGGG + Intergenic
1082831839 11:57624118-57624140 CAGGACCACCAGGGTGAGGATGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083097604 11:60267558-60267580 CAGTAGTCCCAGAGAGAGGATGG + Intergenic
1083282906 11:61638440-61638462 GGGGAGGACAGGAGGGAGGACGG + Intergenic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083597363 11:63924596-63924618 CAGGAGGGGCAGTGGGAGAAGGG - Intergenic
1083669773 11:64293115-64293137 CAGCAGGCCCAGAGGGAGCTGGG + Exonic
1083712951 11:64560000-64560022 CAGGAGGGGGAGCGGGAGGAGGG - Intronic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1083742508 11:64718334-64718356 GAGGAGAGCCAGAGGGAGGCCGG - Intronic
1083784554 11:64936388-64936410 CAGGAGGCTAAGGGGGAGGATGG - Intergenic
1083921613 11:65784114-65784136 CAGAAGGAGCATCGGGAGGAGGG + Intergenic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084400362 11:68939695-68939717 CCAGAGGACCAGCCGGAGGAAGG + Exonic
1085410714 11:76288790-76288812 CGGGAGGAGCAGAGGAAGTAAGG + Intergenic
1085472397 11:76766711-76766733 CAGGAGGGTCCCAGGGAGGATGG - Intergenic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1085847507 11:80083194-80083216 AAGAAGGAAGAGAGGGAGGACGG - Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1087289087 11:96300056-96300078 CAGGAGGCTCAGAGAGAGTAAGG + Intronic
1087474858 11:98622232-98622254 TGGGAGGAAGAGAGGGAGGAGGG - Intergenic
1087518821 11:99203036-99203058 AGGGAGGAAGAGAGGGAGGAAGG + Intronic
1087871304 11:103295934-103295956 CAGGAGGACCAGAGAGACCTCGG - Intronic
1088197677 11:107293864-107293886 AAGGAGGGCAAGAGGAAGGAGGG + Intergenic
1088528904 11:110786718-110786740 CAGGAGCAAGAGGGGGAGGAAGG - Intergenic
1088586875 11:111367182-111367204 CAGGAGGCTCAGAGGAAGGGAGG - Intronic
1088815841 11:113420179-113420201 GAGGAGGAAGACAGGGAGGAAGG - Intronic
1088988101 11:114927664-114927686 AAGGAGGTCGAGAGAGAGGAAGG + Intergenic
1089123179 11:116155496-116155518 GAGGAGGAGGAGAGGAAGGAGGG + Intergenic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1089810117 11:121124870-121124892 GAGGAGGACTAAAGGCAGGAAGG + Intronic
1089964904 11:122647876-122647898 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090131832 11:124150779-124150801 CAGGAAGACGAGAAAGAGGAAGG + Intergenic
1090502966 11:127279720-127279742 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1090580403 11:128152885-128152907 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090580420 11:128152929-128152951 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090585336 11:128205996-128206018 GAGGAGCAAGAGAGGGAGGAGGG + Intergenic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1091180864 11:133603350-133603372 GAGGAGGAGCAGGGGGTGGAGGG + Intergenic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091689604 12:2586807-2586829 CAGGAGGAGGGGAGTGAGGATGG - Intronic
1091696454 12:2631263-2631285 GAGGAGGAGGAGAGAGAGGAAGG - Intronic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1091845123 12:3649822-3649844 AAGGAGGAAGAGAGGAAGGAAGG + Intronic
1091879536 12:3965750-3965772 CAGGAAGGCCACAGGAAGGATGG + Intergenic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092787150 12:12037314-12037336 CAGGAAGACAAGAGAAAGGAGGG + Intergenic
1093123066 12:15295978-15296000 CAGGAGGAAGAGAGAGAGAAAGG - Intronic
1093654151 12:21675702-21675724 TAGGAGGAAGAGAAGGAGGAGGG - Intronic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1094078876 12:26510642-26510664 CAGGAGGACCCGCAGGAGTAAGG + Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094388181 12:29918176-29918198 AAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1095402474 12:41830811-41830833 AAGCAAGACCAGAGGGAGGGAGG + Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1095866679 12:46979740-46979762 GAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1095981884 12:47978722-47978744 CAGAAGGACCAGGGGGACCAGGG + Exonic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096101248 12:48971628-48971650 CGGGAGGAAGGGAGGGAGGAAGG + Exonic
1096160377 12:49371735-49371757 CAGGAGGAAGAGAGAGAGGTGGG + Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097017521 12:55997879-55997901 CAGCAGGGCCAAAGTGAGGAGGG - Intronic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097250485 12:57629984-57630006 CAGCAGGGCCAGAGGGAGAAAGG - Intronic
1097261481 12:57722867-57722889 CAGATGGACCAGAGGAAGCAGGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1099292238 12:80787528-80787550 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
1099582620 12:84470583-84470605 CAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1099587010 12:84532059-84532081 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
1099739901 12:86620853-86620875 CAGGAGGAAGAGAGAGAGAAAGG - Intronic
1100052063 12:90460924-90460946 CAGGAGCAAGAGAGGAAGGAGGG + Intergenic
1100199098 12:92279337-92279359 CAGGAGGATCAGAGGGAATCAGG + Intergenic
1100237146 12:92672419-92672441 GAGCAGGACAAGGGGGAGGAGGG + Intergenic
1100581051 12:95940903-95940925 CTGGAGGTCAAGAGGAAGGAAGG + Intronic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101664606 12:106800348-106800370 CAGGAGGAAGAGAGAGAGAAGGG + Intronic
1101706528 12:107225725-107225747 CGGGAGGAGGAGGGGGAGGAAGG + Intergenic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102476690 12:113193231-113193253 CAGGAGGCTGAGGGGGAGGATGG - Intergenic
1102501151 12:113353538-113353560 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1102572207 12:113833694-113833716 CAGGACCACCAGAGAGGGGAAGG - Intronic
1102598767 12:114012976-114012998 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1102781690 12:115571077-115571099 CAGGAGGTCCAAAGGGAGTGGGG + Intergenic
1103185813 12:118956183-118956205 GGGGAGGGCCAGAGGGAGGTAGG + Intergenic
1104158415 12:126155060-126155082 AAGGAGGAAAAGAGGGAGAAAGG + Intergenic
1104289016 12:127451456-127451478 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104497027 12:129250489-129250511 CAGGAGGATCAGAGTTAGGAAGG - Intronic
1104593563 12:130104082-130104104 CAGGAGGACCCGAAGGAGCCAGG - Intergenic
1104668851 12:130666976-130666998 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1105344231 13:19559569-19559591 GAGGAGGAGCAAAGGGAGCATGG + Intergenic
1105441202 13:20416425-20416447 CAGGAGGTCTGGAGGCAGGAAGG + Intronic
1105519177 13:21116242-21116264 GAGCAGGACCACAGGGAGGAAGG - Intergenic
1105532225 13:21230397-21230419 CAGGAGGCTGAGTGGGAGGATGG + Intergenic
1105535800 13:21262005-21262027 GAGGAGGAGCAAAGGGAGCATGG - Intergenic
1105777412 13:23676599-23676621 GAGGAGGACTAAAGAGAGGAAGG + Intergenic
1105947437 13:25201896-25201918 CAGGAGGTCCAGAGGTATGTTGG + Intergenic
1106104350 13:26721389-26721411 CAGGAGGCTTAGAGGCAGGAGGG + Intergenic
1106345379 13:28871949-28871971 GAGGAGGCCGAGAGGGAGGCAGG + Intronic
1106474679 13:30088525-30088547 CAGGAGGAAGAGAGAGAGGGGGG + Intergenic
1106666858 13:31860421-31860443 AAGGAGGATGGGAGGGAGGAAGG - Intergenic
1106675883 13:31957633-31957655 GAGGAGGAGAAGAGGGGGGAAGG + Intergenic
1106938495 13:34750330-34750352 CTGCAGGACCACAGGGAGGGAGG + Intergenic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107357526 13:39583853-39583875 CCGGAGGACACGAGGGAGGATGG - Intronic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1110129322 13:71987543-71987565 AAGGAGGAAGAGAGGGAGGGAGG + Intergenic
1110146590 13:72199177-72199199 CCAGATGACCAGAGGGAGGGGGG + Intergenic
1110240628 13:73262501-73262523 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1110379918 13:74838925-74838947 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1110412779 13:75221995-75222017 CAGGAGGAAGAGAGACAGGAGGG + Intergenic
1110610836 13:77485887-77485909 AAGGAGGAACAGAGGAGGGAGGG + Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110650663 13:77938143-77938165 CAGGAGGAATGGAGGGTGGAAGG + Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111452600 13:88438685-88438707 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112552038 13:100430483-100430505 CTGGAGGAACACAGAGAGGATGG - Intronic
1113058655 13:106297436-106297458 CAGGAGGAAGAGAGAGAGAAGGG - Intergenic
1113140577 13:107144355-107144377 CAAGAGGCTCAGAGGGAGCATGG + Intergenic
1113326642 13:109288791-109288813 AAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1113378980 13:109786248-109786270 CAGGAGCCCCAGAGCGCGGAGGG - Exonic
1113568433 13:111335826-111335848 CAGGAAGATCACAGCGAGGAAGG + Intronic
1113593308 13:111515330-111515352 CATGAGGGTCTGAGGGAGGAGGG + Intergenic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1114367969 14:22050597-22050619 TAGGAGGAAGAGAGAGAGGACGG + Intergenic
1114444039 14:22774320-22774342 CAGGTGGAGCAGAGGTAGGATGG + Intronic
1114646371 14:24258734-24258756 CAGGAGTATCAGGGGGAGAAGGG + Intronic
1114650974 14:24284475-24284497 CAGGAGGAGCAGTGCAAGGAGGG + Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115006882 14:28496612-28496634 CAGGAGGAAGGGAGAGAGGAAGG - Intergenic
1115089731 14:29559354-29559376 CAGGAAGATCATAGAGAGGAGGG + Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115365965 14:32557335-32557357 TAGGAGGCCAAGATGGAGGATGG - Intronic
1115619423 14:35126518-35126540 GAGGAGAACCACAGGGAAGAAGG + Intronic
1116198643 14:41761269-41761291 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1116808810 14:49519884-49519906 CAGGAAGGCCAGAAGGAGGGAGG + Intergenic
1117010065 14:51462034-51462056 AAGGAGGAAGAGAGGAAGGAAGG + Intergenic
1117098790 14:52324240-52324262 CAGGAGGCAGAGAGGCAGGAGGG + Intronic
1117294979 14:54370913-54370935 GAGGAGGACGGGGGGGAGGAGGG - Intergenic
1117562709 14:56958610-56958632 CAGGAGGACCAGCCTTAGGAAGG + Intergenic
1117699086 14:58395865-58395887 CAGGAGGCCCCGAGGCCGGATGG + Intergenic
1117736573 14:58774309-58774331 AAGGAGGAAATGAGGGAGGAAGG - Intergenic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118166194 14:63339040-63339062 CAAGAGGAAGAGAGAGAGGAGGG + Intergenic
1118171781 14:63395727-63395749 GAGGAGGAGCAGAGGGAAAAGGG + Intronic
1118186422 14:63542718-63542740 CAGGAGGACCGGGAGGAAGAAGG + Intronic
1118462540 14:66000059-66000081 CAGGAGGACCAGAGAGACCTTGG - Intronic
1118660633 14:68005920-68005942 CAGGTGGAAGAGAGAGAGGAGGG + Intronic
1118660637 14:68005962-68005984 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1118766759 14:68915240-68915262 AAGAAGGAGCAGGGGGAGGAGGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118896194 14:69947645-69947667 CAAGAGGAGAAGAGAGAGGAGGG - Intronic
1119004410 14:70910145-70910167 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119609233 14:76047704-76047726 GGGAAGGAACAGAGGGAGGAAGG - Intronic
1119658212 14:76432456-76432478 CAGGAGGACTAGGAGAAGGAGGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1120758415 14:88265333-88265355 CAGGAGGGCCAGAGAGAGAAGGG + Intronic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121124757 14:91399030-91399052 TGGGAGGACCAGAGGGAGAGTGG - Intronic
1121288250 14:92753388-92753410 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1121314643 14:92953631-92953653 GAGAAGGCCCAGGGGGAGGAAGG + Intronic
1121332133 14:93056251-93056273 CAGAAAGATCACAGGGAGGACGG + Intronic
1121508342 14:94493411-94493433 CAGGAGGGCCATAGAAAGGAAGG - Intronic
1121551624 14:94807157-94807179 AAGGAGGCTAAGAGGGAGGAAGG - Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121882585 14:97514316-97514338 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1121882598 14:97514375-97514397 CAGGCAGGCAAGAGGGAGGAAGG - Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122257001 14:100485703-100485725 CATGTGTTCCAGAGGGAGGAGGG + Intronic
1122288269 14:100665679-100665701 CAAGAGGAAGAGAGGGAGGGCGG + Intergenic
1122853977 14:104551432-104551454 GAGGAGGCCCAGAGAGAGGCAGG - Intronic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1123392896 15:19895234-19895256 AAGGAGGAGGAGGGGGAGGAAGG - Intergenic
1123714602 15:23017703-23017725 CAGGATGACAAGAGCGAGTAGGG + Intronic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124110200 15:26778147-26778169 CAGGAGGAAGAGAGAGAGGAGGG + Intronic
1124420511 15:29517076-29517098 CAGGAGGAGGAGAGGCAGGTTGG + Intronic
1125056538 15:35364864-35364886 CAGAAAGACTAGAGGGAGAATGG - Intronic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125599150 15:40906260-40906282 CTGGAGGGCCAGAGGGGGGTGGG + Intergenic
1125720269 15:41841991-41842013 GAGGAGGTGCAGAGGGAGGGAGG - Intronic
1125826091 15:42677843-42677865 CAGGAGGACAAGAAAGAGAAAGG - Intronic
1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG + Intronic
1126105528 15:45144625-45144647 CAGGAAGGCCAGAGGATGGAGGG - Intronic
1126321471 15:47428926-47428948 GAGGAGGAAGAGAGGGAGGGAGG + Intronic
1126362800 15:47863577-47863599 GGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1126370194 15:47937933-47937955 AAGGAGGGAAAGAGGGAGGAAGG + Intergenic
1126490776 15:49233244-49233266 CAGGAGGAAGAGAGAGAGGTGGG + Intronic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1127025532 15:54801154-54801176 CAGGAGCAAAAGAGAGAGGAGGG + Intergenic
1127116985 15:55738764-55738786 CAGGAAGAAGAGAGGGAGGGAGG + Intronic
1127117016 15:55738874-55738896 CAGGAGGAAAAGACAGAGGAAGG + Intronic
1127137553 15:55940476-55940498 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1127196485 15:56591468-56591490 CAGGAGGAAGAGAGTGAGGTGGG + Intergenic
1127267111 15:57371336-57371358 CAGCAGGCCCAGAGTGTGGATGG + Intergenic
1127937316 15:63654331-63654353 CAGAAGGATCATAGGAAGGATGG + Intronic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1128478368 15:68016550-68016572 CAGGAGGAAGAGAGAGAGGCAGG - Intergenic
1128686681 15:69691525-69691547 CATGTGAACCAGAGAGAGGATGG + Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129244610 15:74271807-74271829 CAGGTGGACCTGGGTGAGGAGGG + Intronic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129461365 15:75701614-75701636 AAGGAGGGCCAGAGGGAGTGTGG - Intronic
1129723469 15:77890193-77890215 AAGGAGGGCCAGAGGGAGTGTGG + Intergenic
1129882979 15:79019179-79019201 CAGGAGGCCCAGTCTGAGGAGGG + Intronic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1129969404 15:79764201-79764223 GGGAAGGACCAGAAGGAGGAAGG + Intergenic
1130123195 15:81069964-81069986 CAGGAGGACAAGAATGAGGGCGG + Intronic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1130721021 15:86386087-86386109 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
1130788161 15:87123252-87123274 GGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131099127 15:89674220-89674242 CAAGTCGACCAGAGGAAGGATGG - Intronic
1131215410 15:90531028-90531050 TTGGAGGACCATCGGGAGGATGG + Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131460040 15:92611279-92611301 AGGGAGGAAGAGAGGGAGGAAGG + Intergenic
1131701627 15:94942985-94943007 GAGGAGGAGGAAAGGGAGGAGGG + Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132169926 15:99640500-99640522 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132389422 15:101427620-101427642 CAGCAGGACCAGAGGAGAGAGGG + Intronic
1132724866 16:1334187-1334209 TACGAGGACCTGCGGGAGGAGGG - Intronic
1132729737 16:1355546-1355568 CAGGAGGAGCAGAGGTTGGTAGG + Intronic
1132804331 16:1768711-1768733 GAGGACGACGAGACGGAGGAGGG + Exonic
1132885841 16:2181624-2181646 CAGGTGGACCAGGAGGCGGAGGG + Intronic
1133002386 16:2857941-2857963 CAGGAGGGAGAGAGGGAGGGAGG + Intronic
1133742293 16:8660818-8660840 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
1133743204 16:8667138-8667160 GATGAGGACGAGAGGGAGAAAGG + Intergenic
1133754905 16:8755232-8755254 CGAGAAGACCAGAGGGAGGGAGG - Intronic
1133773838 16:8883229-8883251 GAGGAGGACCATAGGGAGGAGGG - Intergenic
1134288001 16:12879208-12879230 AAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1134444632 16:14321549-14321571 CAGAAGGCCCTGAGGGAGGCAGG + Intergenic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1134691905 16:16196591-16196613 CAGGAGGCACAGAGAGAGTAGGG + Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135138885 16:19905044-19905066 CAAGAGTACAAGAGGGAGGAAGG + Intergenic
1135618484 16:23932696-23932718 CATGTGGACCAGAGGGATGGGGG + Intronic
1135815341 16:25627463-25627485 CAGGAGCAAGAGAGGGAGGGAGG + Intergenic
1136005562 16:27326725-27326747 CAGCAGGCCCACAGGGAGGCTGG + Intronic
1136096310 16:27959569-27959591 CAGAAGGGCAAAAGGGAGGACGG + Intronic
1136617693 16:31408642-31408664 CAGGAGCACAGCAGGGAGGAGGG + Intronic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1137406888 16:48196279-48196301 CAGGAGGAGGAGATGGAAGAAGG - Exonic
1137465718 16:48707123-48707145 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1137495049 16:48963052-48963074 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1137526318 16:49239517-49239539 TAGTAGGAACAGAGGGAGGTGGG - Intergenic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1137632552 16:49957138-49957160 GGGGAGGACCAGTGGAAGGAAGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137801040 16:51262205-51262227 CAGGAAGAAGACAGGGAGGAAGG - Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138195823 16:55051458-55051480 CAGAAGGAAGACAGGGAGGAGGG + Intergenic
1138292031 16:55856010-55856032 CAGGAGGAAGAGAGAGAGGGAGG - Intronic
1138458822 16:57136005-57136027 AAGGAGGAAGGGAGGGAGGAGGG + Intronic
1138486729 16:57349938-57349960 GAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139303108 16:65961978-65962000 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1139307729 16:66001646-66001668 CAGGAGGAAAAGTGAGAGGAGGG + Intergenic
1139322155 16:66123608-66123630 GAGGAGGTTGAGAGGGAGGAAGG + Intergenic
1139328467 16:66169600-66169622 GAGGAGGAGGAGAGGGAGGAAGG + Intergenic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1140018678 16:71215247-71215269 AAGGAGGAAGAAAGGGAGGAAGG + Intronic
1140112881 16:72018594-72018616 CAGGAGGGCCACAGGGAGGGAGG - Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140270157 16:73458337-73458359 AAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1140655197 16:77132485-77132507 GAGGAGGACGAGGAGGAGGAGGG - Intergenic
1140686473 16:77438306-77438328 TAAGAGGAGCAGAGGGAGGGAGG + Intergenic
1140765757 16:78155227-78155249 AAGGAGGAAGGGAGGGAGGAAGG + Intronic
1140771249 16:78205884-78205906 CAGGAGGAAGGAAGGGAGGATGG - Intronic
1140775838 16:78248275-78248297 CAGGAGCAAGAGAGGGAGCAAGG + Intronic
1140792982 16:78410105-78410127 CAAGAGCAACAGAGGAAGGAAGG - Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1140914615 16:79482953-79482975 AAGGAGGGACAGAGGGAGGGAGG - Intergenic
1140914668 16:79483088-79483110 AAGTAGGGACAGAGGGAGGAAGG - Intergenic
1141080544 16:81047898-81047920 CAGGACGGCCAGAGAGAGAAGGG + Intergenic
1141288916 16:82699321-82699343 CAGGAGGACCACCGGTAGTAGGG + Intronic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141756238 16:85992961-85992983 CAGAAGGACAGAAGGGAGGAAGG - Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141812337 16:86383785-86383807 AAGGAGGGACAGAGGGAGAAAGG + Intergenic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1141927092 16:87177096-87177118 GAGCAGGACCAGAGTGAGCAGGG - Intronic
1141980720 16:87548261-87548283 CGTGTGGATCAGAGGGAGGAAGG + Intergenic
1141993379 16:87622666-87622688 CAGGAGGAGCTGAGGGTGCATGG + Intronic
1142109754 16:88325018-88325040 CAGGAGGAAAAGAGAGAGGGAGG + Intergenic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142251420 16:88993706-88993728 GAGGAGGAAGGGAGGGAGGAGGG - Intergenic
1142256296 16:89015331-89015353 CAGAAGGACCAGGAGGGGGACGG + Intergenic
1142256312 16:89015383-89015405 CAGGAGGACGAGGAGGGGGATGG + Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142795430 17:2303570-2303592 GAGGAGGAGGAGAGGGAGGCGGG + Intronic
1142846556 17:2681819-2681841 CCAGAGGAAAAGAGGGAGGAGGG - Exonic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143097294 17:4485105-4485127 CAGCTGGACCAGAGAGTGGAAGG + Intronic
1143119131 17:4596470-4596492 CAGAAGGAGGAGTGGGAGGAAGG + Intronic
1143141982 17:4745906-4745928 CAGGAGGAGCAGAGGGAGTTGGG - Exonic
1143416863 17:6756718-6756740 CAGGAAGAGCAGGGGGAGAAGGG + Intronic
1143490808 17:7284290-7284312 CAGCAGGACCAGCTGCAGGAGGG - Exonic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1143862662 17:9902130-9902152 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1143921153 17:10331998-10332020 CAGGTGGACCAAAAGGAGAAGGG + Intronic
1144044293 17:11440936-11440958 CAAGAGGAAAGGAGGGAGGAAGG + Intronic
1144046109 17:11456177-11456199 ACGGAGGACCGGAGGGAGGGAGG + Intronic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1144247770 17:13384392-13384414 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1145035886 17:19540287-19540309 CAGGTGGCCCACAGGGAGGCAGG + Intronic
1145242699 17:21249014-21249036 CAGGAGGGGCAGAGAGAGCATGG - Intronic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146289741 17:31598710-31598732 AAGGAGCTCCAGAGGGTGGAGGG + Intergenic
1146488437 17:33262424-33262446 GAGGAGGAAGGGAGGGAGGAAGG + Intronic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148105932 17:45118871-45118893 CTGGAGGACCAGGGCGAGGAGGG - Exonic
1148205149 17:45775320-45775342 CGTGAGGACAGGAGGGAGGATGG - Intergenic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148493738 17:48039516-48039538 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
1148851369 17:50557049-50557071 GAGGTGGAAGAGAGGGAGGATGG + Intergenic
1148867414 17:50635654-50635676 AGGGAGGCCCAGAGAGAGGAAGG + Intronic
1148897618 17:50848886-50848908 CAGGAGGAAGAGAGAGAGGGGGG + Intergenic
1148996450 17:51714469-51714491 AAAGAGCTCCAGAGGGAGGAAGG - Intronic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1149587428 17:57801572-57801594 CAGGAGGAAAAGAGAGAGTAAGG - Intergenic
1149862730 17:60132640-60132662 CAGGAGCACCAGAGTTAAGAAGG - Intergenic
1150106280 17:62464796-62464818 CAAGAGGACCTGTGGGTGGAGGG + Intronic
1150239598 17:63621684-63621706 CCGGAGGACCAGTCGGGGGATGG + Intergenic
1150402455 17:64869970-64869992 CAAGAGGACAAGTGGGAGTATGG - Intronic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1150598389 17:66627439-66627461 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150652533 17:67019343-67019365 GAGGAGGAGGTGAGGGAGGAAGG - Intronic
1150984815 17:70184433-70184455 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1151194926 17:72424636-72424658 CAGGGCGGCCAGTGGGAGGAGGG - Intergenic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151284346 17:73099174-73099196 CTGCAGGACAAGAGGGTGGATGG + Intergenic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1151383903 17:73743714-73743736 GAGGAGGAGGAGGGGGAGGAAGG - Intergenic
1151385610 17:73753530-73753552 CAGGAGGCAGAGGGGGAGGAAGG + Intergenic
1151401366 17:73857996-73858018 GAGGGGGCCCTGAGGGAGGAGGG - Intergenic
1151432729 17:74075158-74075180 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1151447430 17:74176428-74176450 AAGGAGGATGAGAGGCAGGAAGG + Intergenic
1151677977 17:75609628-75609650 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1151707050 17:75774649-75774671 CAGGAGCACCATAGGGGTGAGGG + Intergenic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152337063 17:79704792-79704814 CAAGAGGGCGAGAGGGAGGAGGG + Intergenic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152400767 17:80065052-80065074 GAGGAGGGGGAGAGGGAGGAGGG - Intronic
1152450585 17:80376793-80376815 CAGGAGGCCTAGAGGAAGAAAGG - Intronic
1152508778 17:80771413-80771435 CAGGAGGGCCAGCGGGCGGCGGG - Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152700100 17:81814409-81814431 CAGGAGGCTCAGAGGAAGGGCGG - Intergenic
1152813013 17:82391096-82391118 GAGGAGGTGCTGAGGGAGGAGGG + Intronic
1152886604 17:82855047-82855069 GAGGAAGGCCACAGGGAGGAAGG - Intronic
1153387829 18:4518903-4518925 GAGGAAGACCAAAGGCAGGATGG + Intergenic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153574120 18:6503974-6503996 GAGGAGGAAGGGAGGGAGGAGGG + Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1155334230 18:24748687-24748709 AAGGAGGAAGGGAGGGAGGAGGG - Intergenic
1155334239 18:24748710-24748732 AAGGAGGAAGGGAGGGAGGAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155727009 18:29099281-29099303 CAGGAGGAAGAGAGAAAGGATGG - Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156131752 18:33984590-33984612 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
1156160295 18:34350944-34350966 CAGGAGGGGCAGAGGCAGCAGGG - Intergenic
1156250865 18:35351542-35351564 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1156632884 18:38991527-38991549 AAGGAGGAAGAGAGGGAGGAGGG + Intergenic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157386243 18:47261562-47261584 AAGTAGGACCAGGGGCAGGAGGG + Intergenic
1157488680 18:48107420-48107442 GAGGAAGAGGAGAGGGAGGAGGG + Intronic
1157809001 18:50679850-50679872 CAGGAGGGACACAGGAAGGAGGG - Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158475456 18:57775436-57775458 AAGAAGGAAGAGAGGGAGGAAGG + Intronic
1158873197 18:61708851-61708873 CAGGTGAACTAGAGGGATGAAGG - Intergenic
1159088978 18:63825017-63825039 CAGAAGGAAGAGAGGGTGGAGGG + Intergenic
1159118263 18:64139945-64139967 AAAGAGGGCAAGAGGGAGGATGG - Intergenic
1159328065 18:66949573-66949595 CAGCAGGACCAGACGGAGTTTGG - Intergenic
1159841895 18:73407722-73407744 AAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1159898604 18:74021053-74021075 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1160004791 18:75061787-75061809 GAGCAGGACGAGAGTGAGGAGGG - Intronic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160356147 18:78229695-78229717 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1160373016 18:78390331-78390353 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1160431428 18:78815660-78815682 CAGGAGGACAAGAACAAGGAAGG + Intergenic
1160663866 19:313778-313800 CAGGAGGAGCACAGGGATGGCGG - Intronic
1160753666 19:747173-747195 TAGGAGGCCCAGAGGGTGGCAGG - Exonic
1160893817 19:1393526-1393548 CAGAGGGATCAGAGGGAGCAGGG + Intronic
1160973930 19:1783251-1783273 CAGGAGGAGAAGGTGGAGGAGGG - Exonic
1161078890 19:2300679-2300701 CGGGAGGCCCAGAGCGAGGGAGG - Intronic
1161137885 19:2631099-2631121 CATGAAGACCAGAGGAAGAATGG + Intronic
1161207064 19:3046902-3046924 GGGGAGGAGGAGAGGGAGGAGGG - Intronic
1161210611 19:3063299-3063321 CAGGAAGGCCGGAGGGAGGCAGG + Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161355148 19:3814883-3814905 CAGGAGGCCCAGAGCAAGGAGGG - Intronic
1161397332 19:4051793-4051815 TGGGAGGCCCAGAGAGAGGAAGG + Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161552754 19:4923267-4923289 CAGGAGGAGCAGACGGAGCCAGG - Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1161845254 19:6708500-6708522 AAGGAGGAATGGAGGGAGGAAGG - Intronic
1161868079 19:6849243-6849265 GGGGAGCACTAGAGGGAGGAGGG - Intronic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162013803 19:7832796-7832818 CAGGAGGACCACGGGGAACAGGG + Intronic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162338508 19:10076718-10076740 GAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1162805495 19:13136048-13136070 GAGGAGGACGAGGAGGAGGATGG + Exonic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163611526 19:18304383-18304405 GAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1163612704 19:18309473-18309495 CAGGAGGCGCAGTGAGAGGAGGG + Intronic
1163776981 19:19224627-19224649 AAAGAGGATCAGAGAGAGGAAGG - Intronic
1163779612 19:19239576-19239598 TGGGAGGAGGAGAGGGAGGAGGG - Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164540604 19:29119019-29119041 GAGGAGGCCCAGAGAAAGGATGG - Intergenic
1164540769 19:29120044-29120066 CAGCAGGACCAGAGGCATGGAGG + Intergenic
1164680384 19:30130699-30130721 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680487 19:30131008-30131030 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680513 19:30131081-30131103 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680539 19:30131154-30131176 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1164926847 19:32137379-32137401 CTAGAGGACTGGAGGGAGGAAGG + Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165127651 19:33611758-33611780 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1165194990 19:34095135-34095157 CAGGAGGTCCAGACGGTGGGGGG - Intergenic
1165308656 19:35017696-35017718 AAGGAGGAACTGAGGAAGGAAGG - Intronic
1165406508 19:35634106-35634128 CAGGAGGACCTGGGGGAGGGAGG + Intronic
1165638607 19:37364791-37364813 AAGGAGGACCAGAGAGACCATGG + Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1165938401 19:39403202-39403224 CCTGAGGATCTGAGGGAGGAGGG + Intergenic
1165948126 19:39457695-39457717 GACGAGGACCAGTGGGAGGATGG + Exonic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166329599 19:42070262-42070284 CAGGAGGAAGGGAGGGAGGCAGG + Intronic
1166349031 19:42185609-42185631 CAGGGGGACAAGAGTGAGAAGGG - Intronic
1166353318 19:42211450-42211472 AAGGAGGAAGAGAGGGAGGGAGG + Intronic
1166387514 19:42390435-42390457 CAGGAGGAGAAGTGGGGGGATGG - Intergenic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167323910 19:48812588-48812610 CATCTGGATCAGAGGGAGGAGGG - Intergenic
1167360183 19:49025916-49025938 CAGGAAGACCAGAGGGGGCCCGG + Intronic
1167360902 19:49029865-49029887 CAGGAAGACCAGAGGGGGCCCGG - Intronic
1167362750 19:49038932-49038954 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167363385 19:49042256-49042278 CAGGAAGACCAGAGGGGGCCCGG - Intergenic
1167365108 19:49050671-49050693 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167616225 19:50535760-50535782 CAGGAGGATGAATGGGAGGAGGG - Intronic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1168107414 19:54173206-54173228 CAGGTGGCCCGGAGGGAGTAAGG + Exonic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
1168258793 19:55181398-55181420 CTTGAGGACCAAAGGCAGGAAGG - Exonic
1168264423 19:55214355-55214377 CAGGAGCAAGAGAGAGAGGACGG + Intergenic
1168417372 19:56177119-56177141 GAGGAGGACCAGGGGGACGGAGG - Exonic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168695604 19:58402301-58402323 CAGAAGGAGCAGAGGGTGGTGGG + Intronic
1168724333 19:58572552-58572574 CAGAAGGAACAGCGCGAGGAGGG - Intronic
1168725059 19:58576436-58576458 AAGGAGGAAGGGAGGGAGGAAGG - Intergenic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925034242 2:673741-673763 GAGGAGGAGGAGGGGGAGGATGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925210986 2:2045876-2045898 ATGGAGGACCACAGGGAGGGAGG - Intronic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925482468 2:4291593-4291615 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926049790 2:9737516-9737538 GAGGAGTACTAGAGGGAGTAGGG - Intergenic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926242578 2:11099944-11099966 CAGGAAGACAAATGGGAGGACGG - Intergenic
926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG + Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926378943 2:12264723-12264745 CAGGAGCAAGAGAGCGAGGAAGG + Intergenic
926412532 2:12619617-12619639 GAGGAAGAAGAGAGGGAGGAGGG - Intergenic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
926663716 2:15496654-15496676 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
926763958 2:16306023-16306045 CAGAAGGACAAGAGGAAGAAGGG - Intergenic
927062067 2:19432621-19432643 CAGTAGCCCCAGAGCGAGGAGGG + Intergenic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927702493 2:25277041-25277063 CGGGAGCACCAGGGGGAGGGAGG + Intronic
927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG + Intronic
928051531 2:28001739-28001761 CAGGAGCAAGAGAGAGAGGAGGG + Intronic
928105834 2:28470076-28470098 GGGGAGGAGGAGAGGGAGGAGGG + Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928355979 2:30614920-30614942 CAGGAAGCCAAGAGGGAGGGAGG + Intronic
928602360 2:32915976-32915998 AAGGAGGAAGGGAGGGAGGAAGG - Intergenic
928804141 2:35130158-35130180 CAGGAGGACCTGTTGGGGGATGG + Intergenic
928921898 2:36535162-36535184 AAGGAGGACAGGAGGGAGGGAGG + Intronic
929373521 2:41256002-41256024 CAGGAGGAAGGGAGGGAGTAGGG + Intergenic
929763952 2:44828751-44828773 AAGGAGGAACGGAGGGAGGGAGG + Intergenic
930352655 2:50277420-50277442 AAGGAGGAAGGGAGGGAGGAAGG - Intronic
930417797 2:51110936-51110958 AAAGAAGACCAGAGAGAGGAAGG - Intergenic
930438675 2:51378976-51378998 AAGGAGGACCATAGAAAGGAGGG + Intergenic
930755371 2:54967555-54967577 CAAGAGGACCACAGGGAACAGGG + Intronic
930764756 2:55073921-55073943 CAGGTGGTCCTGAGGGAGGGTGG - Intronic
931064689 2:58572104-58572126 CAGGAGGGGCAAAGGGAAGATGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
932296108 2:70624610-70624632 CAGGTGGATCAGAGAGATGAAGG - Intronic
932375793 2:71234678-71234700 CAAGAGGGTAAGAGGGAGGATGG + Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932624111 2:73284404-73284426 GAGGAGGAGGAGGGGGAGGAGGG + Exonic
932668830 2:73719346-73719368 CAGGTGGACCTGATGGTGGATGG + Intergenic
932705208 2:74019460-74019482 CATGAGGACTTGAGGGAGAAAGG - Intronic
932803400 2:74762559-74762581 CAGGAGGACTAAAGGCAGCAAGG - Intergenic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933982660 2:87565784-87565806 CCAGAGGAAAAGAGGGAGGAAGG + Intergenic
934097913 2:88624682-88624704 CAGGACATCCAGAGGGAGGTAGG - Intronic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
934969765 2:98753799-98753821 CAGGTGGACTACAGGGAGAAAGG - Intergenic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935203788 2:100880844-100880866 CAGGAGCACAGCAGGGAGGAGGG + Intronic
935427772 2:102938521-102938543 CAGGAGGAAAGGAGAGAGGAGGG + Intergenic
935491366 2:103724500-103724522 CAGGAGGAAGAGAGAGAGGGGGG - Intergenic
935765071 2:106359008-106359030 GAGAAGGGCCAGAGGCAGGAGGG - Intergenic
935798595 2:106670136-106670158 CAGGAGGAAGAGAGGGAAAAGGG - Intergenic
936233567 2:110724931-110724953 AAGGAAGAACGGAGGGAGGAAGG + Intergenic
936233643 2:110725220-110725242 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
936311180 2:111385009-111385031 CCAGAGGAAAAGAGGGAGGAAGG - Intergenic
936370421 2:111898442-111898464 CGGGAGGACGAGGGGGAGGAGGG - Intergenic
936778342 2:116001293-116001315 AAGGAGGAAAAGAGGGAGGGAGG + Intergenic
936856022 2:116958163-116958185 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
936917869 2:117658685-117658707 CAGGTAGCCCAGATGGAGGAAGG + Intergenic
937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG + Intronic
937241524 2:120465354-120465376 CATGAGGACAGGATGGAGGAGGG - Intergenic
937509805 2:122582951-122582973 AAGGAGGACCAGGGAGGGGAGGG + Intergenic
937579063 2:123461451-123461473 GAGGAGGAGGAGAGGAAGGAAGG - Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
938708053 2:133951028-133951050 CAAGAAGACTAGAGGTAGGAAGG + Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
939428626 2:142073822-142073844 CAGGAGGAAGAGAGAGAGGAAGG - Intronic
939656106 2:144827475-144827497 TAGGAGGAGCAGTGGGATGAGGG + Intergenic
940148872 2:150577621-150577643 CAGCAGGAAGAGAGAGAGGAGGG + Intergenic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
940638761 2:156327639-156327661 CATGAGGACAGGATGGAGGAAGG - Intronic
940714079 2:157198564-157198586 AAGGAAGAACAGAGGAAGGAAGG + Intergenic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941319633 2:164038985-164039007 CAGGAGCAAGAGAGGGAGGGTGG + Intergenic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
941489699 2:166127613-166127635 GAAGAGGAGGAGAGGGAGGAGGG + Intronic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941770356 2:169338145-169338167 AAGGAGGAAGAGAGGGAGTAGGG + Intronic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
942211773 2:173678299-173678321 AAGGAGGAGGAGAGGGAGGGAGG + Intergenic
942447121 2:176085512-176085534 CAGGCGGAGGCGAGGGAGGACGG + Intergenic
942509543 2:176682809-176682831 GAGGAGGAAGAGAGGGAGGGAGG + Intergenic
942800734 2:179872595-179872617 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
942980137 2:182070878-182070900 TAGGAGGAAGAGAGGGAGGAGGG + Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943309459 2:186308602-186308624 CAGCAGGCCCACAGGGTGGAAGG + Intergenic
943677539 2:190730934-190730956 CAGGAGGAAGAGAGAGAGGGGGG - Intergenic
943731381 2:191306689-191306711 AAGGGGGATCAGAGGGAGAAAGG + Intronic
944322069 2:198357833-198357855 TAGAAAGACCAGAGGCAGGAAGG - Intronic
944430375 2:199626630-199626652 GAGGAGGAAGAGAGGAAGGAAGG + Intergenic
944476319 2:200110417-200110439 GAGTAGTACCAGAGGGAGGTAGG - Intergenic
944534370 2:200695100-200695122 CAGGAGCAAGGGAGGGAGGAGGG - Intergenic
945110175 2:206355487-206355509 TAGGAAGAAGAGAGGGAGGAAGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945983975 2:216339897-216339919 CAGGAGGCCCAGAGAGATGGTGG - Intronic
946012899 2:216580693-216580715 CAGGAGGAAGGAAGGGAGGAAGG - Intergenic
946154159 2:217796284-217796306 CAGGAGGGGCAGAGGGATGGCGG - Intergenic
946424509 2:219586018-219586040 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946588574 2:221218081-221218103 CATGATGACCACAGGGACGAAGG + Intergenic
946922650 2:224595757-224595779 CACGAAGTCCAGAGGCAGGATGG + Intergenic
947029932 2:225782570-225782592 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947029967 2:225782685-225782707 AAGGAGGAAGGGAGGGAGGAAGG - Intergenic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947077710 2:226363900-226363922 AGGGAGGAACGGAGGGAGGAAGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947522822 2:230861735-230861757 CAGGAGGAGCAGTGGGCAGAAGG + Intergenic
947567544 2:231204225-231204247 CAGGAGGCTCAGAGAGAGTATGG - Intronic
947747924 2:232518896-232518918 CCTGAAGACCAGAGGCAGGAGGG + Intergenic
948262243 2:236613018-236613040 CACATGGAGCAGAGGGAGGAGGG - Intergenic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948599160 2:239098386-239098408 CAGGAGCAGCAGCGAGAGGATGG - Intronic
948873468 2:240815450-240815472 CGGGAGGCCCAGAGGGAAGGGGG + Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
948995467 2:241576129-241576151 CGGGAGGAGGAGAGGGAGGAAGG - Intergenic
949006674 2:241653383-241653405 CAGGTGGAGCTGATGGAGGAGGG + Intronic
1168955083 20:1828973-1828995 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169779454 20:9293478-9293500 AAAGAGGACGAGAGGAAGGAAGG + Intronic
1169810690 20:9606227-9606249 CAGGAGGAAGAGAGGGCGGCAGG - Intronic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170018201 20:11806745-11806767 CAGGAGGAAAAGAGTGAGAAGGG - Intergenic
1170585946 20:17734123-17734145 CACAAGGACCACATGGAGGAAGG - Intronic
1170647828 20:18212573-18212595 CAGGTGGAACAGAGAGAGAAAGG + Intergenic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1172173847 20:32960701-32960723 TAAGGGGACCACAGGGAGGAGGG - Intronic
1172203072 20:33140427-33140449 CAGGTGGACCAGAGGGGCCAGGG - Intergenic
1172869250 20:38125667-38125689 AAGGAGGGGCAGAGGGTGGAAGG - Intronic
1173002014 20:39111560-39111582 GAAGAGGAGGAGAGGGAGGAGGG + Intergenic
1173073242 20:39790499-39790521 CAGGAAGAACAGAGGAAGAAGGG + Intergenic
1173264971 20:41470883-41470905 CAGGAGGATCAGTGGAAGCATGG - Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173477015 20:43367021-43367043 GGGGACTACCAGAGGGAGGAAGG + Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173648156 20:44646444-44646466 CAGGAAGACAAAAAGGAGGAGGG + Intronic
1173750517 20:45471623-45471645 GAGGAGGACCAGAAGGAGAGAGG + Intronic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1173909202 20:46651528-46651550 CAGGAGGAGCAGGGAGAGGGCGG - Intronic
1173921709 20:46751052-46751074 CAGGAGGAAGAGAGAGAGGTGGG + Intergenic
1174114844 20:48219818-48219840 CAGGAGGCCAAGATGGATGAGGG + Intergenic
1174177995 20:48657060-48657082 CAGGAGGCGCAGAGGGCGGCGGG + Exonic
1174221545 20:48959530-48959552 AAGGAGGGACAGAGGGAGGGAGG - Intronic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1174508992 20:51036901-51036923 CAGCAAGATCAGAGAGAGGAAGG - Intergenic
1174631338 20:51960658-51960680 AAGGTGGAATAGAGGGAGGAGGG + Intergenic
1174639341 20:52029783-52029805 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1174763503 20:53229768-53229790 AAGGAGGGAGAGAGGGAGGAGGG + Intronic
1175211084 20:57355771-57355793 TAGGAGAACAGGAGGGAGGATGG + Intronic
1175367645 20:58466954-58466976 CACGCGGACCAGAGTGGGGAGGG + Intronic
1175547401 20:59787354-59787376 GAGGAGGAGCAGAGGTGGGAGGG + Intronic
1175818576 20:61896362-61896384 CAGGAGGCCCAGATGCGGGACGG - Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176047226 20:63099247-63099269 CAGGTGGGTCTGAGGGAGGAAGG - Intergenic
1176079970 20:63267604-63267626 CAGGACCTCCAGAGGGAGCACGG - Intronic
1176385165 21:6135431-6135453 CCGGAGGACCAGAGGTGGGTGGG + Intergenic
1176673921 21:9759203-9759225 CAGGAGCACCGGAGGGAGCCTGG - Intergenic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1176963611 21:15187636-15187658 CAGGAGGAAGAGAGGGAGTGGGG + Intergenic
1178005140 21:28210365-28210387 GAGGAGAACCAGATGGATGATGG - Intergenic
1178061546 21:28858561-28858583 AAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1178062842 21:28871351-28871373 CAGGAGGAAGAGAGCGAAGAGGG + Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178730230 21:35095231-35095253 CAGGAGCAAAAGAGAGAGGAGGG + Intronic
1178777063 21:35561948-35561970 GAGGAGGAGGAGAGAGAGGAAGG + Intronic
1178777553 21:35566551-35566573 GAGGAAGAATAGAGGGAGGAAGG - Intronic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179374779 21:40840843-40840865 GAGGTGGACGGGAGGGAGGAAGG + Intronic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1179738308 21:43402821-43402843 CCGGAGGACCAGAGGTGGGTGGG - Intergenic
1179977337 21:44875856-44875878 GAGAAGGAGCTGAGGGAGGAGGG - Intergenic
1180204942 21:46253992-46254014 CAGGAGGAAGAGAGAGAGAAGGG - Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1180954318 22:19734821-19734843 CAGGAGGACCATCTGGAGCACGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181441221 22:22936030-22936052 CAGCAGGACCCCAGGGAGGGGGG + Intergenic
1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG + Intronic
1181506619 22:23362736-23362758 CAGGAGGAAGAGAGAGAGGGAGG - Intergenic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181521845 22:23452747-23452769 CAGGAAGGCCAGTGGGAGCAGGG + Intergenic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1181793924 22:25290038-25290060 CAGTAGGAACAGAGGTGGGAGGG + Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1181833920 22:25586581-25586603 CAGTAGGAACAGAGGTGGGAGGG + Intronic
1181885306 22:26017367-26017389 AAGGAGGAGGGGAGGGAGGAAGG - Intronic
1182056239 22:27357434-27357456 CAGGAGGAAGAGAGGGAGAGAGG - Intergenic
1182103282 22:27672053-27672075 CAGGAGGAAGGGAGAGAGGAAGG + Intergenic
1182454090 22:30438778-30438800 GAGCAGGAACTGAGGGAGGAGGG - Intergenic
1182542976 22:31055259-31055281 AAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1183058607 22:35321845-35321867 CAGGTGGGGCACAGGGAGGATGG + Intronic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183085366 22:35483645-35483667 GGGGAGGGACAGAGGGAGGAAGG + Intergenic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183354538 22:37351143-37351165 AAGGAGGAGAGGAGGGAGGAGGG - Intergenic
1183419772 22:37704727-37704749 CAGGAAGAGGAGAGGAAGGAAGG + Intronic
1183572181 22:38661884-38661906 CAGGAGGAGCAGTGAGAGGTCGG + Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183667434 22:39253847-39253869 CAGGAGGACCTGGGGAAGGAAGG - Intergenic
1183807597 22:40224727-40224749 CGGGAGGAAGAGAGGAAGGAAGG - Intronic
1183827042 22:40396738-40396760 CAGGAGGACCAGAGTGAATGGGG + Intronic
1184101038 22:42341903-42341925 TGGGAGGACCACAGGGAGGAGGG + Intronic
1184121186 22:42451644-42451666 GAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
1184340376 22:43882518-43882540 CAGGAGGTCCAGAGCAAGGGAGG - Intronic
1184380209 22:44140646-44140668 GATGAGGAGCAGAGAGAGGAAGG - Intronic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184412322 22:44332320-44332342 AAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1184637713 22:45848246-45848268 CAGGAGGAAGAGAGTGAGGGTGG + Intergenic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1185019353 22:48365288-48365310 AGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185134285 22:49060308-49060330 CAGGAGGGCTGGAGGGTGGAAGG - Intergenic
1185135796 22:49071415-49071437 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1185151611 22:49167130-49167152 AAGAAGGAAGAGAGGGAGGAAGG - Intergenic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
949698711 3:6730337-6730359 CAGGAGGAAGAGAGAGGGGAGGG + Intergenic
949737845 3:7194938-7194960 GAAGAGGACCTGAGGGAAGAGGG + Intronic
949889408 3:8722393-8722415 CAGGAGGAAGAGAGAGAAGAAGG - Intronic
949928759 3:9061723-9061745 CTGGAGGACAGGAGGGAGGGAGG + Intronic
949942011 3:9162535-9162557 CAAGTGGACCAGAAGGAGCAGGG - Intronic
949956102 3:9269878-9269900 AGGGAGGGACAGAGGGAGGAAGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950436656 3:12984252-12984274 CAGGAGGACCACGGGGAGATAGG + Intronic
950440890 3:13009585-13009607 CAGGAGGAGGTGAGGGATGAGGG - Intronic
950618071 3:14178395-14178417 GAGGAGGCCCAGAGGCAGGGCGG - Exonic
950698087 3:14719972-14719994 AAGGAGGACAAGAGAGAGGAGGG + Intronic
950891425 3:16408152-16408174 CATGAGGGCCTGAGGCAGGAGGG - Intronic
951857819 3:27217430-27217452 CAGGAGGAAGAGAGAGAGTAGGG + Intronic
951891603 3:27572872-27572894 TAGGAGGTAGAGAGGGAGGAAGG - Intergenic
951932325 3:27982180-27982202 CAGGAGCATCAGTGTGAGGAAGG - Intergenic
952030449 3:29135840-29135862 GAGGACTACTAGAGGGAGGAGGG + Intergenic
952055489 3:29439952-29439974 CAGGAAGACCAGACGGAAGTCGG + Intronic
952388167 3:32858075-32858097 GAGGAGGAAGAGAGAGAGGAGGG + Intronic
952512222 3:34069157-34069179 GAGGAGGGCCAAAGAGAGGATGG + Intergenic
952623583 3:35376292-35376314 AAGGAGGGCCGGAGGGAGGGAGG + Intergenic
953104017 3:39857240-39857262 CAGGAGGGAGGGAGGGAGGAAGG + Intronic
953140013 3:40220796-40220818 CAGGAGGAAGAGAGTGAGGGAGG + Intronic
953167031 3:40474638-40474660 GAGGAGGAACAGGGGGATGAGGG + Intergenic
953349426 3:42203468-42203490 CAGGAGGGCAAGAGGGAGAGAGG - Intronic
953365425 3:42340467-42340489 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
953405842 3:42659391-42659413 GAGGAGGAGGAGGGGGAGGAGGG + Exonic
953410111 3:42686022-42686044 CAGGAGGCCGAGACGGAAGACGG - Exonic
953543353 3:43841896-43841918 CAGGAGGAGCAGAGGGAGTGGGG + Intergenic
953694425 3:45146456-45146478 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
953855565 3:46497168-46497190 CAAGAGGAGGAGAGGAAGGAAGG - Intergenic
953866399 3:46586887-46586909 CCTGAGGACCAGATAGAGGAAGG + Intronic
953887486 3:46723729-46723751 CAGGAGCACCAGAGAGTGGGGGG + Intronic
954133102 3:48569968-48569990 GAGGAGGATCAGGGGGAGGAGGG + Intronic
954135012 3:48578461-48578483 CAGGGGGACCAGAGGGGCCAGGG + Exonic
954387366 3:50251204-50251226 CAGAAGGGCAAGAGGGTGGAGGG - Intronic
954479729 3:50787807-50787829 GAGGAGGAAGAGAGAGAGGAAGG - Intronic
954756010 3:52840376-52840398 CAAGAGGAGCAGAGGTAGAAAGG + Exonic
954873846 3:53787725-53787747 CATGAGGACCAGCAGGAAGAGGG + Intronic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
955098728 3:55826020-55826042 AAGGAGGAAGAGAGGAAGGAAGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955518624 3:59752731-59752753 CAGGAGGAAGAGAGAGTGGAGGG - Intronic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
956290418 3:67654645-67654667 GAGGAGGAGCAGCGGGAGGAGGG + Intergenic
956626620 3:71273120-71273142 CACAAGGACCAGAAGGAAGAAGG - Intronic
956659622 3:71584260-71584282 CCCGCGGACCAGAGAGAGGAAGG + Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956776866 3:72572401-72572423 CAGGGAGACCAGAGCCAGGAGGG - Intergenic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
958157759 3:89776134-89776156 GAGGAGGAGGAGAGGAAGGAAGG - Intergenic
958842202 3:99220228-99220250 CAGGAAGGCAAGAGGCAGGAAGG + Intergenic
960298932 3:115977984-115978006 GAGGAGGAAGAGAGGAAGGAAGG - Intronic
960465845 3:117996495-117996517 GAGGAGGAGAAGAGGGAGGGAGG - Intergenic
960558185 3:119052472-119052494 AAGGAGGAAGAGAGGGAGGGAGG + Intronic
960724878 3:120660063-120660085 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
960959734 3:123061819-123061841 CAGGAGGAAGAGAGAGAGGGGGG + Intergenic
961182486 3:124887387-124887409 CTGGCGGGCCGGAGGGAGGAAGG - Intronic
961306500 3:125961420-125961442 CAGGAGGGCCTGAGGGAGTGGGG - Intergenic
961413136 3:126737713-126737735 CAGGTGGAGAGGAGGGAGGAAGG + Intronic
961443768 3:126968471-126968493 GAGGAGGAGAAGGGGGAGGAGGG + Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961790420 3:129371961-129371983 GAGGACTACTAGAGGGAGGAGGG - Intergenic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962277943 3:134029990-134030012 CCCGAGGAAAAGAGGGAGGAGGG - Exonic
962878203 3:139552233-139552255 GAGGGGGACCAGAGTTAGGAGGG + Intergenic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
963001739 3:140688027-140688049 CTGGTGGACCAGATCGAGGACGG + Exonic
963652926 3:148006928-148006950 GAGGAGGAGGAGAGGGAGGGAGG - Intergenic
963703261 3:148653629-148653651 CACAAGGACAAGAGGGAGGAGGG - Intergenic
963952130 3:151214488-151214510 AAGGAAGAACAGAGGGAGGGAGG - Intronic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
965039051 3:163482723-163482745 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965460978 3:168962900-168962922 CAGGAGGCTGAGTGGGAGGATGG + Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966630135 3:182063506-182063528 AAGAAGGAACAGAGGAAGGAGGG + Intergenic
966754226 3:183353590-183353612 CAGGAGGAAGAGAGTGAGGGAGG + Intronic
966908491 3:184544536-184544558 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
966908573 3:184544755-184544777 GAGGAGGAGGAGAGGGAGGAGGG - Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967862687 3:194163923-194163945 CAGGAGGAGGAAAGGGAGGAGGG - Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968360651 3:198144582-198144604 CAGAAGGCCCAGGGAGAGGAGGG + Intergenic
968493051 4:900814-900836 CAGAAGGAAGAGAGGGAGGGAGG + Intronic
968565325 4:1309574-1309596 GAGGAGGAGCAGAGGCAGGGAGG + Intronic
968871891 4:3246576-3246598 CAGCAGCACCTGAGGGAGAAGGG - Intronic
968889162 4:3358881-3358903 GAGGAGGAGAAGGGGGAGGAAGG - Intronic
968889292 4:3359184-3359206 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
968904013 4:3443472-3443494 CAGAAGGGCCAAGGGGAGGATGG + Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969117569 4:4881209-4881231 CAGGACAACCAGTGGTAGGAGGG - Intergenic
969140595 4:5067862-5067884 CAGGAGGATAAGAGAGAGGGAGG + Intronic
969301368 4:6299271-6299293 CAAGAGGAGCAGAGGGCTGAGGG - Intronic
969355216 4:6621069-6621091 CAGGAGGGTGAGAGGGAGGCTGG + Intronic
969397176 4:6929604-6929626 CAGGAGGGGCAGGGGTAGGAGGG + Intronic
969454772 4:7294839-7294861 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
969481408 4:7448863-7448885 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969481466 4:7449024-7449046 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969481535 4:7449202-7449224 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
969984301 4:11191147-11191169 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
970088193 4:12371467-12371489 CAAGAGGAACAGAGAGAGTAGGG - Intergenic
970297182 4:14642277-14642299 AAGGAGGCAAAGAGGGAGGAAGG + Intergenic
970352401 4:15216040-15216062 CAGGAGCAAGAGAGGGAGCAGGG - Intergenic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
970551526 4:17186388-17186410 TAGGTGGACCAGATGGAGCAGGG + Intergenic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
970603519 4:17658845-17658867 GAGCAGCACCTGAGGGAGGAGGG - Intronic
971218087 4:24680559-24680581 AAGGAGGAAAGGAGGGAGGAGGG + Intergenic
971769824 4:30882098-30882120 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
972295047 4:37729454-37729476 CAGGAGGTCAAGAGGGAGAATGG + Intergenic
973157685 4:46977275-46977297 AAGGAGGAAGGGAGGGAGGAAGG + Intronic
973336245 4:48959389-48959411 GAGGAGAGCCAGAGGGAGAAGGG + Intergenic
973581611 4:52349550-52349572 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
973584364 4:52375925-52375947 CAGGAGGCTGAGTGGGAGGATGG + Intergenic
973726502 4:53782299-53782321 CAGCAGGCAAAGAGGGAGGATGG - Intronic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
973968920 4:56191396-56191418 AGGGAGGAACAGAGGGAGGGAGG - Intronic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974366386 4:60955129-60955151 CAGGAGTGCAAGAGGGTGGAGGG + Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975033022 4:69647059-69647081 CAGCAGGAACATAGGAAGGAGGG + Exonic
975237252 4:72013732-72013754 CAGGAAGACTAGAGGGTAGAAGG + Intergenic
975607212 4:76167461-76167483 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
975723486 4:77270279-77270301 AAGCAGGACCAGGGAGAGGAAGG + Intronic
975933365 4:79553856-79553878 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976303439 4:83536427-83536449 GAGGAGGAGCCCAGGGAGGAAGG + Intronic
976486153 4:85607369-85607391 AGGGAGGAACGGAGGGAGGAAGG + Intronic
976532891 4:86175578-86175600 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
976572757 4:86632672-86632694 GAGGAGGCGCAGGGGGAGGAGGG - Intronic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
978056326 4:104272511-104272533 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
978071628 4:104479778-104479800 ACGGAGGAACAGAGGGAGGGAGG - Intronic
978197925 4:105991972-105991994 CAGGAGGACATGAAGAAGGATGG - Intronic
978690568 4:111504539-111504561 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980285970 4:130778729-130778751 AAGGAGGAAGGGAGGGAGGAAGG + Intergenic
981193679 4:141893063-141893085 CAGGAAGACTAAAGGGAGGAGGG + Intergenic
981269543 4:142829015-142829037 TAGGTAGATCAGAGGGAGGAGGG + Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981294764 4:143118983-143119005 CAGGAGTCCTAGAGAGAGGAAGG - Intergenic
981409911 4:144417700-144417722 CAGGAGGAAGAGAGAGAGGTGGG + Intergenic
981542415 4:145859673-145859695 CGCGAGAACCAGAGAGAGGAAGG - Intronic
981919125 4:150067741-150067763 GAACAGGACCAGAGGTAGGAAGG + Intergenic
982183631 4:152774079-152774101 CAGGAGGGAGAGAGGAAGGAAGG - Intronic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
982271914 4:153599195-153599217 CAGGAGCACGAGAGGGGAGAAGG + Intronic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982618746 4:157677340-157677362 CAGGAGGAAGAGAGAGATGAGGG + Intergenic
983279887 4:165667039-165667061 CAGGAGGAAGACAGGAAGGAAGG + Intergenic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
983678791 4:170328340-170328362 CAGAAGGACCTCATGGAGGAAGG + Intergenic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984189012 4:176582392-176582414 CAGGAGGAAGAGAGAGAGGTGGG - Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984256927 4:177400569-177400591 CAGGAGCAAGAGAGAGAGGAGGG + Intergenic
984587034 4:181576623-181576645 CAGCAGAACCACAGGAAGGAAGG + Intergenic
984660398 4:182368234-182368256 CACGAGCATCAGAGGCAGGATGG + Intronic
985112482 4:186560222-186560244 CAAGAGGAAGAGAGAGAGGAGGG + Intergenic
985428573 4:189855679-189855701 CAGGAGGAACAGAGGGGAAATGG - Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985581444 5:697459-697481 ACGGAGGACCAGAGAGAGGATGG + Intergenic
985629663 5:1008088-1008110 CAGGAGGAAGTGAGGGAAGAAGG + Intergenic
985873940 5:2581098-2581120 CAGGAGGGAGGGAGGGAGGAAGG - Intergenic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
986093572 5:4534915-4534937 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
986164641 5:5263395-5263417 AATGAAGACCAGAGGGATGAAGG - Intronic
986360854 5:6976417-6976439 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
986699840 5:10395681-10395703 CAGGAAGTCCAGAGGAAGAATGG + Intronic
986919733 5:12666990-12667012 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987185647 5:15415651-15415673 AAGGAAGACAAGAGGGAGGACGG + Intergenic
987187986 5:15444665-15444687 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
987490001 5:18568004-18568026 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
988066222 5:26230630-26230652 AAGGAGGACGGAAGGGAGGAAGG - Intergenic
988463598 5:31465759-31465781 AGGGAGGAAGAGAGGGAGGAGGG - Intronic
988716265 5:33831584-33831606 AAGGAGGACCAGCTGGAAGATGG - Intronic
988906378 5:35794903-35794925 GAGGGGGACCTGAGGGCGGAAGG - Intronic
989090359 5:37724059-37724081 CCGGGGGACCAGGGGAAGGAAGG - Intronic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
990304337 5:54480120-54480142 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
990425386 5:55682970-55682992 GAGGAGGAAAAGAGGGAGGGAGG + Intronic
990454873 5:55975318-55975340 CAGGAGGAAGAGAGAGAGAAAGG - Intronic
990782959 5:59386684-59386706 CAGGAGGAAGGGAGGGAGGGAGG + Intronic
991092899 5:62710085-62710107 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
991172306 5:63642628-63642650 AGGGAGGAACAGAGGGAGGGAGG - Intergenic
991273518 5:64815366-64815388 CAGGAGGAAAAGAGTGATGAAGG + Intronic
991601084 5:68351775-68351797 CTGGAAGACCAGAGGTAGGAAGG - Intergenic
991646783 5:68808276-68808298 AGGGAGGAAGAGAGGGAGGAAGG + Intergenic
991646788 5:68808300-68808322 AAGGAGGAAGAGAGGCAGGAAGG + Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992689055 5:79225684-79225706 CAGGAGGATAAGTGGAAGGATGG - Intronic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993622556 5:90186160-90186182 GAGGAGGAGGAGAGGGGGGAAGG - Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994073142 5:95622991-95623013 AAGGAGGAACAAAGAGAGGAAGG - Intergenic
994077321 5:95667927-95667949 CAGGAGGAAGAGAGAGAGGTGGG - Intronic
994193314 5:96893611-96893633 AGGGAGGGCCAGAGGGAGCATGG - Intronic
994636003 5:102344876-102344898 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
994898576 5:105739675-105739697 CAGGAGGAAAAGAGGCAGGTAGG - Intergenic
994913685 5:105945639-105945661 GAGGAGGAGGAGAGGAAGGATGG + Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
996509759 5:124305034-124305056 AAGGAGGACTGGAGGGTGGAAGG - Intergenic
996876980 5:128250862-128250884 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997232822 5:132256742-132256764 CGAGAGAACCAGAGGGAGGTTGG + Intronic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
997927634 5:138045426-138045448 CAGGAGGCTGAGTGGGAGGATGG + Intronic
998386811 5:141761946-141761968 CAGGAAGCCAAGAGGTAGGAGGG + Intergenic
998609286 5:143670600-143670622 CAGGAGGAAGAGAGAGAGGGTGG + Intergenic
999081879 5:148852251-148852273 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999082092 5:148854331-148854353 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999178365 5:149648382-149648404 CAGGAGGAGGAGAGCAAGGAGGG - Intergenic
999296533 5:150462947-150462969 GAGGAGAACCAGAGGGAGAAGGG + Intergenic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000239119 5:159392872-159392894 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1001408708 5:171495295-171495317 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001475682 5:172048990-172049012 CTGAAGGACCTGAGGGAGGGAGG - Intronic
1001549042 5:172588661-172588683 CAGGAGCACCAGCTGGAGGTGGG + Intergenic
1001573096 5:172743682-172743704 CAGGTGGTCCAGAGGAAGGAGGG + Intergenic
1002053217 5:176583738-176583760 CAGGAGGGACAGGGGTAGGAGGG + Intronic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002102365 5:176863807-176863829 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
1002123765 5:177026072-177026094 CAGGAGAACCAGGGAGACGAAGG - Intronic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002956857 6:1874014-1874036 CAGACGGACCAGTGGGAGGAAGG + Intronic
1003265035 6:4558195-4558217 TAGGAGAACCAGAGATAGGATGG + Intergenic
1003369519 6:5510759-5510781 CAAGAGGACAAGAGGGGGGTGGG - Intronic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003635605 6:7828897-7828919 CACGCGGACCAGAGGTTGGACGG + Intronic
1003667013 6:8120883-8120905 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
1003681613 6:8263138-8263160 AAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1003977835 6:11360584-11360606 CAGGAGGAAGAGAGAGAGCAGGG - Intronic
1004287901 6:14339613-14339635 CAGGTGGGTCAGGGGGAGGAGGG - Intergenic
1004423254 6:15489871-15489893 AAGGAGGAGGAGAGGGAAGAGGG - Intronic
1004458495 6:15813906-15813928 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1004544959 6:16588793-16588815 AAGGAGGAAGGGAGGGAGGAAGG + Intronic
1004577035 6:16906893-16906915 AAGGAGGAGGAGAGGAAGGAAGG + Intergenic
1004714611 6:18205136-18205158 CAGCAGGACCAGAAAGAGAATGG + Intronic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005732273 6:28709678-28709700 GAGGAGGACGAGAAGAAGGAAGG - Intergenic
1006025363 6:31143317-31143339 GAGGAGGCCCGGAAGGAGGAGGG - Exonic
1006095198 6:31651977-31651999 CTGGAGGACGAGAGGTGGGAGGG + Intronic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006443754 6:34067613-34067635 AAGGAGGAAGGGAGGGAGGAAGG - Intronic
1006744136 6:36329887-36329909 GAGGAGGAGGAGAGGAAGGAAGG + Intronic
1006834766 6:36991195-36991217 AAGGAAGACCAGAGTGAGGCTGG - Intergenic
1006932852 6:37697929-37697951 GAGGAGGAAGAGAGGGAGGGAGG - Exonic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007282105 6:40720388-40720410 CGGGAGGGACAGAGGGAGGGAGG + Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008365869 6:50678957-50678979 CAGGAGGCTCAGGGGGAGGATGG + Intergenic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008800487 6:55362954-55362976 GAGGAGGAGAAGGGGGAGGAGGG + Intronic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1009671177 6:66753099-66753121 AAGGAGGAAGAGAGGCAGGAAGG + Intergenic
1009948359 6:70366066-70366088 AAGGAGGGATAGAGGGAGGAAGG + Intergenic
1010196881 6:73248435-73248457 CAGGAGGGAGAGAGGAAGGAGGG - Intronic
1010298657 6:74232087-74232109 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1011280624 6:85673564-85673586 CAGGAGGAGCAGAGGAATAATGG - Intergenic
1011847461 6:91584199-91584221 AAGAAGGAAGAGAGGGAGGAAGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012549659 6:100455367-100455389 CAGGAGGACCCCAGGGACCAGGG - Intronic
1012848999 6:104424409-104424431 AAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1013044398 6:106470058-106470080 CTCGGGGACCAAAGGGAGGAGGG - Intergenic
1013604199 6:111732828-111732850 CAGCAGGACCACAGGATGGAAGG + Intronic
1013836772 6:114343089-114343111 GAGGAGGAGCACGGGGAGGAGGG - Intergenic
1014103867 6:117541510-117541532 AAGGAGGAACAGAGGTAGGAGGG + Intronic
1014289302 6:119539843-119539865 CAGGAGGACCAGTGGCAGAGAGG + Intergenic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1015442834 6:133268796-133268818 CAGGAGGAGAAGAGGGAGAGTGG + Intronic
1015807019 6:137119947-137119969 CAGGAGGACTAGAGAGACCACGG - Intergenic
1015998506 6:139018829-139018851 AAGGAGGACAGGAGGGAGGGAGG + Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016403703 6:143707907-143707929 CAGGAGGAAGAGAGAGAGGGAGG + Intronic
1016532613 6:145075191-145075213 AAGGAGGAAAAGAGGGAGGGAGG + Intergenic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1016642537 6:146365820-146365842 GACGAGGACCAGAGTGAGGCAGG + Intronic
1016784548 6:147995760-147995782 CAGGACTACCAGAGCAAGGAAGG + Intergenic
1016882760 6:148927209-148927231 GAGGAGGACCAGTGGGAGGGAGG + Intronic
1017189847 6:151641342-151641364 CAGGAGCAAGAGAGAGAGGAAGG - Intergenic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1018347745 6:162920188-162920210 AAGGAGGAAGTGAGGGAGGAAGG + Intronic
1018630793 6:165820596-165820618 CAGGAGGACCAGACGCTGGGGGG - Intronic
1018788852 6:167130974-167130996 GAGGGGGTCCAGAGGGAGGGTGG - Intronic
1019053463 6:169202260-169202282 CAGGTGGACCTGGGGGAGCAGGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019210662 6:170401992-170402014 CAGGGAGTCCTGAGGGAGGATGG - Intronic
1019259353 7:72050-72072 CAGAAGGCCCAGGGAGAGGAGGG - Intergenic
1019320789 7:414403-414425 AAGGAGGAAGAGGGGGAGGAGGG - Intergenic
1019327608 7:446008-446030 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1019531747 7:1506688-1506710 GAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1019589494 7:1823739-1823761 CAGGAAGGCCAGTGGGAGCAGGG - Intronic
1019606431 7:1912506-1912528 CAGGAGGAGCCGTGAGAGGATGG - Intronic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1020119957 7:5497530-5497552 GAGGAGGTCGAGAGGGAGGGTGG + Intronic
1020202768 7:6093224-6093246 AAGGAGGAAGAGAGGGAGGGAGG - Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020618061 7:10484622-10484644 AAGGATGACCACAGGTAGGAGGG - Intergenic
1020630889 7:10637957-10637979 CAAGAGGAACAGAGGCAGGCAGG + Intergenic
1020761284 7:12270219-12270241 CAGGACGACCAGCGGTAGGGAGG + Intergenic
1021018418 7:15564873-15564895 CAGGAGGACGAGACAGAAGAGGG - Intergenic
1021188444 7:17592638-17592660 CAGGAGGAGGAGTGGAAGGAGGG + Intergenic
1021202343 7:17741148-17741170 CTGGAGGACCAGAGGGGCCAGGG - Intergenic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1022170039 7:27817967-27817989 CAGGAGGCCAAAAGGCAGGAGGG - Intronic
1022289069 7:28983936-28983958 CAGGAGGAGGAGAGAGAGGGAGG + Intergenic
1022531808 7:31071504-31071526 CTGGAGGACGAAGGGGAGGACGG + Intronic
1022753022 7:33252109-33252131 CAGGAGCAAGAGAGGGAGGGGGG + Intronic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1023168762 7:37369901-37369923 AAGGAGGATCAGAAGGAGTAGGG - Intronic
1023217720 7:37882524-37882546 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1023269474 7:38445938-38445960 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
1023589391 7:41765118-41765140 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1023595204 7:41822417-41822439 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
1023694738 7:42833441-42833463 CAGGAGGAGCAAGGGAAGGAAGG + Intergenic
1023700723 7:42889334-42889356 TAAGAGGAAAAGAGGGAGGAGGG - Intergenic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023876747 7:44290351-44290373 CTGGAGGACCTGAGCGGGGAGGG - Intronic
1023991686 7:45132540-45132562 AAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1024233085 7:47377710-47377732 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024293830 7:47827266-47827288 CAGGAGGACCAGCGGCAGTGGGG + Intronic
1024312155 7:47979375-47979397 CAGGAGGATCAGAACGGGGATGG - Intronic
1024711666 7:52021869-52021891 CAGGAGGCCTAGAGGGAGCAAGG - Intergenic
1024983877 7:55179549-55179571 CAGGAGGACCAGAGGCTGGAGGG + Intronic
1025212821 7:57030691-57030713 GAGGAGGACGAGAGGGCGGCTGG - Intergenic
1025659132 7:63546133-63546155 GAGGAGGACGAGAGGGCGGCTGG + Intergenic
1025847830 7:65216726-65216748 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1025939958 7:66068678-66068700 CAGGAGCAAGAGAGAGAGGAGGG + Intergenic
1026280749 7:68919796-68919818 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1026354049 7:69541937-69541959 TAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1026589134 7:71680635-71680657 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026767068 7:73166830-73166852 GAGGAGGAGGAGAGGGAGGGGGG - Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1027581746 7:80005425-80005447 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1027753828 7:82185521-82185543 GAGGAGGAGGAGGGGGAGGAAGG + Intronic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028435428 7:90797744-90797766 CAGGAGGAATAGAGAGAGGGAGG + Intronic
1028755369 7:94427632-94427654 CAGGAGGGCCAGGGGGACCAGGG - Exonic
1029144954 7:98439267-98439289 GGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1029157934 7:98530542-98530564 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1029506885 7:100968186-100968208 CAGGAAGAGAAGGGGGAGGAGGG - Exonic
1029519411 7:101050704-101050726 CAGGAGGGCGGGAGTGAGGATGG + Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029704460 7:102268786-102268808 CAGGAGGAAGAGAGAGAGAATGG + Intronic
1029750378 7:102539626-102539648 CAGGAGGACCGTGAGGAGGACGG + Intronic
1029768330 7:102638734-102638756 CAGGAGGACCGTGAGGAGGACGG + Exonic
1029983694 7:104902428-104902450 GAGGAGGAGGAGGGGGAGGAGGG + Intronic
1030338548 7:108351192-108351214 CAGAAGGGCAAGAGAGAGGAGGG - Intronic
1030365499 7:108641358-108641380 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1030710866 7:112747540-112747562 CAGGAGGAAGAGTGAGAGGAGGG - Intergenic
1030835565 7:114279841-114279863 AAGGAAGATCAGAGGCAGGAGGG + Intronic
1030942489 7:115671296-115671318 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1031871257 7:127091727-127091749 AGGGATGACCAGTGGGAGGAGGG - Intronic
1032035345 7:128517384-128517406 CAAGAGGACCTGTGGGTGGAGGG + Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1032887628 7:136158642-136158664 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1032996175 7:137448712-137448734 AAGGAGGAAGGGAGGGAGGAAGG + Intronic
1033276312 7:139974176-139974198 AGGGAGGTCCAGAGGGAGGGTGG + Intronic
1033359274 7:140626619-140626641 CAGGAAGGCAAGAGGGAGAAAGG - Intronic
1033648801 7:143324364-143324386 CAGGTGGAAGAGAGGGAGGTGGG - Intronic
1033714850 7:143989715-143989737 CAGGAGGACAAGAGAGACCACGG - Intergenic
1033890435 7:146006407-146006429 GAGAAGGAGCAGGGGGAGGATGG - Intergenic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034301993 7:150024307-150024329 CAGGAGGACCCACGGGAGGGTGG + Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1035064453 7:156094995-156095017 CAGGTGGACCTGAGGTAGGCAGG + Intergenic
1035085910 7:156257759-156257781 CAGGAGGAAGAGAGGGACGGGGG + Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036448727 8:8846288-8846310 GAGGAGGATAAGAAGGAGGAGGG + Intronic
1036502824 8:9329157-9329179 CGGGAGGCCCATAGGTAGGAAGG + Intergenic
1036684790 8:10902499-10902521 CAGAGGGACCAGACGGAGAAAGG - Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037339817 8:17832286-17832308 CAGAAGGAACGGAAGGAGGAAGG + Intergenic
1037426605 8:18762264-18762286 CAGGAGGAAGAGAGGAAGGAAGG - Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1037497022 8:19450148-19450170 GAGGAGGAGGAGAGGGAGAAGGG + Intronic
1037514954 8:19620870-19620892 CAGGAGCATCAGAGGGAACATGG + Intronic
1037821768 8:22138606-22138628 GAGGACGACAGGAGGGAGGAGGG - Intronic
1037858671 8:22389447-22389469 CAGGAGGACCCGGGGGAGGTGGG + Intronic
1037926072 8:22845099-22845121 CATGAGGACCAGATAGAGAATGG - Intronic
1038284960 8:26198484-26198506 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1038339530 8:26673896-26673918 GAGGAGGAGGGGAGGGAGGAAGG - Intergenic
1038397604 8:27258613-27258635 CTGGAGAACCAGAGGGGTGAGGG + Intergenic
1038497384 8:28013249-28013271 GAGGAGGAAGAGAGGGAGCAAGG + Intergenic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1039116692 8:34099261-34099283 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1039566143 8:38553875-38553897 AAGCAGGAACAGAGGGAGGGGGG + Intergenic
1039737420 8:40347711-40347733 CAGGAGGTCAAGAAGGAGGAAGG - Intergenic
1039845268 8:41321456-41321478 CATGAGGACCACAGTGACGAGGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1039986568 8:42452680-42452702 AAGGAGGAAAAGATGGAGGAGGG + Intronic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1041119254 8:54569937-54569959 CTGGAGGACGAGTGGGAGTATGG + Intergenic
1041330518 8:56719304-56719326 AAGGAGGAGGAGAGGGAGCAGGG - Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1042310507 8:67374700-67374722 CAGGTGGACCAGAGAGAAGGTGG - Intergenic
1042893982 8:73645801-73645823 CAGGAGGAAGAGAGAAAGGAGGG + Intronic
1043383709 8:79728724-79728746 CAGGAGGAAGAGAGTGAGGGGGG - Intergenic
1043726218 8:83614267-83614289 AAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045674098 8:104589082-104589104 CAGGCGAGCCGGAGGGAGGAGGG - Intergenic
1045755330 8:105534410-105534432 AAGGAGGAAGAGAGGAAGGAAGG - Intronic
1046111355 8:109729788-109729810 AAGGAGGAAGAGGGGGAGGAGGG + Intergenic
1046283933 8:112071403-112071425 GTAGAGGACCAGAGGGAGGTGGG - Intergenic
1046806200 8:118481446-118481468 AAGAAGGAAAAGAGGGAGGAAGG + Intronic
1047691590 8:127360379-127360401 CAGGAGGAAGAGAGAGAGAAGGG + Intergenic
1047715533 8:127591636-127591658 CTGGAGGACCTCAGGGAGGAGGG + Intergenic
1048053956 8:130846487-130846509 AAGAAGGAAGAGAGGGAGGAAGG - Intronic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048516580 8:135116818-135116840 GAGGAGGAGGAGAGGGGGGAGGG - Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048918994 8:139210775-139210797 CAGGAAGACCAGAGGCATCACGG + Intergenic
1049122069 8:140747772-140747794 AAGGAGGAAGAGGGGGAGGAAGG + Intronic
1049240376 8:141534917-141534939 GAGGAGGACCAGTGGGAGGAGGG - Intergenic
1049268648 8:141682705-141682727 CAGGAGGCCCAGAGGGAGACAGG + Intergenic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1049431584 8:142567673-142567695 CTCGAGGACCAGAGGGATGAGGG + Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049589104 8:143447730-143447752 CAGGAGGACGAGAGAGAGCGGGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050598038 9:7223752-7223774 AAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1050718446 9:8557064-8557086 AAGGAGGACCAGTGAGAGGAAGG + Intronic
1050895925 9:10885991-10886013 AAGGAGGAATAGAGGGTGGAAGG - Intergenic
1050970145 9:11860225-11860247 CAGGAGGACAAGAAAGAGTATGG + Intergenic
1050982476 9:12037354-12037376 CTGGAGTACCAGAGGGAGACAGG + Intergenic
1051274651 9:15387166-15387188 CAGCAGGAAGAGAGAGAGGAGGG - Intergenic
1051694321 9:19751794-19751816 CTGGAGGATCAGACGTAGGAAGG + Intronic
1052284005 9:26763786-26763808 CAGAAGGAAAAGAGAGAGGAAGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053392807 9:37747879-37747901 CAGGAGCACCAGAGGGACAAGGG - Intronic
1053444145 9:38138509-38138531 CTTGAGGACCTGGGGGAGGAGGG + Intergenic
1053516514 9:38735030-38735052 AAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1053684853 9:40511611-40511633 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1053934816 9:43139894-43139916 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054278874 9:63113345-63113367 CAGGAGCATCGGAGAGAGGAGGG + Intergenic
1054297945 9:63347074-63347096 CAGGAGCATCGGAGAGAGGAAGG - Intergenic
1054395962 9:64651592-64651614 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054430606 9:65156787-65156809 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054499774 9:65864734-65864756 CAGGAGCATCGGAGAGAGGAGGG + Intergenic
1054862988 9:69972250-69972272 CAGGAGTAACAGAGGGGGAAGGG - Intergenic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055396731 9:75883710-75883732 AAGGTGGACCAGGGGTAGGAAGG + Intergenic
1055735803 9:79328715-79328737 CAGGAGGAAGAGAGAGAAGAGGG + Intergenic
1056000704 9:82213392-82213414 CAGGAGGAATAGAGAGAGGTGGG - Intergenic
1056238314 9:84618048-84618070 TAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1056545317 9:87608013-87608035 CAGGAGGAAGAGAGAGAGAAGGG + Intronic
1056617457 9:88180597-88180619 AAGGAGGGCCAGCGGGAGGGCGG - Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057165475 9:92921784-92921806 AAGGAGGAAGACAGGGAGGAAGG - Intergenic
1057332641 9:94129907-94129929 CAGGAGGAAGAGAGAGAAGAGGG - Intergenic
1057497418 9:95571969-95571991 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1057505319 9:95628516-95628538 GAGGAGGACGAGGAGGAGGAGGG - Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058171576 9:101687407-101687429 TAAGAGTACCAGAGGGTGGATGG + Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058366044 9:104209590-104209612 TAGCAGGACCCGTGGGAGGAAGG + Intergenic
1058483903 9:105424164-105424186 GAAGAGGACCAGAGAGAGGAGGG - Intronic
1059352882 9:113678059-113678081 GAGGAGGAGGAGAGGAAGGAAGG - Intergenic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059451224 9:114372548-114372570 CAGGAGGAAGGAAGGGAGGAGGG + Intronic
1059588816 9:115635264-115635286 CAGGAGCACAAGACAGAGGAAGG - Intergenic
1059611371 9:115900681-115900703 GAGGAGGAGGAGAGGAAGGAGGG - Intergenic
1059613573 9:115924694-115924716 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1059613578 9:115924710-115924732 AGGGAGGAACAGAGGGAGGGAGG + Intergenic
1060097470 9:120804887-120804909 CAGGAGGACCAGAGAGACCTTGG + Intergenic
1060112629 9:120917627-120917649 CTGGAGGCCCAAGGGGAGGATGG + Intronic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060628975 9:125139004-125139026 AAGGTGGAGCAGAGGGAGGGTGG + Intronic
1060737234 9:126073758-126073780 ACTGAGGACCAGAGGGAGAAGGG + Intergenic
1060859044 9:126938886-126938908 CAGGAGTAGAGGAGGGAGGAGGG + Intronic
1060931373 9:127491516-127491538 CAGGAGGGTCAGAGGAAGGAGGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061399037 9:130358396-130358418 AAGGTGGACCTGAGGGACGAGGG + Intronic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061582907 9:131548311-131548333 AAGGAGGAATAGAGGGTGGAAGG - Intergenic
1061634918 9:131901527-131901549 CTTGAGGAACGGAGGGAGGAGGG + Intronic
1061865664 9:133490768-133490790 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062340356 9:136091307-136091329 CAGGACGGCCTCAGGGAGGACGG + Intronic
1062349661 9:136132734-136132756 CAGGAGCCGCACAGGGAGGATGG - Intergenic
1062501887 9:136855240-136855262 CAGGAGGATCTGAGGGCAGAGGG - Exonic
1062540240 9:137038845-137038867 AAGAAGGCCCCGAGGGAGGAAGG - Intergenic
1062588735 9:137263507-137263529 CAGGAGGGCCAGGGGGAAGGAGG - Intronic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1062671840 9:137715518-137715540 CAGGAAGAACAGAGCCAGGAAGG + Intronic
1062712048 9:137980666-137980688 GGGGAGTACTAGAGGGAGGAGGG - Intronic
1062745352 9:138208413-138208435 CAGAAGGCCCAGGGAGAGGAGGG + Intergenic
1203394802 Un_KI270512v1:15440-15462 CAGGAGAACCAGAGCCAAGATGG - Intergenic
1185449555 X:275213-275235 GAGAAGGAGCAGGGGGAGGAAGG + Intergenic
1185603592 X:1354959-1354981 GAGGAGGACTGGGGGGAGGAAGG + Intronic
1186005464 X:5066001-5066023 CAGGAGGAAGACAGGGAGGGAGG + Intergenic
1186113024 X:6276639-6276661 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
1186239941 X:7555203-7555225 AAGGAGGAAGCGAGGGAGGAAGG + Intergenic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187480210 X:19648372-19648394 AAGGAGGGCAAGAGGGAGGAGGG + Intronic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1187852381 X:23604009-23604031 GAGGAGGCCCAGAGTCAGGATGG - Intergenic
1188309247 X:28597064-28597086 AAGGAGGACCAAATGGAGCATGG + Intronic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188572845 X:31610062-31610084 CAGGAAGGACAGAGGGAGAATGG - Intronic
1188838720 X:34989249-34989271 CAGATGGACTAGAGGGAGAAAGG + Intergenic
1189025202 X:37387532-37387554 CAGGAGGAAGAGAGAGAGGGGGG + Intronic
1189069797 X:37851235-37851257 CAGGAAGAAGAGAGAGAGGAGGG - Intronic
1189220106 X:39364271-39364293 CAGGAGGAAGAGAGAGAGAATGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189424624 X:40886986-40887008 GAGGACTACTAGAGGGAGGAGGG - Intergenic
1189729880 X:44008573-44008595 AAGGAGGAGAAGAGGGAGGGAGG + Intergenic
1190048618 X:47132567-47132589 GAGGAGGAAGAAAGGGAGGAAGG - Intergenic
1190368340 X:49718543-49718565 CAGGAGGACGAGACAGAGAAGGG + Intergenic
1190372862 X:49759577-49759599 CAGGAGGAACAGAGAGCGAAGGG + Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1191000980 X:55659338-55659360 CAGGAGGACATGGGGGAAGAAGG + Intergenic
1191666329 X:63706415-63706437 CAGGAGGATGAGGTGGAGGAGGG - Exonic
1191951509 X:66598406-66598428 CACGAGGAACAGAGCCAGGATGG + Intronic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192667523 X:73102891-73102913 CAAGAGGAAGAGAGAGAGGAGGG - Intergenic
1193026414 X:76850460-76850482 CAGGAGGAACAGAGAGAGGGGGG + Intergenic
1193186825 X:78523239-78523261 CAGGAGGAAAAGAGTGATGAGGG + Intergenic
1193591136 X:83390010-83390032 CAGGAGGACCAGAGTGACCTAGG - Intergenic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194402238 X:93452775-93452797 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196109528 X:111930999-111931021 GAGGAGGAGGACAGGGAGGAAGG + Intronic
1196708884 X:118742169-118742191 CAGCAGGACAAGGGAGAGGAAGG - Intronic
1196740838 X:119024437-119024459 CAGGAGGGCCTGAGGTGGGATGG + Intergenic
1196824710 X:119732019-119732041 CAGCAGGACCAGCAGAAGGAAGG + Intergenic
1197098635 X:122625182-122625204 CAGGAGGAAAAGAGAGAGGGAGG + Intergenic
1197271012 X:124424810-124424832 CAGGAGGAAGAGAGAGAGAAGGG - Intronic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197816313 X:130502269-130502291 AAGGAGGACCGAAGGAAGGAGGG - Intergenic
1197834185 X:130677203-130677225 GAGGAGGAAGTGAGGGAGGAAGG - Intronic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199605357 X:149573908-149573930 AGTGAGGACCAGAGGGAGAAAGG - Intergenic
1199633764 X:149795460-149795482 AGTGAGGACCAGAGGGAGAAAGG + Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199720562 X:150540282-150540304 CAGGAGCAACAGAGAGAGCAGGG - Intergenic
1200125711 X:153813431-153813453 CAGGAGGACCAGGAGGATGTGGG + Intronic
1200232201 X:154449667-154449689 CCTGCGGACCTGAGGGAGGAAGG - Exonic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic
1201437360 Y:13973730-13973752 CAGGAGGAAGAGAGAGAGGGAGG + Intergenic