ID: 1163586934

View in Genome Browser
Species Human (GRCh38)
Location 19:18169309-18169331
Sequence CCCAGGGGCGGCTCTGCTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 344}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163586934_1163586945 0 Left 1163586934 19:18169309-18169331 CCCCAAGCAGAGCCGCCCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 344
Right 1163586945 19:18169332-18169354 CCCGTCTGCGCCGGAGGCTGCGG 0: 1
1: 0
2: 9
3: 483
4: 16256
1163586934_1163586951 15 Left 1163586934 19:18169309-18169331 CCCCAAGCAGAGCCGCCCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 344
Right 1163586951 19:18169347-18169369 GGCTGCGGCGGCGGGAGCCACGG 0: 1
1: 1
2: 5
3: 94
4: 882
1163586934_1163586948 6 Left 1163586934 19:18169309-18169331 CCCCAAGCAGAGCCGCCCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 344
Right 1163586948 19:18169338-18169360 TGCGCCGGAGGCTGCGGCGGCGG 0: 1
1: 1
2: 5
3: 153
4: 2564
1163586934_1163586947 3 Left 1163586934 19:18169309-18169331 CCCCAAGCAGAGCCGCCCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 344
Right 1163586947 19:18169335-18169357 GTCTGCGCCGGAGGCTGCGGCGG 0: 1
1: 0
2: 3
3: 34
4: 439
1163586934_1163586939 -9 Left 1163586934 19:18169309-18169331 CCCCAAGCAGAGCCGCCCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 344
Right 1163586939 19:18169323-18169345 GCCCCTGGGCCCGTCTGCGCCGG 0: 1
1: 0
2: 0
3: 16
4: 168
1163586934_1163586949 7 Left 1163586934 19:18169309-18169331 CCCCAAGCAGAGCCGCCCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 344
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586934_1163586943 -6 Left 1163586934 19:18169309-18169331 CCCCAAGCAGAGCCGCCCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 344
Right 1163586943 19:18169326-18169348 CCTGGGCCCGTCTGCGCCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163586934 Original CRISPR CCCAGGGGCGGCTCTGCTTG GGG (reversed) Exonic