ID: 1163586949

View in Genome Browser
Species Human (GRCh38)
Location 19:18169339-18169361
Sequence GCGCCGGAGGCTGCGGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1403
Summary {0: 1, 1: 0, 2: 13, 3: 302, 4: 1087}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163586931_1163586949 11 Left 1163586931 19:18169305-18169327 CCCGCCCCAAGCAGAGCCGCCCC 0: 1
1: 0
2: 3
3: 33
4: 341
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586936_1163586949 6 Left 1163586936 19:18169310-18169332 CCCAAGCAGAGCCGCCCCTGGGC 0: 1
1: 0
2: 2
3: 18
4: 178
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586930_1163586949 18 Left 1163586930 19:18169298-18169320 CCGAGGACCCGCCCCAAGCAGAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586928_1163586949 29 Left 1163586928 19:18169287-18169309 CCCGCTGAGCACCGAGGACCCGC 0: 1
1: 0
2: 0
3: 6
4: 159
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586937_1163586949 5 Left 1163586937 19:18169311-18169333 CCAAGCAGAGCCGCCCCTGGGCC 0: 1
1: 0
2: 4
3: 34
4: 289
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586942_1163586949 -10 Left 1163586942 19:18169326-18169348 CCTGGGCCCGTCTGCGCCGGAGG 0: 1
1: 0
2: 0
3: 12
4: 125
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586940_1163586949 -8 Left 1163586940 19:18169324-18169346 CCCCTGGGCCCGTCTGCGCCGGA 0: 1
1: 0
2: 0
3: 11
4: 55
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586932_1163586949 10 Left 1163586932 19:18169306-18169328 CCGCCCCAAGCAGAGCCGCCCCT 0: 1
1: 0
2: 0
3: 37
4: 357
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586938_1163586949 -5 Left 1163586938 19:18169321-18169343 CCGCCCCTGGGCCCGTCTGCGCC 0: 1
1: 0
2: 2
3: 22
4: 290
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586934_1163586949 7 Left 1163586934 19:18169309-18169331 CCCCAAGCAGAGCCGCCCCTGGG 0: 1
1: 0
2: 2
3: 15
4: 344
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586929_1163586949 28 Left 1163586929 19:18169288-18169310 CCGCTGAGCACCGAGGACCCGCC 0: 1
1: 0
2: 1
3: 10
4: 117
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087
1163586941_1163586949 -9 Left 1163586941 19:18169325-18169347 CCCTGGGCCCGTCTGCGCCGGAG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1163586949 19:18169339-18169361 GCGCCGGAGGCTGCGGCGGCGGG 0: 1
1: 0
2: 13
3: 302
4: 1087

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163586949 Original CRISPR GCGCCGGAGGCTGCGGCGGC GGG Exonic