ID: 1163587719

View in Genome Browser
Species Human (GRCh38)
Location 19:18173154-18173176
Sequence GGAAAGCAGAAGCTGGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 300}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163587719_1163587726 13 Left 1163587719 19:18173154-18173176 CCCTGCGCCAGCTTCTGCTTTCC 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1163587726 19:18173190-18173212 TCAAGCCTGAGTCAGTCCCACGG 0: 1
1: 0
2: 2
3: 10
4: 143
1163587719_1163587727 14 Left 1163587719 19:18173154-18173176 CCCTGCGCCAGCTTCTGCTTTCC 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1163587727 19:18173191-18173213 CAAGCCTGAGTCAGTCCCACGGG 0: 1
1: 0
2: 0
3: 16
4: 168
1163587719_1163587724 -10 Left 1163587719 19:18173154-18173176 CCCTGCGCCAGCTTCTGCTTTCC 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1163587724 19:18173167-18173189 TCTGCTTTCCGGCGTGGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 109
1163587719_1163587732 28 Left 1163587719 19:18173154-18173176 CCCTGCGCCAGCTTCTGCTTTCC 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1163587732 19:18173205-18173227 TCCCACGGGACCACGGTGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 79
1163587719_1163587730 26 Left 1163587719 19:18173154-18173176 CCCTGCGCCAGCTTCTGCTTTCC 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1163587730 19:18173203-18173225 AGTCCCACGGGACCACGGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 70
1163587719_1163587729 21 Left 1163587719 19:18173154-18173176 CCCTGCGCCAGCTTCTGCTTTCC 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1163587729 19:18173198-18173220 GAGTCAGTCCCACGGGACCACGG 0: 1
1: 0
2: 0
3: 2
4: 101
1163587719_1163587731 27 Left 1163587719 19:18173154-18173176 CCCTGCGCCAGCTTCTGCTTTCC 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163587719 Original CRISPR GGAAAGCAGAAGCTGGCGCA GGG (reversed) Intronic
900578290 1:3394916-3394938 GGAGAGGAGAAACTGGCCCATGG - Intronic
900894990 1:5477129-5477151 GGAAAGCAGAGCCTGAAGCAAGG - Intergenic
901207648 1:7505988-7506010 GGAAAGCAGAAGCCAGTGGAAGG + Intronic
901467754 1:9433605-9433627 GGAAAGAAGTAGCTGGAGCAGGG + Intergenic
903006746 1:20303694-20303716 GGAAGGCAGAAACTTGCCCATGG - Intronic
904128208 1:28257424-28257446 TGAAAGCTGAAGCTGACACAGGG + Intergenic
904998740 1:34651634-34651656 GGAAAGCAGTAGCTCTCACAAGG - Intergenic
905231394 1:36516743-36516765 GGACAGCATGAGCTGGGGCAAGG - Intergenic
906013426 1:42551384-42551406 AAAAAGCAGAAGCTGGGGGAAGG + Intronic
906305959 1:44719319-44719341 GGAGAGCAGGATCTGGCACAAGG + Intronic
906583094 1:46952618-46952640 TGAAAGCAGAAGCTGGTTCCAGG - Intergenic
908965527 1:69757484-69757506 GGAGAGAAGAAGCTGGGCCAAGG + Intronic
910397779 1:86808975-86808997 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
911130053 1:94378108-94378130 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
911298707 1:96148628-96148650 GAAAAGCGGAAGCTGGCTCCAGG - Intergenic
912245505 1:107957968-107957990 GGAAAGCAGAGCCTGGGGTAAGG - Intronic
915928065 1:160039487-160039509 AGAACGCAGAAGCTGGCTCTTGG + Exonic
919153581 1:193731951-193731973 GGAAACCAGAAGAAGGTGCAGGG - Intergenic
919820019 1:201466846-201466868 GGGAAGGAGAAGCTGGAGGAGGG - Intronic
920093608 1:203471622-203471644 GGACACAAGAAACTGGCGCACGG + Intergenic
920218485 1:204378093-204378115 GGAGAGCAGAAGCTGGAGCGGGG + Intergenic
920287509 1:204891148-204891170 AGAAAGCAGAACCTCGGGCAAGG + Intronic
920425986 1:205875563-205875585 TGAAAGCAGAAGCTGGTTCCAGG + Intergenic
920564517 1:206962713-206962735 GGAAAGCAGATGTTGTCCCAAGG + Intronic
921317138 1:213903191-213903213 GGAAGGCAGGAGCTGGGGCTGGG + Intergenic
921567400 1:216736646-216736668 GAAATGCAGCAGCTAGCGCAAGG - Intronic
921762320 1:218930345-218930367 GGAAGGCAGATTCTGGCTCAGGG + Intergenic
922090277 1:222389304-222389326 GGACAGAAGAAGCGGGCACAGGG - Intergenic
923613018 1:235512027-235512049 GGAAAGCAGAATTGGGCGGAGGG - Intergenic
923773825 1:236960645-236960667 AGAAAGGAGATGCTGGCTCAGGG + Intergenic
1063076085 10:2718297-2718319 GGAAAGCACATGCTGTTGCAAGG - Intergenic
1064292659 10:14050247-14050269 GGACAGCAGCACCTGGCACAGGG - Intronic
1066271642 10:33829839-33829861 GGAATGGAGAAGCAGGAGCACGG + Intergenic
1066483815 10:35824514-35824536 GCCATGCAGAAGCTGGGGCAAGG - Intergenic
1067208910 10:44242402-44242424 GGAAAGCAGATGGAGGAGCAGGG - Intergenic
1067691590 10:48505477-48505499 GGAGAGCAGAGTCAGGCGCACGG - Intronic
1067940919 10:50654917-50654939 GGAAAGCAGAACCTGTTCCATGG + Intergenic
1070556003 10:77528124-77528146 GGAAAACAGGACCTGGCACAAGG + Intronic
1070568301 10:77620383-77620405 GGAAAGCAGGAGCTGTGGGAGGG + Intronic
1070628792 10:78069711-78069733 GGAGGGCAGAACCTGGAGCATGG + Intergenic
1070828618 10:79405422-79405444 GGACAGCAGAAGTTAGGGCAGGG + Intronic
1071435789 10:85647180-85647202 GGTAGGCAGGAGCTGGCGCTTGG - Exonic
1073006909 10:100331283-100331305 GGTGATCAGAAGCTGGAGCAGGG - Intergenic
1075292521 10:121242571-121242593 GTAAAACAGAAGCTGGGGCCGGG - Intergenic
1076527964 10:131124279-131124301 GGAAAGTAGAATCTGGAGCTCGG - Intronic
1077156169 11:1092669-1092691 AGAACGCAGAAGCTGGATCACGG - Intergenic
1077232065 11:1462229-1462251 GGAACACAGAAGCTGGAGCTGGG - Intronic
1077306136 11:1869450-1869472 GGGGAGCAGAAGCGGGTGCAGGG + Intronic
1079333980 11:19555194-19555216 GGGAAGCAGAAGCTGGCAGAGGG + Intronic
1079731525 11:23941090-23941112 GCAAAGCAGAAGCTGGTTCTAGG + Intergenic
1079934133 11:26596909-26596931 TGAAAGCAGAAGCTGGTTCCAGG + Intronic
1081070264 11:38602578-38602600 TGAAAGCAGAAGCTGGTTCCAGG - Intergenic
1081145761 11:39561484-39561506 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
1081314403 11:41614252-41614274 GGAGAGCAGAAGTAGGCACAAGG - Intergenic
1081421156 11:42875676-42875698 GAAAAGCAGAAGCTGGTTCTAGG - Intergenic
1082798555 11:57396372-57396394 GGAAGGTAGAAGATGGGGCAGGG - Intronic
1083475008 11:62909796-62909818 GCAAAGCAGCAGCAGGCGAAAGG + Exonic
1083820202 11:65166157-65166179 GGACAGCAAAAGTTGGCGGATGG + Intergenic
1083923546 11:65792948-65792970 GGATTGCAGAAGCAGGAGCACGG - Intronic
1084013466 11:66365393-66365415 GGAGAGCACAAGCTGGAGCCTGG - Intronic
1084533691 11:69744632-69744654 GGAAACCAGAGGCTGGGGGAGGG - Intergenic
1086891178 11:92259903-92259925 GGAAAGCAGAAGATGTGGCTGGG + Intergenic
1086897758 11:92333427-92333449 GTAAAGCAGCAGCTGGCCCCGGG + Intergenic
1087074769 11:94118971-94118993 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
1087265054 11:96051500-96051522 GGCATGCAGAAGCTGCCTCAAGG + Intronic
1087459245 11:98424280-98424302 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
1087777475 11:102269386-102269408 GGAAAGGTGAAGCTGGATCATGG + Intergenic
1088492301 11:110400182-110400204 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
1089843783 11:121442112-121442134 GTATAGCAGAATCTGGTGCAAGG - Intergenic
1091807151 12:3365034-3365056 GGAAAGCAGCAGCTGGAGTCTGG - Intergenic
1092864114 12:12744892-12744914 GGAAAGCAGATCGTGGCACAGGG - Intronic
1092912727 12:13162223-13162245 GGAAAGCACAAGATAGCCCAGGG + Intergenic
1094169232 12:27474586-27474608 GGAAAGCTGAGGCAGGGGCATGG - Intronic
1094199375 12:27780677-27780699 GGACAGCAGCAGCTGCAGCAGGG - Exonic
1094338370 12:29385052-29385074 GAAAAGCAGAAGCTGGTTCTAGG + Intergenic
1096345658 12:50843899-50843921 CCGAAGCACAAGCTGGCGCATGG + Exonic
1096352445 12:50911594-50911616 TGAAAGCAGAAGCTGGTTCTAGG + Intergenic
1096783374 12:54003549-54003571 GGAAAGCACAAGCTGGGCCTGGG - Intronic
1099414990 12:82373750-82373772 GAAAAGCAGAAGCTGGTTCCAGG + Intronic
1099988589 12:89698470-89698492 GGAAAGGAGGAGCTGGGGTAGGG + Intronic
1100051006 12:90447585-90447607 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
1100318309 12:93465995-93466017 GTAAAGCAGAAGCGGTCGCCTGG - Intergenic
1101071941 12:101084847-101084869 GGAAAGGACAAGCTTGCCCAAGG + Intronic
1102184223 12:110935077-110935099 TCAAAGCAGAAGCTGGGGCGGGG + Intergenic
1104309449 12:127641455-127641477 GGAAAGCAAGACCTGGCTCAGGG + Intergenic
1106789406 13:33139399-33139421 GGATAGCAAAAGCTGACACAGGG - Intronic
1109424073 13:62149681-62149703 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
1110637620 13:77784386-77784408 GGAAAGGAGAAGCTGCGGGATGG + Intergenic
1112353574 13:98656223-98656245 GGGAGGCTGAAGCTGGAGCATGG - Intergenic
1112810257 13:103210034-103210056 AGAAAGATGAAGATGGCGCAGGG + Intergenic
1114516225 14:23301864-23301886 GGAAAGAAGAAGCGGGAGGAGGG + Intronic
1114571801 14:23674560-23674582 GTAAAGCAGATGCTGAGGCAAGG - Intergenic
1114621933 14:24101319-24101341 GGCGGGCAGAAGCTGGCGGATGG + Intronic
1117216304 14:53556206-53556228 GGAAAGCAGGAACTGGGCCAAGG + Intergenic
1119562998 14:75605810-75605832 GGGACACAGAAGCTGGAGCAAGG + Intronic
1120198546 14:81513791-81513813 GGAAAGCGGAAGCTGGTTCCAGG - Intronic
1121087069 14:91154876-91154898 GGAAAGCAGCGGCTGGCTCATGG - Intronic
1124050192 15:26189993-26190015 TGAAAGCAGAAGATGATGCAAGG - Intergenic
1124683429 15:31757125-31757147 GAAAAGCAGGAGCTGGGGTATGG - Intronic
1125370656 15:38972754-38972776 GGAAAAGAGAAGCTGGCAAATGG + Intergenic
1125414850 15:39441945-39441967 GGAACGCGTAAGCTGGCGTATGG + Intergenic
1125600859 15:40915212-40915234 GGAAAACAAAATCTAGCGCAGGG + Intergenic
1128452462 15:67813640-67813662 GGAAGGCAGGAGCTGGCTCAGGG + Intergenic
1132314879 15:100882077-100882099 GGAGAGCAGACGGTGGAGCATGG + Intronic
1132534666 16:472139-472161 CGAAAGCTGAGGCTGGCACAGGG + Intronic
1134624020 16:15711150-15711172 GGAAGAGAGCAGCTGGCGCAGGG - Intronic
1136022276 16:27447829-27447851 GGAAAGCAGGAGATGGCTCAGGG + Intronic
1138345773 16:56319378-56319400 TGACAGGAGAAGCTGGTGCAGGG + Intronic
1138520225 16:57566813-57566835 GCAAGGCAAAAGCTGGTGCAAGG + Intronic
1140450963 16:75070458-75070480 GGAAAGCAGGATCGGGGGCAAGG - Intronic
1141165572 16:81658709-81658731 GGAAATGAGAAGCAGGCGGATGG + Intronic
1141389883 16:83655638-83655660 GTAAAGTAGAAGCTGTTGCAGGG + Intronic
1141423318 16:83930957-83930979 CGCAAGCAGGTGCTGGCGCAGGG - Intronic
1143057136 17:4170864-4170886 GGAAAACAAAAGCACGCGCAGGG + Intronic
1144171541 17:12664136-12664158 GGGAAGCAGAAGGTGGGGAAGGG + Intergenic
1144713170 17:17416221-17416243 TGAAAGAAGAAGGTGGCGCAAGG - Intergenic
1145796587 17:27659010-27659032 GGCAGGAAGAAGGTGGCGCATGG + Intergenic
1145811022 17:27764287-27764309 GGCAGGAAGAAGGTGGCGCATGG + Intronic
1147581403 17:41629249-41629271 GGACAGCAGAAGCTCACCCAAGG + Intergenic
1147972919 17:44229447-44229469 GGCAAGCAGAAGGTGGTGCTAGG - Intergenic
1148163522 17:45465865-45465887 GCAAAGCAGAAGCTAGACCATGG + Intronic
1148521087 17:48275657-48275679 GCAAAGCAGAAGCTGAGTCAAGG + Intronic
1149541750 17:57472801-57472823 GGAAAGCAGAACTTGCTGCAGGG - Intronic
1150297057 17:64016797-64016819 CCAAAGCAGAGGCTGGAGCAAGG - Intronic
1150394749 17:64812517-64812539 GCAAAGCAGAAGCTAGACCATGG + Intergenic
1152392374 17:80010439-80010461 GATGAGGAGAAGCTGGCGCAGGG - Exonic
1155549982 18:26954478-26954500 GGAAAGAAGCAGATGGTGCAAGG - Intronic
1158366295 18:56740841-56740863 AGAAAACAGAAGCTGACACAGGG - Intronic
1160061404 18:75532148-75532170 GGAGATGAGAAGCTGGCCCATGG - Intergenic
1160091790 18:75834006-75834028 CGGAAGCAGAAGCTGCCCCAAGG - Intergenic
1162139408 19:8577039-8577061 GGAAGACAGAAGGTGGCCCAGGG - Intronic
1163587719 19:18173154-18173176 GGAAAGCAGAAGCTGGCGCAGGG - Intronic
1163807686 19:19409858-19409880 GGAAAGCACAAGGTGGGGGAGGG - Intronic
1164993223 19:32699472-32699494 GAAAAGCAGAAGCTGGTTCCAGG + Intronic
1165846852 19:38823593-38823615 GAAAAGCAGAAGCTGGTTCTAGG - Intronic
1165962511 19:39547152-39547174 GCAAGGCAGAAGCTGATGCAGGG - Intergenic
1167299858 19:48672178-48672200 GGAAGGCAGGAGCTGGGACAGGG + Intronic
1167334103 19:48874072-48874094 GGAAAGGAGAAGCTGCCCCAGGG + Exonic
1167492052 19:49798711-49798733 GGAAGACAGGAGCTGGGGCATGG + Intronic
1167642340 19:50688692-50688714 GGAAAGCAGAGGCTGGCTGGGGG + Intronic
1168663121 19:58183100-58183122 GCAGAGCAGAAGCTGGAGAAAGG - Exonic
926092844 2:10061648-10061670 GGAGAGCAGGGACTGGCGCAAGG + Intronic
927163290 2:20291165-20291187 GGAAGGCACAAGCTGTGGCAGGG + Intronic
927554329 2:24021758-24021780 GGGAAGCAGAAGCTGGGGGCAGG + Intronic
928457055 2:31431834-31431856 TGAAAGCAGAAGTTGGAGCTTGG + Intergenic
929241061 2:39653975-39653997 GGAAAGTACAAGGTGGGGCAGGG - Intergenic
930038243 2:47101279-47101301 GAAAAGCAGAAGCTGGTTCTAGG - Intronic
930631243 2:53757322-53757344 TGAAAGCAGAAGCTGGTTCCAGG - Intronic
933525687 2:83435652-83435674 GGAAAGAAAAAGCTGGAGCATGG - Intergenic
934501983 2:94869277-94869299 AGAAAGCAGGAGGTGGGGCATGG - Intergenic
934672326 2:96222572-96222594 TGAAAGCAGAAGCTGGTTCCAGG + Intergenic
935748454 2:106209934-106209956 TGAAAGCAGAAGCTGGTTCCAGG - Intergenic
939032326 2:137091928-137091950 GTAAAGCAGAGGCTGGGGGAGGG - Intronic
941316855 2:164004088-164004110 GGAAAACAAAAGCTGGCAAAAGG + Intergenic
941433584 2:165440474-165440496 GGAAATCACAAGCTGGCACAAGG - Intergenic
943103328 2:183512227-183512249 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
946207616 2:218121240-218121262 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
947935087 2:233997671-233997693 GGAAACCAGAGGCTGGGGTAGGG - Intronic
948303557 2:236928915-236928937 GGAATGGAGAAGCAGGAGCATGG - Intergenic
948762532 2:240201063-240201085 GGGAAGGGGAAGATGGCGCAAGG - Intergenic
1169066459 20:2696834-2696856 GGAGAGCAGATGCTGGCCTATGG - Intronic
1169647877 20:7833842-7833864 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
1172031211 20:31983540-31983562 AGGAAGCAGGAGCTGGAGCATGG + Intronic
1172258527 20:33540679-33540701 GGAAACCAGAAGATGATGCAAGG + Intronic
1173406894 20:42774213-42774235 GGAAAGTAAAAGATGGGGCAAGG - Intronic
1174045591 20:47730311-47730333 GGATGGCAGAAGCTGGGGCTGGG + Intronic
1174334120 20:49845653-49845675 GGGAAGGAGAAGCTGGACCAGGG - Intronic
1174399879 20:50270244-50270266 AGAACGCAGCAGCTGGCGCCGGG + Intergenic
1176082765 20:63282237-63282259 GGGAACCAGAAGCTGACGCTCGG - Intronic
1177134824 21:17297585-17297607 GGAAAGCAGAAGCTGGTTCCAGG - Intergenic
1177406589 21:20675940-20675962 GGAAAGCAGAAGCAGGAGTAAGG - Intergenic
1177883183 21:26718377-26718399 GCAAAGCAGGAGCAGGCACATGG + Intergenic
1179272354 21:39861300-39861322 GGAAAGCAGACCTTGGCACAGGG - Intergenic
1179978810 21:44885822-44885844 GGAAAACAGAACCTGCCCCATGG + Intergenic
1180746397 22:18092054-18092076 GGAAAGCAGACGACGGCACAGGG - Exonic
1180746407 22:18092094-18092116 GGAAAGCAGAGGACGGCACAGGG - Exonic
1181958431 22:26605180-26605202 GGAAAGCAGAAGCAGGAACTGGG - Intronic
1183019548 22:35016228-35016250 GGATAGCAGAAGCTGTAGGAGGG + Intergenic
1183222228 22:36522836-36522858 AAAAAGCAGAAGCGGGAGCAGGG - Intronic
1183384599 22:37507781-37507803 GGGAAGCAGCAACTGGCCCAGGG + Intronic
1183538201 22:38415330-38415352 GGAAAGCAGAAGTTCTCCCAGGG - Intergenic
1183769933 22:39915396-39915418 AGAAAGCAGAAGGTGGAGCAAGG - Intronic
1184331983 22:43833203-43833225 AGAAAGCAGGAGCTGGGGGAGGG - Intronic
1184762066 22:46550434-46550456 GGGAGGCAGAACCTGCCGCATGG - Intergenic
1184984503 22:48120346-48120368 GGAAAGCAAAAGATGGAGCTGGG - Intergenic
1185322737 22:50209379-50209401 CGTCAGCAGAAGCTGGCGCCAGG + Intronic
949449235 3:4166829-4166851 GAAAAGCAGAAGCTGGTTCCAGG + Intronic
949932705 3:9091736-9091758 TGAAAGCAGAGGTTGGCGCCGGG - Intronic
949941730 3:9159882-9159904 GGAAAGCAGAAGATGGAAGAAGG + Intronic
950534513 3:13571320-13571342 AGAGGGCAGAAGCTGGGGCAAGG + Exonic
950872397 3:16241008-16241030 GGTAAGAAGAAGCTGGCAAACGG - Intergenic
950882720 3:16336144-16336166 GGAAGGCAGATGCTGGAACACGG + Intronic
954072625 3:48154058-48154080 TCATAGCAGAAGCTGGGGCATGG - Intergenic
954232524 3:49228288-49228310 GAAAAGCAGAAGCTGGTTCCAGG + Intronic
954715409 3:52524369-52524391 TGAAAGCAGAAGCATGCACAGGG + Exonic
954718602 3:52539981-52540003 GCAAAGCAGCAGCTGGAACAAGG + Intronic
956176637 3:66479058-66479080 GGAGACCAGAAGCTGGGGGAAGG - Intronic
958576051 3:95950762-95950784 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
959051710 3:101530661-101530683 GGAAACTGGAAGCTTGCGCAGGG - Intergenic
960058329 3:113292903-113292925 GGACAGAAGAGGCTGGTGCATGG + Intronic
960881917 3:122354041-122354063 AGAAAGCAGAAGCTGTAACAAGG - Intergenic
961590424 3:127975560-127975582 GGTAAGAAGAAGCTGGTGCAAGG - Intronic
964946748 3:162234323-162234345 GTAAAGAAGATGCTGGCACAAGG + Intergenic
965062476 3:163802363-163802385 GAAAAGCAGAAGCTGGTTCTAGG - Intergenic
967485909 3:190030330-190030352 GGGAAGCTGAGGCTGGCACATGG + Intronic
967879257 3:194287694-194287716 GCAAAGCATAAGCTTGGGCAGGG - Intergenic
969858139 4:10016269-10016291 GGAAACCAGAAGCCCGCCCAGGG + Intronic
969934460 4:10667036-10667058 GAAAAGCAGAATCTGACTCAGGG - Intronic
969987657 4:11228034-11228056 GGAGAGCAGCACCTGGCCCAAGG + Intergenic
973539450 4:51921717-51921739 GGAAAGCAGAAGATGGACCCTGG + Intergenic
974520056 4:62971999-62972021 TGAAAGCAGAAGCTGGTTCCAGG - Intergenic
979703591 4:123694683-123694705 GCAAAGGAGAAGCAGGCACAGGG + Intergenic
980259628 4:130432038-130432060 GCAATGCAGAAGCAGGCACAAGG + Intergenic
982877021 4:160663057-160663079 GGAAAGCAGAAGCTGGTTCCCGG - Intergenic
985301601 4:188496117-188496139 GGAAAGGAGAAGCTGTGGCCGGG - Intergenic
985615534 5:918314-918336 GGAAAGCAGAGCCTGGCTCTGGG + Intronic
985825042 5:2185465-2185487 GGGCAGTAGAAGCTGGCGGAGGG + Intergenic
985943243 5:3155710-3155732 GGAAAGCTGAGGCAAGCGCAGGG + Intergenic
985950948 5:3220918-3220940 GGAAAGGAGATGCTCGCGCCAGG - Intergenic
987922255 5:24298006-24298028 GGAAGGCAAAAGCTGGGTCATGG + Intergenic
987929613 5:24387817-24387839 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
990116459 5:52398008-52398030 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
997228968 5:132228923-132228945 GGAAAGCAGGAGCACGCACACGG + Intronic
997520711 5:134523299-134523321 GTAAAGCAGCAACTGGCACAGGG - Intergenic
998041525 5:138953638-138953660 GGCAGGCAGGCGCTGGCGCAGGG + Intronic
998059217 5:139105860-139105882 AGAAGGCAGAAGCCGGCACAAGG + Intronic
998991573 5:147823197-147823219 GGAAAGGAGAAGGAGGGGCAGGG - Intergenic
1000084951 5:157880711-157880733 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
1000230068 5:159307579-159307601 GGAAAGGAGAAGCAAGTGCAAGG - Intergenic
1000874562 5:166619990-166620012 TGATAGCAGAAGCTGCTGCATGG + Intergenic
1001016230 5:168143738-168143760 TGAAAGGAGAAGGTGGGGCAAGG + Intronic
1002081110 5:176737960-176737982 AGCAAGCAGATGCTGGCTCACGG + Intergenic
1002394226 5:178940874-178940896 GAAAAGCTGAAGATGGGGCAAGG - Intergenic
1003802181 6:9682383-9682405 GGAAAGCAGAAGATGGAGGCTGG + Intronic
1004531098 6:16456477-16456499 GAAAAGCAGAAGCTGGTTCCAGG - Intronic
1005886548 6:30101905-30101927 GGAAAACAGAAGCTGGAAAAAGG + Intergenic
1006354149 6:33544012-33544034 GGAGAGCAGAAGCTGGCTGGTGG - Intergenic
1006910477 6:37560242-37560264 AGGAGGCAGAAGCTGGGGCAGGG + Intergenic
1007029743 6:38617179-38617201 GAAAAGCAGAAGCTGGTTCCAGG - Intronic
1007385285 6:41516402-41516424 GGAGAGCAGAAACAGGGGCAGGG - Intergenic
1007431297 6:41779032-41779054 GGAAGGAAGAAGCAGGCTCAGGG + Intronic
1009872498 6:69468935-69468957 GAAAAGCAGAAGCTGGTTCTAGG - Intergenic
1010955777 6:82089319-82089341 AGAAAGCAGAAGGTGGAGCAGGG - Intergenic
1011436989 6:87348878-87348900 CGAAAGCAGAAGCTGAAGTATGG + Exonic
1011663927 6:89617255-89617277 GGACTGCTGAAGCTGGCACAAGG + Intronic
1013435826 6:110105491-110105513 GAATGGCAGAAGCTGGCCCAAGG - Exonic
1016183739 6:141176875-141176897 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
1016746031 6:147581420-147581442 GGAAAGGATAAGATGGCCCAGGG + Intronic
1017254449 6:152317274-152317296 GGAATGCAGCAGCTGGATCATGG + Intronic
1018423651 6:163661663-163661685 AGAAAGCACAGGCTGGCCCAGGG - Intergenic
1018793815 6:167170830-167170852 GGAAAGAAGAAGCTTTCTCAGGG + Intronic
1018822521 6:167384251-167384273 GGAAAGAAGAAGCTTTCTCAGGG - Intronic
1019477892 7:1252737-1252759 GGAAAGGAGCAGGTGGGGCAGGG + Intergenic
1019853876 7:3585139-3585161 GGAAAGCAGAGGCTGAGGCAAGG - Intronic
1023078226 7:36503962-36503984 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
1023151331 7:37203891-37203913 GAAAAGCAGAAGCTGGTTCCAGG + Intronic
1023439676 7:40172756-40172778 TGAAAGCAGAAGCTGGTTCCAGG + Intronic
1024001018 7:45189435-45189457 GGGAAGCGGAGGCTGGCCCAGGG - Intergenic
1024094482 7:45973074-45973096 GGAAGACAGAAGCTGGGACAGGG + Intergenic
1024735000 7:52295603-52295625 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
1026349440 7:69502974-69502996 GGAAAGCAGAACCTGAGACAAGG + Intergenic
1027428216 7:78083009-78083031 GGACAGCAGGAGGTGGGGCAAGG + Intronic
1027790834 7:82637798-82637820 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
1029464510 7:100716771-100716793 GGAGAGCAGAGGCTGGGGAAGGG + Intergenic
1029940928 7:104479789-104479811 GGAAAACAGATGCTAGAGCAGGG - Intronic
1030420229 7:109299911-109299933 GAAAAGCAGAAGCTGGTTCTAGG - Intergenic
1030567823 7:111182353-111182375 GAAGAGCAGAAGCTGTCCCAAGG + Intronic
1034747201 7:153533592-153533614 GGTAATCAGAAGCTCCCGCATGG + Intergenic
1034875285 7:154719982-154720004 GGGAAGCAGATGCAGGAGCATGG - Intronic
1036070675 8:5438498-5438520 GGACAGCAGCAGCTGCTGCACGG + Intergenic
1037570696 8:20155444-20155466 TGAAAGCAGAAGCTGGTTCCAGG - Intronic
1038231625 8:25705937-25705959 GGGAAGCAAAAGCAGGCTCATGG - Intergenic
1038297563 8:26309535-26309557 GGAAAGGAGAAGCTGATGCCTGG - Intronic
1038638503 8:29305763-29305785 GAAAAGCAGAAGCTGGTTCTAGG - Intergenic
1039999987 8:42567532-42567554 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
1040526900 8:48233670-48233692 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
1040953107 8:52955429-52955451 GAAAAGCAGAAGCTGGTTCTAGG - Intergenic
1040971747 8:53142810-53142832 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
1041000207 8:53442155-53442177 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
1041001618 8:53460292-53460314 GGAAAGCGGAAGCTGGTTCCAGG - Intergenic
1041033027 8:53757297-53757319 GGGTAGCAGAAGCCGGGGCAGGG - Intronic
1041107121 8:54454471-54454493 GGAAAGCAGGGGCTGGAGGAAGG - Intergenic
1042951384 8:74203878-74203900 TAAAAGCAGAACCTGGGGCAGGG + Intergenic
1044616692 8:94149671-94149693 GGGAAGCAGAAGGTGGCAAAAGG + Intronic
1047444302 8:124905896-124905918 TGAAAGCAGAAGCTGGTTCCAGG + Intergenic
1048095221 8:131284855-131284877 GGAAAGCAGAAAAGGGCACAAGG - Intergenic
1048330964 8:133470627-133470649 TGGAAGCAGAGGCTGGGGCACGG + Intronic
1049028431 8:140013933-140013955 GGAAATCAGATACAGGCGCATGG + Intronic
1052058071 9:23925166-23925188 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
1053532630 9:38897355-38897377 GGAAAGCGGAAGCTGGTTCCAGG + Intergenic
1054154361 9:61629697-61629719 GGATAGCAGCAGATGCCGCAGGG - Intergenic
1054204853 9:62121776-62121798 GGAAAGCGGAAGCTGGTTCCAGG + Intergenic
1054633505 9:67466582-67466604 GGAAAGCGGAAGCTGGTTCCAGG - Intergenic
1056168685 9:83962183-83962205 TGAAAACAGAATCTGGGGCAGGG + Intergenic
1056532295 9:87498145-87498167 GGAAAGCAAAAGCTGGCGCCGGG - Intronic
1059165692 9:112074433-112074455 GGAAAGCAGGGGCTGGCGAGGGG - Intronic
1059998846 9:119939932-119939954 TGAAAGCTGAAGCTGGCAAAGGG + Intergenic
1061872939 9:133530283-133530305 GGAAAGGAGAAGCTGAGTCAGGG + Intergenic
1061920330 9:133779003-133779025 GGAAGGGAGATGCAGGCGCAAGG - Intronic
1061923652 9:133795533-133795555 GGACAGCAGGAGTTGGGGCAGGG - Intronic
1185508537 X:645859-645881 GGAACGCAGAAGATGGAGTAGGG - Exonic
1186399693 X:9246139-9246161 GGAAAGGAGATGCAGGAGCAAGG + Intergenic
1186778476 X:12889539-12889561 GGAACCCAGAAGCAGGCCCAAGG - Exonic
1187200236 X:17127630-17127652 GGAGAGCTGAAGCTGGAGAAGGG - Intronic
1187237161 X:17478143-17478165 GGAAAGAAGAAGCTGGCCAAAGG - Intronic
1188296156 X:28451669-28451691 GCAAAGCAGAGGCTGAGGCAAGG - Intergenic
1191167388 X:57404953-57404975 TGAAAGCAGAAGCTGGTTCCAGG + Intronic
1193172278 X:78349762-78349784 TGAAAGCAGAAGCTGGTTCCAGG + Intergenic
1193257442 X:79366937-79366959 GGTAAGCAGAAGGTGCCGCAAGG + Intronic
1196744312 X:119055834-119055856 GGAAAGCAGCAGCAGCAGCAAGG + Intergenic
1196886594 X:120251422-120251444 GGAAAGTAGAAGGTGGCGAACGG - Intronic
1197034139 X:121854127-121854149 GGAAAGCTGTAGCTGGAGGAGGG - Intergenic
1198994051 X:142553124-142553146 GGAATGAAGAAGCTGGAGTATGG + Intergenic
1199932419 X:152537220-152537242 GAAAAGCAGCAGCTGGTTCATGG + Intergenic
1200695229 Y:6352658-6352680 GGAAAGCAGAAGCTGGTTGCAGG + Intergenic
1200775953 Y:7170575-7170597 GTAAAGCAGAAGCTGGTTCCAGG - Intergenic
1200801274 Y:7389073-7389095 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
1201040048 Y:9822052-9822074 GGAAAGCAGAAGCTGGTTGCAGG - Intergenic
1201530305 Y:14984248-14984270 GAAAAGCAGAAGCTGGTTCCAGG - Intergenic
1201568848 Y:15393032-15393054 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic
1201724249 Y:17136107-17136129 TGAAAGCAGAAGCTGGTTCCAGG + Intergenic
1202146966 Y:21808223-21808245 GAAAAGCAGAAGCTGGTTCCAGG + Intergenic