ID: 1163587720

View in Genome Browser
Species Human (GRCh38)
Location 19:18173155-18173177
Sequence CGGAAAGCAGAAGCTGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163587720_1163587732 27 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587732 19:18173205-18173227 TCCCACGGGACCACGGTGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 79
1163587720_1163587730 25 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587730 19:18173203-18173225 AGTCCCACGGGACCACGGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 70
1163587720_1163587731 26 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1163587720_1163587726 12 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587726 19:18173190-18173212 TCAAGCCTGAGTCAGTCCCACGG 0: 1
1: 0
2: 2
3: 10
4: 143
1163587720_1163587729 20 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587729 19:18173198-18173220 GAGTCAGTCCCACGGGACCACGG 0: 1
1: 0
2: 0
3: 2
4: 101
1163587720_1163587727 13 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587727 19:18173191-18173213 CAAGCCTGAGTCAGTCCCACGGG 0: 1
1: 0
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163587720 Original CRISPR CGGAAAGCAGAAGCTGGCGC AGG (reversed) Intronic