ID: 1163587720

View in Genome Browser
Species Human (GRCh38)
Location 19:18173155-18173177
Sequence CGGAAAGCAGAAGCTGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163587720_1163587730 25 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587730 19:18173203-18173225 AGTCCCACGGGACCACGGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 70
1163587720_1163587727 13 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587727 19:18173191-18173213 CAAGCCTGAGTCAGTCCCACGGG 0: 1
1: 0
2: 0
3: 16
4: 168
1163587720_1163587732 27 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587732 19:18173205-18173227 TCCCACGGGACCACGGTGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 79
1163587720_1163587729 20 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587729 19:18173198-18173220 GAGTCAGTCCCACGGGACCACGG 0: 1
1: 0
2: 0
3: 2
4: 101
1163587720_1163587731 26 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1163587720_1163587726 12 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587726 19:18173190-18173212 TCAAGCCTGAGTCAGTCCCACGG 0: 1
1: 0
2: 2
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163587720 Original CRISPR CGGAAAGCAGAAGCTGGCGC AGG (reversed) Intronic
900014490 1:138721-138743 CGGGAAGCAGAAGGTGGGCCTGG + Intergenic
900044355 1:493923-493945 CGGGAAGCAGAAGGTGGGCCTGG + Intergenic
900065762 1:728829-728851 CGGGAAGCAGAAGGTGGGCCTGG + Intergenic
900110864 1:1005020-1005042 CGGACAGCAGAGGCGGGAGCTGG - Intergenic
900323935 1:2098428-2098450 CGAAGAGCTGAAGCTGGGGCCGG - Intronic
900554237 1:3271800-3271822 CGGAAAGCAGCAGCAGGCCGCGG + Intronic
900724090 1:4203698-4203720 AGGAAAGCAGAAGATGGCAGAGG + Intergenic
901467753 1:9433604-9433626 AGGAAAGAAGTAGCTGGAGCAGG + Intergenic
903296793 1:22348863-22348885 TGGAAAGCAGAATCTGGGACGGG - Intergenic
904037003 1:27564324-27564346 CAGAAAGAAGAAGCTGAAGCTGG + Intronic
904045081 1:27603888-27603910 CAGAAAGCAGACGCTGGCTTTGG + Intronic
904600207 1:31668781-31668803 CGGTAAGAAGAAGCTGGCAGGGG - Exonic
907426165 1:54380563-54380585 CAGGAAGCCGAAGCTGGCCCTGG - Intronic
907910909 1:58825201-58825223 CAGAAAGCAGCAGGTGGGGCGGG - Intergenic
910173770 1:84406198-84406220 TGGAAAGCAGAAGCAGCTGCAGG - Intronic
912255095 1:108050304-108050326 TGGAAAGCAGAAGCCTGCTCTGG + Intergenic
915561485 1:156690714-156690736 CGGGCAGCAGAGGCTGGCGGTGG + Intergenic
920218484 1:204378092-204378114 CGGAGAGCAGAAGCTGGAGCGGG + Intergenic
920695952 1:208181406-208181428 GGGAAAGCAAAAGCTGTCACTGG - Intronic
921317137 1:213903190-213903212 TGGAAGGCAGGAGCTGGGGCTGG + Intergenic
922100887 1:222476178-222476200 CGGGAAGCAGAAGGTGGGCCTGG + Intergenic
922733732 1:227968494-227968516 CGGGAAGCAGAAGGTGGGCCTGG - Intergenic
922734152 1:227970651-227970673 CGGGAGGCAGGAGCTGGCCCTGG - Intergenic
924343810 1:243056295-243056317 CGGGAAGCAGAAGGTGGGCCTGG + Intergenic
1064609252 10:17080019-17080041 AGGAGAGCAGAAGCTGAGGCAGG - Intronic
1065660326 10:27999092-27999114 CGGAAAGCAGCAGGTGGCCGGGG - Intergenic
1067015669 10:42755070-42755092 CGGGAAGCAGAGGCCGCCGCCGG - Intergenic
1068417544 10:56743828-56743850 CGGAAAGCAGGAGATGAAGCTGG - Intergenic
1069667736 10:70174880-70174902 GGGAAAGCAGATGCTGGCAAGGG - Intergenic
1069686464 10:70322251-70322273 GGGGAAGCCAAAGCTGGCGCTGG + Intronic
1070678208 10:78429782-78429804 AGGGAAGCAGAAGCTGGAACAGG + Intergenic
1072880443 10:99221798-99221820 CGGAGAGAAGAAGCTGGCCAAGG + Intronic
1075292522 10:121242572-121242594 AGTAAAACAGAAGCTGGGGCCGG - Intergenic
1076682540 10:132181171-132181193 TGGAGAGCAGCAGCTGGCTCTGG + Intronic
1076970687 11:130398-130420 CGGGAAGCAGAAGGTGGGCCTGG + Intergenic
1077232066 11:1462230-1462252 GGGAACACAGAAGCTGGAGCTGG - Intronic
1077259104 11:1606251-1606273 GGGAAGGCAGGAGCTGGCGGAGG - Intergenic
1079333979 11:19555193-19555215 GGGGAAGCAGAAGCTGGCAGAGG + Intronic
1079425762 11:20341055-20341077 AGGAAAGCAGTAGCTGTCTCTGG - Intergenic
1082260253 11:50072606-50072628 CGGGAGGCAGGAGCTGGCCCTGG + Intergenic
1084184576 11:67464828-67464850 CGGCACGAAGAAGATGGCGCTGG + Exonic
1084532316 11:69734861-69734883 GAGATAGCAGAAGCTGGCACAGG + Intergenic
1084544804 11:69809846-69809868 CTTAAAGCAGCAGCTGACGCAGG + Intergenic
1084658430 11:70533059-70533081 CGGAAAGCAGACGTTGCCGGAGG + Intronic
1084800453 11:71540014-71540036 GGGAAGGCAGGAGCTGGCGGAGG + Intronic
1086891177 11:92259902-92259924 TGGAAAGCAGAAGATGTGGCTGG + Intergenic
1086897757 11:92333426-92333448 AGTAAAGCAGCAGCTGGCCCCGG + Intergenic
1089104274 11:115989290-115989312 CGGAAAACAGAAGCTGCACCAGG - Intergenic
1091681217 12:2528534-2528556 CGGAAGGCAGATGGTGGGGCTGG - Intronic
1094121552 12:26980015-26980037 CAGAAAGCTGAAGCTGGCACTGG - Intronic
1096004436 12:48157508-48157530 CCGGAAGCAGAAGCTGTCGGGGG + Exonic
1096783375 12:54003550-54003572 GGGAAAGCACAAGCTGGGCCTGG - Intronic
1097242230 12:57583410-57583432 CGGAAAGCAAAAGGGGGCACGGG - Intronic
1102058666 12:109915628-109915650 CGGAGAGCAGACCCCGGCGCGGG - Intronic
1102184222 12:110935076-110935098 TTCAAAGCAGAAGCTGGGGCGGG + Intergenic
1102759605 12:115374237-115374259 CAGAAAACAGAAGCTGACCCAGG + Intergenic
1105349341 13:19601889-19601911 CGGGAAGCGGAAGTGGGCGCGGG - Intergenic
1111869665 13:93814837-93814859 CTGAATGCAGCAGTTGGCGCTGG + Intronic
1113590376 13:111494832-111494854 CTGAGAGCAGAAGCTGTGGCGGG - Intergenic
1113778411 13:112961944-112961966 TGCAACGGAGAAGCTGGCGCAGG - Intronic
1114061107 14:19016384-19016406 AGGAAAGGAGCAGCTGGCTCTGG + Intergenic
1114069769 14:19097706-19097728 CGGGAAGCAGAGGCCGCCGCCGG + Intergenic
1114092493 14:19302297-19302319 CGGGAAGCAGAGGCCGCCGCCGG - Intergenic
1114101149 14:19383595-19383617 AGGAAAGGAGCAGCTGGCTCTGG - Intergenic
1122747278 14:103906034-103906056 GAGAAAGCGGCAGCTGGCGCTGG - Intergenic
1123903870 15:24903183-24903205 CTGAAAGCATATGCTGGGGCTGG + Intronic
1128452461 15:67813639-67813661 AGGAAGGCAGGAGCTGGCTCAGG + Intergenic
1128942842 15:71802471-71802493 CAGAAAGCCGAAGCCGCCGCAGG + Intronic
1131986944 15:98052145-98052167 AGGAAAGCAGAAGCTAGGGAAGG + Intergenic
1133650883 16:7813758-7813780 CTGAAATCAGAAGCTTGGGCTGG + Intergenic
1136022275 16:27447828-27447850 GGGAAAGCAGGAGATGGCTCAGG + Intronic
1136682573 16:31976658-31976680 GGGAAGGCAGGAGCTGGAGCAGG - Intergenic
1136782833 16:32917826-32917848 GGGAAGGCAGGAGCTGGAGCAGG - Intergenic
1137754307 16:50889342-50889364 AGGCAAGCAGGAGCTGGAGCCGG + Intergenic
1138039177 16:53643471-53643493 CGGAAAGTAAAAGCTGAGGCAGG + Intronic
1141006790 16:80360029-80360051 GGGGATGCAGAAGCTGGCACTGG + Intergenic
1142030801 16:87837592-87837614 CGGGAGGCAGAAGCTGACCCGGG - Intronic
1142449563 16:90167085-90167107 CGGGAAGCAGAAGGTGGGCCTGG - Intergenic
1203085481 16_KI270728v1_random:1181810-1181832 GGGAAGGCAGGAGCTGGAGCAGG - Intergenic
1142457528 17:64761-64783 CGGGAAGCAGAAGGTGGGCCTGG + Intergenic
1143420816 17:6790618-6790640 CAGAAAGAAAAAGCTGGCTCAGG + Intronic
1144994794 17:19260134-19260156 AGGAAAGCAGAAGCTGAGGAAGG + Intronic
1147143096 17:38469998-38470020 AGGAAGGCAGGAGCTGGAGCAGG - Intronic
1147388928 17:40097609-40097631 CTGAAAGCAGAAGCTGAAGGTGG - Intronic
1149248864 17:54744605-54744627 AGGAGATCAGAAGCTGGCTCTGG + Intergenic
1151897671 17:76991262-76991284 GGGAAAGCAGGAGCTGGGCCAGG - Intergenic
1153059540 18:981073-981095 GGGAAAGCAGAAGATGGGGAGGG + Intergenic
1160539690 18:79613791-79613813 TGGAAAGCAGGAGCTGGCACTGG + Intergenic
1160891957 19:1383812-1383834 CGGAAACCGGAACCTGGAGCCGG - Exonic
1163587720 19:18173155-18173177 CGGAAAGCAGAAGCTGGCGCAGG - Intronic
1167334102 19:48874071-48874093 GGGAAAGGAGAAGCTGCCCCAGG + Exonic
1167567900 19:50268253-50268275 CCGCAAGCAGGAGCTGGAGCTGG + Exonic
1167642339 19:50688691-50688713 GGGAAAGCAGAGGCTGGCTGGGG + Intronic
925885502 2:8391017-8391039 AGGAATGCACAAGCTGGCTCAGG + Intergenic
927972906 2:27316847-27316869 CAGCGAGCAGATGCTGGCGCAGG + Intronic
927990625 2:27444435-27444457 CTGAAAGGAAAAGCTGGTGCTGG + Exonic
929548761 2:42875674-42875696 CGGAACTCAGGAGCTGGCCCTGG - Intergenic
931299805 2:60967594-60967616 CAGAAAGCAGAGTCTGTCGCTGG - Exonic
931868304 2:66434308-66434330 CGGAAAGCGAAACCCGGCGCGGG - Intronic
936783161 2:116058766-116058788 CTGGAAGCAGAAGCTGGTGAAGG + Intergenic
936973443 2:118196432-118196454 CAGAAGGCAGAAGCTGGATCAGG - Intergenic
937097986 2:119248136-119248158 CGGCAAGCAGAAGCTGTAGAGGG - Exonic
937939747 2:127275854-127275876 GAGAAAGCAGAAGCTGGAGCCGG + Intronic
937991488 2:127664619-127664641 CTGAAAGCTGAGGCTGGCGGGGG + Intronic
939140414 2:138347352-138347374 TGGAAAGTAGAAGTTGGGGCAGG - Intergenic
941568548 2:167140590-167140612 CCGGAAGCAGAAGCCGGTGCTGG - Intronic
942460506 2:176165013-176165035 CTGCTAGCAGAAGCAGGCGCCGG + Intronic
942965870 2:181891941-181891963 CGGGGAGCTGAAGCGGGCGCCGG - Exonic
943537336 2:189168934-189168956 CAGAAAGCAGAAACTGGTGTGGG - Intronic
944647831 2:201797303-201797325 AGGAAGGCAGAAGCAAGCGCGGG + Intronic
945683751 2:212944033-212944055 AGGAGAGCAGAAGCTGCAGCCGG - Intergenic
949009256 2:241669102-241669124 CGGAAAACAAAAGGTGGTGCAGG - Intronic
1168825679 20:811980-812002 GGGAACTCAGAGGCTGGCGCCGG - Intergenic
1170464625 20:16611435-16611457 GGGAAGGCAGCAGCTGGGGCGGG - Intergenic
1173589070 20:44210401-44210423 CGAAAAGGGGAAGCTGCCGCTGG + Intronic
1174045590 20:47730310-47730332 CGGATGGCAGAAGCTGGGGCTGG + Intronic
1174399878 20:50270243-50270265 CAGAACGCAGCAGCTGGCGCCGG + Intergenic
1177996047 21:28099136-28099158 AGGAAAGCAGAAGTTGTCTCCGG + Intergenic
1180479590 22:15738996-15739018 AGGAAAGGAGCAGCTGGCTCTGG + Intergenic
1180488236 22:15820269-15820291 CGGGAAGCAGAGGCCGCCGCCGG + Intergenic
1181958432 22:26605181-26605203 AGGAAAGCAGAAGCAGGAACTGG - Intronic
1182073090 22:27477060-27477082 TGCAAGGCAGAAGCTGGCCCAGG + Intergenic
1183430705 22:37763911-37763933 CGGCCACCAGAAGCTGGAGCAGG - Intronic
1183832617 22:40426401-40426423 AGGAAAGCAGAGGCAGGTGCTGG - Intronic
1184563326 22:45276005-45276027 CAGAAAGCCGAGGCTGGGGCTGG + Intergenic
1184984504 22:48120347-48120369 TGGAAAGCAAAAGATGGAGCTGG - Intergenic
949932706 3:9091737-9091759 TTGAAAGCAGAGGTTGGCGCCGG - Intronic
951448634 3:22811704-22811726 CGGCAAGCAGAATGTGGAGCTGG - Intergenic
954715408 3:52524368-52524390 CTGAAAGCAGAAGCATGCACAGG + Exonic
954819683 3:53315003-53315025 CTGAAAGCAGAAGCTGTCGGGGG + Intronic
961611880 3:128146020-128146042 CGCAAAGGAGAAACTGGAGCAGG + Intronic
970472042 4:16388736-16388758 AGGAAAGCAGAGGCTGGGGGTGG - Intergenic
975974697 4:80081509-80081531 TGGAAGGCAGAAGCTGTCTCAGG + Intronic
979259315 4:118633551-118633573 CGGGAGGCAGGAGCTGGCCCTGG - Intergenic
979329035 4:119407012-119407034 CGGGAGGCAGGAGCTGGCCCTGG + Intergenic
979329448 4:119409164-119409186 CGGGAAGCAGAAGGTGGGCCTGG + Intergenic
981755040 4:148133683-148133705 CAGTAACCAGAAGCTGGCGCAGG + Intronic
982202921 4:152976147-152976169 CGAAGAGCAGAGGCTGCCGCGGG + Exonic
985030890 4:185788103-185788125 AACAAAGCAGCAGCTGGCGCTGG - Intronic
985301602 4:188496118-188496140 AGGAAAGGAGAAGCTGTGGCCGG - Intergenic
985615533 5:918313-918335 TGGAAAGCAGAGCCTGGCTCTGG + Intronic
985980258 5:3456739-3456761 TGGAAGGCAGCAGCTGGCTCAGG + Intergenic
992015668 5:72573011-72573033 CAGAAAGGGGAAGCTGGGGCTGG + Intergenic
996893796 5:128455927-128455949 CAGACAGCAGCAGCTGGAGCTGG - Intronic
997953368 5:138259514-138259536 CGGGAACCAGAGGCTGGGGCTGG - Intronic
998328247 5:141301509-141301531 GGGAGAACGGAAGCTGGCGCAGG + Intergenic
1000781246 5:165484773-165484795 AGGAAAGCAGAGGCAGGAGCTGG - Intergenic
1002729488 5:181325006-181325028 CGGGAAGCAGAAGGTGGGCCTGG - Intergenic
1006910476 6:37560241-37560263 CAGGAGGCAGAAGCTGGGGCAGG + Intergenic
1007595224 6:43046966-43046988 GGGAAAGCTGGAGCTGGCTCAGG - Exonic
1010955778 6:82089320-82089342 CAGAAAGCAGAAGGTGGAGCAGG - Intergenic
1013641521 6:112087468-112087490 GGGAATGCAGAAGCGGCCGCGGG - Exonic
1017937168 6:159015931-159015953 CGGAATCCAGTATCTGGCGCTGG + Intergenic
1019387763 7:768019-768041 CAGCGAGCAGGAGCTGGCGCTGG + Intronic
1019707018 7:2501792-2501814 AGGTAAGCAGAAGCTGGCAGGGG - Intergenic
1023400759 7:39792082-39792104 CGGGAGGCAGGAGCTGGCCCTGG - Intergenic
1024074224 7:45810597-45810619 CGGGAGGCAGGAGCTGGCCCTGG - Intergenic
1024649525 7:51391757-51391779 CGGGAAGCAGAAGGTGGGCCTGG + Intergenic
1025177820 7:56810848-56810870 CGGGAAGCAGGAGCTGTCCCTGG + Intergenic
1025182507 7:56830626-56830648 CGGGAAGCAGAAGGTGGGCCTGG + Intergenic
1025689423 7:63746368-63746390 CGGGAAGCAGAAGGTGGGCCTGG - Intergenic
1025976922 7:66377231-66377253 CGGAAAGCCGAAGGTGGGTCCGG + Intronic
1027189225 7:75988174-75988196 CGGGAAGCAGGAACAGGCGCTGG - Intronic
1029940929 7:104479790-104479812 CGGAAAACAGATGCTAGAGCAGG - Intronic
1030083720 7:105799543-105799565 AGGAAAGCAGAAGTTGGTTCTGG + Intronic
1035297297 7:157874370-157874392 CAGAAAGCAGGAGCTGGGTCAGG - Intronic
1036454071 8:8892953-8892975 CGGTAAGCGTGAGCTGGCGCAGG + Exonic
1036694837 8:10967696-10967718 CTGAATGCAGAGGCTGGCACCGG - Intronic
1038561102 8:28580877-28580899 CTCACAGCAGAAGCTGGTGCTGG - Intergenic
1040552471 8:48449190-48449212 GGGAAAGCACAAGATGGCCCTGG - Intergenic
1042951383 8:74203877-74203899 CTAAAAGCAGAACCTGGGGCAGG + Intergenic
1043271859 8:78343800-78343822 CTGAAAGCAGAAGATAGAGCAGG + Intergenic
1045482154 8:102601140-102601162 CGGAAAGCAGACGGGGGTGCTGG - Intergenic
1046417128 8:113932115-113932137 CGGAAAACAGGAGCTGGAGAGGG + Intergenic
1046712713 8:117529603-117529625 AGGAAATAAGAAGCTGGAGCCGG + Intronic
1048299631 8:133241903-133241925 CAGAAAGCTGAAGCTGGCCAGGG + Intronic
1048941660 8:139405407-139405429 CTGGAAGCAGAAGCGGGCTCAGG + Intergenic
1049536834 8:143186385-143186407 CGGAGTGCAGGAGGTGGCGCCGG - Intergenic
1051527555 9:18063907-18063929 CGGAAATTGGAAGCTGGCTCTGG - Intergenic
1051685751 9:19656819-19656841 CGGAACACAGAAGCTGGGGATGG - Intronic
1053022197 9:34702366-34702388 CTCCGAGCAGAAGCTGGCGCTGG + Intergenic
1056532296 9:87498146-87498168 GGGAAAGCAAAAGCTGGCGCCGG - Intronic
1058495797 9:105558021-105558043 AGGAAAGCCGAGGCTGGGGCTGG + Intergenic
1059165693 9:112074434-112074456 AGGAAAGCAGGGGCTGGCGAGGG - Intronic
1059998845 9:119939931-119939953 CTGAAAGCTGAAGCTGGCAAAGG + Intergenic
1060870683 9:127037611-127037633 AGGAAAGCAGAACCTGGAGGTGG - Intronic
1203577459 Un_KI270745v1:20275-20297 CGGGAAGCAGAAGGTGGGCCTGG - Intergenic
1191103901 X:56760387-56760409 CAGAAAACAGAAACTGGGGCTGG + Intergenic
1197758719 X:130013622-130013644 GGGGGAGCAGAAGCTGGCACAGG - Exonic
1197796658 X:130305479-130305501 CGGGCAGCAGCAGCTGGTGCTGG - Intergenic
1198107097 X:133472364-133472386 GGGAAAGGAGAAGCTTGCTCTGG + Intergenic
1199761566 X:150908260-150908282 CTGACAGCAGAAGCTGGAGGAGG - Intergenic
1200048413 X:153414990-153415012 CGGGAAACAGCAGCTGGGGCCGG + Intergenic