ID: 1163587722

View in Genome Browser
Species Human (GRCh38)
Location 19:18173161-18173183
Sequence CCACGCCGGAAAGCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163587722_1163587727 7 Left 1163587722 19:18173161-18173183 CCAGCTTCTGCTTTCCGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1163587727 19:18173191-18173213 CAAGCCTGAGTCAGTCCCACGGG 0: 1
1: 0
2: 0
3: 16
4: 168
1163587722_1163587726 6 Left 1163587722 19:18173161-18173183 CCAGCTTCTGCTTTCCGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1163587726 19:18173190-18173212 TCAAGCCTGAGTCAGTCCCACGG 0: 1
1: 0
2: 2
3: 10
4: 143
1163587722_1163587731 20 Left 1163587722 19:18173161-18173183 CCAGCTTCTGCTTTCCGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1163587722_1163587735 26 Left 1163587722 19:18173161-18173183 CCAGCTTCTGCTTTCCGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1163587735 19:18173210-18173232 CGGGACCACGGTGAGGGGTCTGG 0: 1
1: 0
2: 2
3: 16
4: 139
1163587722_1163587730 19 Left 1163587722 19:18173161-18173183 CCAGCTTCTGCTTTCCGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1163587730 19:18173203-18173225 AGTCCCACGGGACCACGGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 70
1163587722_1163587732 21 Left 1163587722 19:18173161-18173183 CCAGCTTCTGCTTTCCGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1163587732 19:18173205-18173227 TCCCACGGGACCACGGTGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 79
1163587722_1163587729 14 Left 1163587722 19:18173161-18173183 CCAGCTTCTGCTTTCCGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1163587729 19:18173198-18173220 GAGTCAGTCCCACGGGACCACGG 0: 1
1: 0
2: 0
3: 2
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163587722 Original CRISPR CCACGCCGGAAAGCAGAAGC TGG (reversed) Intronic
900554236 1:3271794-3271816 CCAGCACGGAAAGCAGCAGCAGG + Intronic
900599638 1:3497515-3497537 CCACCCCGGAGGGCAGAGGCAGG + Intronic
901518376 1:9764591-9764613 CCAGGCTGGAATGCAGCAGCGGG - Intronic
901861673 1:12078645-12078667 CCACCCCAGGCAGCAGAAGCTGG + Intronic
902923152 1:19679233-19679255 CCTCGCCAGGAAGCAGCAGCTGG - Exonic
903465716 1:23551452-23551474 CCACTCTGGAAAGAAGAAGAAGG + Intergenic
905644182 1:39613191-39613213 CCAGGCTGGAATGCAGTAGCTGG + Intergenic
909527597 1:76644205-76644227 CCATGGCAGAAGGCAGAAGCAGG + Intergenic
912807285 1:112767237-112767259 CCAGGCTGGAATGCAGAGGCTGG + Intergenic
913088717 1:115461583-115461605 CCACCCCGCAAAGAAGAGGCTGG + Intergenic
914779678 1:150773895-150773917 CCAGGCTGGAGAGCAGAGGCAGG + Intergenic
920492853 1:206431302-206431324 CCATGCAGGAAAACAGAAACAGG + Intronic
923100692 1:230813989-230814011 CCAAAGCAGAAAGCAGAAGCAGG - Intergenic
1066531109 10:36340103-36340125 CCAGGCTGGAATGCAGTAGCCGG - Intergenic
1069784197 10:70977501-70977523 CCACGTGGGGAAGGAGAAGCAGG + Intergenic
1070844417 10:79510237-79510259 TCACCCCAGAAAGGAGAAGCAGG + Intergenic
1070891042 10:79942396-79942418 CCAGGCCCAAAAGGAGAAGCTGG - Exonic
1070929380 10:80250071-80250093 TCACCCCAGAAAGGAGAAGCAGG - Intergenic
1072566370 10:96620033-96620055 AAAAGCTGGAAAGCAGAAGCAGG + Intronic
1076667806 10:132102895-132102917 CCAGGCCGGAGAGGAGATGCAGG + Intergenic
1077627682 11:3787745-3787767 GCACTCCGGGAAGCAGAGGCGGG + Intronic
1081611507 11:44565802-44565824 CCGAGCCGGACCGCAGAAGCGGG - Intronic
1083276600 11:61600455-61600477 CCACGATGGAAAGGAGAAGGTGG - Intergenic
1083843073 11:65315490-65315512 CCAGGCCGGAAAGCACAGGGGGG + Intronic
1089015901 11:115165036-115165058 CAAAGCCGGAAAACAGCAGCAGG + Intergenic
1089496053 11:118909229-118909251 CCAGGCCGGCAGGCAGAAGCAGG + Intronic
1091780462 12:3211040-3211062 CCAGGCTGTAAAGCTGAAGCAGG - Intronic
1091883549 12:3999460-3999482 CCACACAGGAAATCAGAGGCAGG + Intergenic
1091987129 12:4919826-4919848 CCACGCCAGGAAACAAAAGCGGG - Intronic
1092265363 12:6976677-6976699 CCACGCTGGAATGCAGTGGCGGG - Exonic
1098194292 12:67983521-67983543 CCTCACCAGAAAGCAGATGCTGG + Intergenic
1101750825 12:107581260-107581282 CCACGCCGGGCAGCAGCAGCCGG - Exonic
1104913401 12:132251416-132251438 CCTCCCCGGAAAGCGGATGCCGG - Intronic
1105757209 13:23478285-23478307 CCACGCTGGAATGCAGTGGCAGG + Intergenic
1108757126 13:53517108-53517130 CCAAGCTGGAGAGCAGAAGCTGG - Intergenic
1109705599 13:66087395-66087417 CCACACAGGCAAGTAGAAGCCGG - Intergenic
1115652785 14:35415097-35415119 ACTTGCCTGAAAGCAGAAGCTGG - Intergenic
1117163490 14:53011520-53011542 CCACTCTGGAAAGCAGAAATGGG + Intergenic
1121872310 14:97419395-97419417 CCAGGCCGGAATGGAGTAGCAGG - Intergenic
1123753498 15:23377943-23377965 CCACTCTGGGAAGCTGAAGCAGG + Intergenic
1126387347 15:48107724-48107746 CCAGGCAGGCAAGGAGAAGCTGG - Intergenic
1130369705 15:83274572-83274594 CCACGTCAAAAAGCAGATGCTGG - Intronic
1130436391 15:83903872-83903894 CCAGGCTGGAGAGCAGTAGCAGG - Intronic
1130698940 15:86159583-86159605 CCACTCCAGCAAGCAGAGGCAGG - Intronic
1134078632 16:11309461-11309483 CCAGGCTGGAGAGCAGAGGCTGG - Intronic
1134462877 16:14445072-14445094 CCACTCTGGGAAGCTGAAGCAGG - Intronic
1139589710 16:67926812-67926834 CCATGCCGGGAGGCAGAGGCAGG + Intronic
1141173558 16:81705285-81705307 CCACTCCCAACAGCAGAAGCTGG + Intronic
1143803903 17:9409230-9409252 CCACGGGGGAAGGCAGAAACCGG - Intronic
1144959166 17:19035205-19035227 CCAGGCTGGAAAGTAGCAGCAGG - Intronic
1144975993 17:19139319-19139341 CCAGGCTGGAAAGTAGCAGCAGG + Intronic
1147734784 17:42629052-42629074 CCAGGCTGGAAGGCAGTAGCAGG + Intergenic
1148934309 17:51152504-51152526 GCACGCTGGAAAGCAGCGGCGGG - Intergenic
1152655816 17:81518818-81518840 CCACGCGGAAAAGGGGAAGCGGG + Intronic
1158536953 18:58316761-58316783 ACAAGCCGGAAAACTGAAGCTGG - Intronic
1159535900 18:69714330-69714352 GCACACCCGAAGGCAGAAGCGGG + Intronic
1160830787 19:1104185-1104207 CCACGCCGGCGAGCGGAGGCAGG - Intronic
1160999798 19:1904987-1905009 CCACGCCGGAGTGCAGTAACAGG + Intergenic
1163206782 19:15809067-15809089 CCATGTAGGAAAGCAGAGGCAGG + Intergenic
1163587722 19:18173161-18173183 CCACGCCGGAAAGCAGAAGCTGG - Intronic
1164861569 19:31565908-31565930 CCAGGCTGGAATGCAGTAGCAGG + Intergenic
1164991864 19:32690660-32690682 CCATGCCGGAATGCAGTGGCAGG + Intergenic
1167371706 19:49086388-49086410 CCAAGTCTGAGAGCAGAAGCAGG - Exonic
1168031091 19:53680425-53680447 CCACTTTGGAAAGCAGAGGCGGG - Intergenic
1168637181 19:58005350-58005372 CCATGATGGGAAGCAGAAGCTGG + Intronic
929226018 2:39512398-39512420 GCAGGCCTGACAGCAGAAGCTGG - Intergenic
932056432 2:68448306-68448328 TCACGCCGGTAGACAGAAGCTGG - Intergenic
933673214 2:85029011-85029033 CCACGCTGGAATGCAGTGGCCGG + Intronic
935860809 2:107327054-107327076 AAACACTGGAAAGCAGAAGCAGG - Intergenic
936234650 2:110732620-110732642 CCACGCGGAGAAGCAGAGGCAGG + Exonic
936273533 2:111070845-111070867 CCACGAGGGAAAGCAGGAACAGG - Intronic
936472709 2:112812966-112812988 CCAGTCCGAAAAGCAGAAGAGGG + Intergenic
947108719 2:226695810-226695832 CTACCCAGGAAAGCAGAGGCAGG + Intergenic
948710136 2:239820214-239820236 CCACTCCAGAAAGTAGCAGCAGG + Intergenic
1171191540 20:23162805-23162827 CAACCCAGGGAAGCAGAAGCTGG - Intergenic
1172189872 20:33055453-33055475 CCAGGCCCCAGAGCAGAAGCAGG - Exonic
1184850827 22:47119299-47119321 CCCCGCTGGAAAGAAGCAGCAGG + Intronic
1185100196 22:48836235-48836257 CCAAGACAGAAAGCAGAATCAGG - Intronic
954184673 3:48907714-48907736 CCAGGCTGGAATGCAGTAGCAGG + Intergenic
955711936 3:61789141-61789163 CCACACTGGAATGCAGTAGCAGG + Intronic
956231264 3:67019168-67019190 AACCGCCGGAAAGCAGAAGCGGG - Intergenic
959343651 3:105163703-105163725 CCAAGCTGGAATGCAGTAGCTGG - Intergenic
959472089 3:106764430-106764452 CCACTGTGGGAAGCAGAAGCAGG + Intergenic
961057084 3:123798391-123798413 CCAGGCCTGACAGCAGAAGGGGG - Intronic
961819735 3:129569843-129569865 CCACCACGGAGAGCAGCAGCAGG + Exonic
962851740 3:139313262-139313284 CCCAGCCAGAAAGCAGAGGCTGG + Intronic
963923345 3:150926135-150926157 CCTGGCTGGAAAGGAGAAGCAGG - Intronic
967035483 3:185645882-185645904 ACAGGCCAGGAAGCAGAAGCAGG + Intronic
969963242 4:10968253-10968275 CCAGGCTGGAATGCAGTAGCAGG - Intergenic
973539448 4:51921710-51921732 GCAGGCCGGAAAGCAGAAGATGG + Intergenic
975711198 4:77161346-77161368 CCACTTTGGAAGGCAGAAGCAGG - Intronic
978289074 4:107116283-107116305 GCAGGCCATAAAGCAGAAGCTGG + Intronic
980442428 4:132866773-132866795 TCACAGCAGAAAGCAGAAGCAGG + Intergenic
982574958 4:157097975-157097997 CCAGGCTGGAAAGCAGTGGCAGG - Intronic
982932913 4:161430694-161430716 CCAGGCTGGAATGCAGTAGCCGG - Intronic
983401283 4:167269388-167269410 CCACGCCGGTAAGGAAAAGGTGG - Intergenic
984931074 4:184847430-184847452 CCAGGCTGGAATGCAGTAGCGGG - Intergenic
991965729 5:72088400-72088422 CCAGGCCGGACTGCAGTAGCAGG - Intergenic
992309260 5:75478268-75478290 CCAGGCTGGAATGCAGCAGCAGG - Intronic
1001278223 5:170366382-170366404 CCACCCTGGAAGGGAGAAGCTGG + Intronic
1005981995 6:30843800-30843822 CCACGGAGGCAAGCAGAGGCAGG + Intergenic
1006197596 6:32255298-32255320 CCAGGCCGGCAAGCAGGAGGCGG - Intergenic
1006463095 6:34175279-34175301 CCACAGTGGAAAGCAAAAGCAGG - Intergenic
1007165521 6:39826088-39826110 CCAAGCCAGCAGGCAGAAGCTGG - Intronic
1012746981 6:103103783-103103805 CCAGGCTGGAATGCAGAGGCAGG + Intergenic
1022066604 7:26864765-26864787 CTACGCCGGGAAGCAGGAGGAGG + Intronic
1026555806 7:71407702-71407724 CCAGGCTGGAAAGCAGTGGCCGG - Intronic
1036617797 8:10402393-10402415 CCAGGCCAGAAAGCAGCTGCTGG - Intronic
1037937267 8:22923521-22923543 CCAGGCTGGAATGTAGAAGCAGG - Intronic
1041512420 8:58666600-58666622 CCAAGCCGCCAGGCAGAAGCAGG + Intergenic
1043620781 8:82190189-82190211 AGACGCAGGAAAGCAGAAGTGGG + Intergenic
1044405188 8:91818598-91818620 CCATGGAGGCAAGCAGAAGCAGG + Intergenic
1046340376 8:112846445-112846467 CCAGGCTGGAATGCAGCAGCAGG + Intronic
1053016475 9:34665162-34665184 GCACCCCGGGGAGCAGAAGCTGG - Exonic
1056761987 9:89422346-89422368 CCAAGCCAGAAAGCAGGGGCTGG - Intronic
1060122712 9:121009898-121009920 TCACGGTGGAAAGCAGAACCAGG + Intronic
1061286986 9:129629432-129629454 CCAGGCTGGAATGCAGAGGCAGG + Intronic
1062049322 9:134438892-134438914 CAACCCCTGAAAGCAGAACCTGG + Intronic
1186849903 X:13569888-13569910 CCACCCAGGAGAGCAGCAGCGGG - Exonic
1189203584 X:39218729-39218751 CCACACTGGCAAGCAGAAGCTGG + Intergenic
1189824106 X:44899337-44899359 CCCCACCACAAAGCAGAAGCAGG - Intronic
1193396510 X:80990281-80990303 TCACAGCGGAAAGCAGAACCAGG + Intergenic
1195370301 X:104166621-104166643 GCACCCCGGCAAGCAGCAGCGGG + Exonic
1198276091 X:135097501-135097523 ACACGACGGACAGCAGGAGCAGG + Intergenic