ID: 1163587725

View in Genome Browser
Species Human (GRCh38)
Location 19:18173175-18173197
Sequence AGGCTTGACCACAGCCACGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163587725_1163587726 -8 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587726 19:18173190-18173212 TCAAGCCTGAGTCAGTCCCACGG 0: 1
1: 0
2: 2
3: 10
4: 143
1163587725_1163587737 20 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587737 19:18173218-18173240 CGGTGAGGGGTCTGGAGCGTCGG 0: 1
1: 0
2: 0
3: 15
4: 147
1163587725_1163587732 7 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587732 19:18173205-18173227 TCCCACGGGACCACGGTGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 79
1163587725_1163587739 22 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587739 19:18173220-18173242 GTGAGGGGTCTGGAGCGTCGGGG 0: 1
1: 0
2: 0
3: 8
4: 138
1163587725_1163587738 21 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587738 19:18173219-18173241 GGTGAGGGGTCTGGAGCGTCGGG 0: 1
1: 0
2: 1
3: 21
4: 194
1163587725_1163587729 0 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587729 19:18173198-18173220 GAGTCAGTCCCACGGGACCACGG 0: 1
1: 0
2: 0
3: 2
4: 101
1163587725_1163587735 12 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587735 19:18173210-18173232 CGGGACCACGGTGAGGGGTCTGG 0: 1
1: 0
2: 2
3: 16
4: 139
1163587725_1163587727 -7 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587727 19:18173191-18173213 CAAGCCTGAGTCAGTCCCACGGG 0: 1
1: 0
2: 0
3: 16
4: 168
1163587725_1163587730 5 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587730 19:18173203-18173225 AGTCCCACGGGACCACGGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 70
1163587725_1163587740 27 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587740 19:18173225-18173247 GGGTCTGGAGCGTCGGGGTCAGG 0: 1
1: 0
2: 1
3: 16
4: 199
1163587725_1163587731 6 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163587725 Original CRISPR AGGCTTGACCACAGCCACGC CGG (reversed) Intronic
900074694 1:803873-803895 AGGCTTTACCACAGTCACAAAGG + Intergenic
901637115 1:10675641-10675663 GGGCTGGACCCCAGCCACTCTGG + Intronic
902238890 1:15075169-15075191 GTGCTTGACCACAGCCCAGCAGG + Intronic
902275796 1:15338420-15338442 AGGCTTGACCACAGACAGAGGGG - Intronic
904990111 1:34585676-34585698 AGGCTTGCCCAAAGTCACACAGG + Intergenic
905358234 1:37399892-37399914 AGACTTGACCAAGGCCACACAGG + Intergenic
905460230 1:38117727-38117749 TGGCTTGAGGACAGCCACTCAGG + Intergenic
906206547 1:43990492-43990514 AGGACTGACCACAGCCTGGCTGG + Exonic
909066582 1:70942180-70942202 AGTCTTGAGCACAGCCACCCAGG + Intronic
913502750 1:119486919-119486941 AGTCTTGTCCACAGCCATGAAGG - Intergenic
915737297 1:158093244-158093266 AGGCTAGGCCACAGCCACAGAGG - Intronic
916715212 1:167441984-167442006 AGCTTTGATCACAGCCACTCTGG + Intronic
917368690 1:174263208-174263230 AAGCTAGACCACAGGCACGCAGG - Intronic
921082404 1:211752813-211752835 AAGCTTGAGGACAGCCACCCAGG - Intronic
922270539 1:224028778-224028800 AGGCTTTACCACAGTCACAAAGG + Intergenic
923630423 1:235646016-235646038 AGGCGGGACAACAGCCACGATGG - Intronic
923674443 1:236067289-236067311 AGCCTTGACCTCAGCCAGGTTGG - Intergenic
1066200793 10:33141221-33141243 AGACATGCCCAAAGCCACGCTGG - Intergenic
1076763581 10:132617825-132617847 ACACCTGCCCACAGCCACGCAGG - Intronic
1078521309 11:12066135-12066157 AGGCCTGCCCACAGCCACATGGG - Intergenic
1082001059 11:47394027-47394049 AGGCCTGACCCCAGGCAGGCTGG + Intergenic
1083307217 11:61767444-61767466 GGGCTTGTCCAGAGCCACACAGG + Intronic
1083610967 11:64004121-64004143 GGGCTTTACCACAGCAAAGCAGG - Intronic
1083611453 11:64006370-64006392 AGGCTTGAGCTCAGCCCAGCAGG + Intronic
1083853187 11:65379502-65379524 AGAGTTGACCACAGCTATGCTGG + Exonic
1084488604 11:69465468-69465490 AGGCTTGAGCACAGCTTCGAGGG + Intergenic
1088882560 11:113983116-113983138 AGACTTCCCCACATCCACGCTGG - Exonic
1090347323 11:126082127-126082149 TGGCTTGCCCACAGTCACCCAGG + Intergenic
1091659986 12:2376268-2376290 TGGCTTGCCCAAAGCCACACAGG - Intronic
1094631922 12:32184081-32184103 AGTCCTGACCACTGCCACGCCGG - Intronic
1095293993 12:40507893-40507915 AGGCAAGTCCACAGCCACACAGG + Intronic
1095944840 12:47747980-47748002 AGGGCTCAGCACAGCCACGCTGG + Intronic
1095984603 12:47991114-47991136 AGGATTGGCCACAGCCCCTCTGG + Intronic
1099290131 12:80766537-80766559 AGTCTTTACCACAACCATGCTGG + Intergenic
1100237513 12:92675264-92675286 TGGCCTGACCACAGCCATGTGGG + Intergenic
1102642750 12:114381378-114381400 AGCCTTGATAACAGCCAGGCAGG - Intronic
1105031769 12:132889026-132889048 AGGCTTGAGCACCACCACTCTGG - Intronic
1118147606 14:63157394-63157416 AAGCCTGACTACAGCCACCCAGG - Intergenic
1126688339 15:51267435-51267457 TGGCTTGAGCACAGGGACGCTGG + Intronic
1127048000 15:55048093-55048115 AGGTTTGACCACAGCCATGTTGG - Intergenic
1127184114 15:56460060-56460082 AAGCTTGAGGACAGCCACTCAGG + Intronic
1131517732 15:93090003-93090025 TGGCTTGAACACGGCCACGTCGG + Intergenic
1132241020 15:100257060-100257082 CGGCTTGACCACAGCCTGGAAGG + Intronic
1133456683 16:5948352-5948374 CTGCTGGACCACAGCCACGGAGG - Intergenic
1137261260 16:46831453-46831475 AGGCGTGGCCACTGCCGCGCCGG - Intergenic
1138250983 16:55501725-55501747 AGCCTTGACCACCTCCACCCTGG - Intronic
1139177007 16:64700923-64700945 AGGCCTGCCCACCGCCAGGCTGG + Intergenic
1139876679 16:70151600-70151622 AGGTTTGACCACAAGCACCCAGG - Intronic
1140322196 16:73963732-73963754 AGGCTATACCAAAGCCACGAAGG - Intergenic
1142310423 16:89309227-89309249 GGGCATGGCCACAGCCACGAAGG + Intronic
1144016913 17:11204866-11204888 ATGCTTGACCAAAGCCAAGCTGG - Intergenic
1147017996 17:37507724-37507746 AGGCTTGGCCATAGACACGGTGG - Intronic
1147884669 17:43676572-43676594 TGGCTTGACCACAGCCAGGGAGG - Intergenic
1148054859 17:44787845-44787867 AGCTCTGGCCACAGCCACGCTGG - Intergenic
1149002528 17:51771801-51771823 AGGCTTGACCAATACCAAGCTGG + Intronic
1149227755 17:54495210-54495232 AGGCTTGACAAAAGCCAGGTTGG + Intergenic
1151341234 17:73472183-73472205 AGCCTGGACCGCACCCACGCTGG - Exonic
1152550649 17:81028298-81028320 AGGCTGGACCACGGCAACACAGG + Intergenic
1152855676 17:82663663-82663685 AGGCCCGACCACAGCCCCGCTGG + Intronic
1160841163 19:1147584-1147606 AGGCTTGACCACCACCCCCCTGG - Intronic
1161089102 19:2351396-2351418 AGGCATCACCTCAGCCAGGCAGG - Intronic
1162514820 19:11141705-11141727 AGGCTTGACCCCAGCTACTCAGG + Intronic
1162780727 19:13005883-13005905 AGGCTTGCCCTCACCCCCGCAGG + Intronic
1163587725 19:18173175-18173197 AGGCTTGACCACAGCCACGCCGG - Intronic
1165096116 19:33410811-33410833 GGGCTCAGCCACAGCCACGCAGG - Intronic
926633920 2:15160993-15161015 AGGATTGACCACAGCCAGAGAGG - Intergenic
930388134 2:50723695-50723717 GGGTCTGACCACAGCCATGCAGG - Intronic
932568565 2:72924620-72924642 GGGCTTGACCGCAGCGCCGCGGG - Intronic
932692744 2:73927077-73927099 AGCCTTGGCCTCCGCCACGCAGG + Intronic
933730469 2:85452405-85452427 AGTCTTGACCACAGCCTACCAGG + Intergenic
935594320 2:104867609-104867631 AGCCATGACCAAAGCCCCGCGGG - Intergenic
935718576 2:105960108-105960130 AGGCCTGACTCCAGCCACGAGGG - Intergenic
936092696 2:109511430-109511452 AGGCCTGACCAGAGGCACACTGG - Intergenic
936512515 2:113159543-113159565 AGCCTTGACCAAAGGCACCCAGG + Intronic
937570328 2:123350129-123350151 AAGCTTCCCCTCAGCCACGCAGG - Intergenic
937895798 2:126976173-126976195 AGGGCTGACCACAGCCGCCCTGG - Intergenic
938168628 2:129055801-129055823 AGCCATGACCAAACCCACGCAGG + Intergenic
945464003 2:210145788-210145810 AGGCTAGTCCACAGCCATGATGG + Intronic
947083600 2:226425832-226425854 TGGCTTCAACACAGCCACTCAGG + Intergenic
948462949 2:238139029-238139051 AGGCCTGAGCCCAGCCAGGCTGG - Intronic
948600458 2:239105068-239105090 AGGCTTTTCCAGAGCCACTCTGG + Intronic
948694773 2:239727659-239727681 CGGCTGGACCACATACACGCAGG - Intergenic
1171071144 20:22069799-22069821 GGGCCTGAGCACAGCCAGGCTGG - Intergenic
1171782347 20:29430691-29430713 CGGCTGAACCACAGCCACGGGGG - Intergenic
1171959807 20:31485540-31485562 AGCCCTGACCCCAGCCAGGCTGG - Intergenic
1173198860 20:40938951-40938973 ATGCTTGTGCACAGCCACCCTGG - Intergenic
1173928286 20:46797332-46797354 AGGCCTGACCCCAGCAAGGCAGG + Intergenic
1175050601 20:56151988-56152010 AGGCTTGACAGCAGGCAGGCAGG + Intergenic
1175183620 20:57165508-57165530 AGGAGGGACCACAGCCATGCTGG + Intergenic
1176870011 21:14076494-14076516 AGGCTTGACCCAAGACCCGCGGG - Intergenic
1178517442 21:33260140-33260162 AGGCTGGACTTTAGCCACGCTGG - Intronic
1180135145 21:45857650-45857672 AGGCTGCACCCCAGCCACCCTGG + Intronic
1184885502 22:47342653-47342675 TGGCCTGACCACAGCCATACAGG - Intergenic
1185156124 22:49194522-49194544 AGGCCTGCCCACACCCACACAGG + Intergenic
955034282 3:55251032-55251054 TGACTTGCCCACAGCCACACGGG - Intergenic
961420688 3:126800794-126800816 AGGCTTAACCACAGCCCTACAGG + Intronic
961812264 3:129528658-129528680 AGGCCTGAGCTCAGCCACTCAGG - Exonic
966925705 3:184643260-184643282 AGGCTTGAAGAAAGCCAGGCTGG + Intronic
968519953 4:1030735-1030757 AGCCTTGGCCACACCCACTCAGG - Intergenic
979321448 4:119329821-119329843 AGGCTGGACCACAGCCAAATGGG - Intergenic
989137188 5:38167204-38167226 AGGCCTCACCACAGCCACTGAGG - Intergenic
999737131 5:154521294-154521316 AGTCTTGGCCACAGGCAGGCGGG - Intergenic
1000055997 5:157606780-157606802 AAGCTTGAGGACAGCCACCCAGG - Intergenic
1000190809 5:158908892-158908914 CAGCTTGACCACAGCCCGGCTGG - Intronic
1002096830 5:176836309-176836331 AGGCGTGACCACAAGCATGCTGG - Intronic
1002166730 5:177352170-177352192 AGGCTTGCCCAGGGCCACCCGGG - Intergenic
1013286372 6:108685760-108685782 AGGCTAGCCCACTGCCACACTGG - Intergenic
1015715906 6:136191775-136191797 GGGCCTGACCACGACCACGCAGG + Exonic
1019422495 7:957585-957607 AGCCCTGACCACAGCCAGTCAGG - Intronic
1022173223 7:27849307-27849329 AGACTGGACCACAGCCACCTGGG - Intronic
1022721871 7:32948749-32948771 AGGCTTGGCCAGAGTGACGCAGG - Intergenic
1023083852 7:36550510-36550532 TGGCTTGCCCAAAGCCACACAGG + Intronic
1024659300 7:51477885-51477907 CGGCTTGGCCCCCGCCACGCGGG + Intergenic
1026910757 7:74090542-74090564 ATGGCTGACCACAGCCAGGCTGG + Intronic
1029390159 7:100269744-100269766 AGACTTTGCCTCAGCCACGCAGG + Intronic
1029941249 7:104482819-104482841 AGACTGGACCACAGCCAGCCCGG - Intronic
1035540947 8:437606-437628 AGGCTTTACCACAGTCACAAAGG - Intronic
1036794980 8:11749324-11749346 GGCCTTGCCCACAGCCACTCAGG + Intronic
1048495629 8:134933504-134933526 AGGCTTGACCAGAGCCTAGCTGG + Intergenic
1049272780 8:141704834-141704856 AGGCATGGCCACAGGAACGCTGG - Intergenic
1049451489 8:142664436-142664458 AACCTTGACCACAGCCCCGAGGG + Intronic
1049629340 8:143644211-143644233 AGGTTTCACCATAGCCAGGCTGG + Intronic
1056993198 9:91429881-91429903 CAGCTTGCCCACAGCCACTCAGG + Intergenic
1058585963 9:106506326-106506348 AGGCTGCGCCACAGCCATGCTGG - Intergenic
1059893447 9:118832355-118832377 AGTGGTGACCACAGCCAGGCTGG - Intergenic
1062315927 9:135966997-135967019 AGCCCCAACCACAGCCACGCCGG + Intergenic
1062315940 9:135967032-135967054 AGTCCCAACCACAGCCACGCCGG + Intergenic
1062315952 9:135967067-135967089 AGTCCCAACCACAGCCACGCCGG + Intergenic
1062315964 9:135967102-135967124 AGTCCCAACCACAGCCACGCCGG + Intergenic
1062675646 9:137741997-137742019 TTGCTTGAGCACAGCCATGCTGG + Intronic
1190291155 X:48993292-48993314 TGGCTTGTCCAAAGCCACACAGG + Intronic
1192188666 X:68977089-68977111 AGGCCTCATCACAGCCAAGCAGG + Intergenic
1195706181 X:107739490-107739512 AAGGTTGACCACACACACGCTGG + Intronic