ID: 1163587726

View in Genome Browser
Species Human (GRCh38)
Location 19:18173190-18173212
Sequence TCAAGCCTGAGTCAGTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163587720_1163587726 12 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587726 19:18173190-18173212 TCAAGCCTGAGTCAGTCCCACGG 0: 1
1: 0
2: 2
3: 10
4: 143
1163587719_1163587726 13 Left 1163587719 19:18173154-18173176 CCCTGCGCCAGCTTCTGCTTTCC 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1163587726 19:18173190-18173212 TCAAGCCTGAGTCAGTCCCACGG 0: 1
1: 0
2: 2
3: 10
4: 143
1163587725_1163587726 -8 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587726 19:18173190-18173212 TCAAGCCTGAGTCAGTCCCACGG 0: 1
1: 0
2: 2
3: 10
4: 143
1163587718_1163587726 18 Left 1163587718 19:18173149-18173171 CCACTCCCTGCGCCAGCTTCTGC 0: 1
1: 0
2: 2
3: 43
4: 606
Right 1163587726 19:18173190-18173212 TCAAGCCTGAGTCAGTCCCACGG 0: 1
1: 0
2: 2
3: 10
4: 143
1163587722_1163587726 6 Left 1163587722 19:18173161-18173183 CCAGCTTCTGCTTTCCGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1163587726 19:18173190-18173212 TCAAGCCTGAGTCAGTCCCACGG 0: 1
1: 0
2: 2
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163587726 Original CRISPR TCAAGCCTGAGTCAGTCCCA CGG Intronic