ID: 1163587729

View in Genome Browser
Species Human (GRCh38)
Location 19:18173198-18173220
Sequence GAGTCAGTCCCACGGGACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163587718_1163587729 26 Left 1163587718 19:18173149-18173171 CCACTCCCTGCGCCAGCTTCTGC 0: 1
1: 0
2: 2
3: 43
4: 606
Right 1163587729 19:18173198-18173220 GAGTCAGTCCCACGGGACCACGG 0: 1
1: 0
2: 0
3: 2
4: 101
1163587722_1163587729 14 Left 1163587722 19:18173161-18173183 CCAGCTTCTGCTTTCCGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1163587729 19:18173198-18173220 GAGTCAGTCCCACGGGACCACGG 0: 1
1: 0
2: 0
3: 2
4: 101
1163587720_1163587729 20 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587729 19:18173198-18173220 GAGTCAGTCCCACGGGACCACGG 0: 1
1: 0
2: 0
3: 2
4: 101
1163587719_1163587729 21 Left 1163587719 19:18173154-18173176 CCCTGCGCCAGCTTCTGCTTTCC 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1163587729 19:18173198-18173220 GAGTCAGTCCCACGGGACCACGG 0: 1
1: 0
2: 0
3: 2
4: 101
1163587725_1163587729 0 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587729 19:18173198-18173220 GAGTCAGTCCCACGGGACCACGG 0: 1
1: 0
2: 0
3: 2
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163587729 Original CRISPR GAGTCAGTCCCACGGGACCA CGG Intronic