ID: 1163587731

View in Genome Browser
Species Human (GRCh38)
Location 19:18173204-18173226
Sequence GTCCCACGGGACCACGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163587725_1163587731 6 Left 1163587725 19:18173175-18173197 CCGGCGTGGCTGTGGTCAAGCCT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1163587722_1163587731 20 Left 1163587722 19:18173161-18173183 CCAGCTTCTGCTTTCCGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1163587720_1163587731 26 Left 1163587720 19:18173155-18173177 CCTGCGCCAGCTTCTGCTTTCCG 0: 1
1: 0
2: 2
3: 8
4: 182
Right 1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1163587719_1163587731 27 Left 1163587719 19:18173154-18173176 CCCTGCGCCAGCTTCTGCTTTCC 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163587731 Original CRISPR GTCCCACGGGACCACGGTGA GGG Intronic
913507879 1:119534743-119534765 TTCCCAAGGCACCACAGTGAAGG - Intergenic
915071487 1:153272546-153272568 GTCCCACTAGACCACAGTGGTGG - Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
918311317 1:183287606-183287628 ATCCCACTGGGCCAAGGTGATGG + Intronic
1074973999 10:118565912-118565934 GTCCCATTGGACAAAGGTGAAGG - Intergenic
1083748154 11:64746277-64746299 GTCCCACGGCGGGACGGTGATGG - Intergenic
1084030786 11:66479635-66479657 GACTCACGGGACCACGGTCTGGG - Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1088196136 11:107276053-107276075 GTCCCATGGGGACATGGTGATGG - Intergenic
1088889653 11:114034692-114034714 TTCCCATGGGACCTCCGTGAGGG + Intergenic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1099574276 12:84361680-84361702 TGCCCAGGGGACCACCGTGACGG + Intergenic
1100339119 12:93661132-93661154 GTCCCCTGGGACAAAGGTGAAGG - Intergenic
1107483081 13:40801417-40801439 TTCTCACAGGATCACGGTGAGGG - Intronic
1113488793 13:110676307-110676329 GTCCAAGGGGACCAGGGAGAAGG + Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1122992012 14:105240957-105240979 GCCCCACGAGACCACGGGCAGGG + Intronic
1123450551 15:20357061-20357083 GTCCCACGGGAGGCCCGTGATGG + Intergenic
1137528540 16:49261026-49261048 GTCCCACGGGATCTCGGGGGAGG - Intergenic
1140322527 16:73967038-73967060 GTCCCCCGGGACCCTGGTGGTGG - Intergenic
1144422777 17:15113174-15113196 GTTCCGCGGGGCCACAGTGAGGG + Intergenic
1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG + Intronic
1151426736 17:74035574-74035596 ATCCCAAGGAACCACAGTGAAGG - Intergenic
1154954415 18:21241509-21241531 GCCTCCCGGGACCACGGGGACGG - Intergenic
1161307061 19:3574056-3574078 GGCCCACAGGACCAAGGGGAGGG - Intronic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
925295646 2:2774730-2774752 GTCCCAGGGGACCAAGGCAAGGG - Intergenic
926592772 2:14757521-14757543 GACCGCCGTGACCACGGTGAGGG - Intergenic
926764409 2:16311675-16311697 ATCCCACTGCACCACGGTGAGGG + Intergenic
948992619 2:241562494-241562516 GTCCCATGGGACCTCAGGGAGGG + Intronic
1171396218 20:24835450-24835472 GTCTCACTGGATCATGGTGAAGG - Intergenic
1171749047 20:29029437-29029459 GCCCCACGGGACCTGAGTGAAGG + Intergenic
1172442754 20:34977662-34977684 CTACCTCGGCACCACGGTGAGGG - Exonic
1173589966 20:44217033-44217055 GTCCCATGGGACAACGGGGTCGG - Intergenic
1176316136 21:5246267-5246289 GCCCCACGGGACCTGAGTGAAGG - Intergenic
1180393940 22:12312193-12312215 GCCCCACGGGACCTGAGTGAAGG - Intergenic
1180405807 22:12552557-12552579 GCCCCACGGGACCTGAGTGAAGG + Intergenic
1181026264 22:20129525-20129547 GCCCCACGGGACCACAGGGTAGG + Intronic
1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG + Intronic
950364379 3:12472674-12472696 GTCCCACGGTGTCATGGTGAGGG - Intergenic
954325565 3:49861564-49861586 GTCCCTCAGGGCCACGGGGAGGG - Exonic
965300147 3:166998247-166998269 GTCAGAGGGGACCAGGGTGATGG - Intergenic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
968878711 4:3287864-3287886 GTCCCACGGGGCCTGGGTGGGGG + Intergenic
990719706 5:58680583-58680605 GTCCCACTGGACCAAAGTCAGGG + Intronic
992827961 5:80568972-80568994 GTCTCAGGGAACCAAGGTGATGG + Exonic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1004037254 6:11935531-11935553 GTAACACGGGACCATGGAGAGGG + Intergenic
1004037260 6:11935553-11935575 GTAACACGGGACCATGGAGAGGG + Intergenic
1004037266 6:11935575-11935597 GTAACACGGGACCATGGAGAGGG + Intergenic
1006322627 6:33329181-33329203 GTCGCACGGGACCCCTGGGAGGG + Intronic
1019258280 7:65345-65367 GCCCCACTGGACCACGGCTAAGG + Intergenic
1030563364 7:111119861-111119883 GAGCCATGGGACCACTGTGAAGG + Intronic
1033174670 7:139113166-139113188 ATCCCACTGGACTACTGTGATGG - Intergenic
1034860480 7:154590944-154590966 CACCCACTGGACCACAGTGATGG + Intronic
1046556108 8:115775404-115775426 CTCCCATGGGATCAGGGTGAAGG + Intronic
1047384224 8:124394748-124394770 CTCCCATGGGACCTCAGTGAGGG - Intergenic
1049035557 8:140073041-140073063 ATCCCACTGTACCATGGTGAAGG + Intronic
1049593436 8:143472784-143472806 GTCCCGCGGGTGCACGGTGCAGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1055066933 9:72128691-72128713 GTCTCACAGGACTACTGTGATGG - Intronic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1060484188 9:124036859-124036881 CTCCCAGGGGGCCACAGTGATGG + Intergenic
1062040301 9:134401499-134401521 GACCCACGGGGCCACCTTGAGGG + Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1185886132 X:3784999-3785021 GTCCCCAGGGACCATGATGAGGG - Intergenic
1186935493 X:14446210-14446232 TTCCCAAGGGGCCACAGTGAAGG - Intergenic