ID: 1163588599

View in Genome Browser
Species Human (GRCh38)
Location 19:18177587-18177609
Sequence GATTTGCGAGGCGGGAGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163588589_1163588599 1 Left 1163588589 19:18177563-18177585 CCCCATTGGGAAAGATGTGCCAC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1163588599 19:18177587-18177609 GATTTGCGAGGCGGGAGGCGGGG 0: 1
1: 0
2: 2
3: 4
4: 137
1163588585_1163588599 11 Left 1163588585 19:18177553-18177575 CCCTAGCCACCCCCATTGGGAAA 0: 1
1: 0
2: 1
3: 16
4: 113
Right 1163588599 19:18177587-18177609 GATTTGCGAGGCGGGAGGCGGGG 0: 1
1: 0
2: 2
3: 4
4: 137
1163588587_1163588599 5 Left 1163588587 19:18177559-18177581 CCACCCCCATTGGGAAAGATGTG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1163588599 19:18177587-18177609 GATTTGCGAGGCGGGAGGCGGGG 0: 1
1: 0
2: 2
3: 4
4: 137
1163588588_1163588599 2 Left 1163588588 19:18177562-18177584 CCCCCATTGGGAAAGATGTGCCA 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1163588599 19:18177587-18177609 GATTTGCGAGGCGGGAGGCGGGG 0: 1
1: 0
2: 2
3: 4
4: 137
1163588586_1163588599 10 Left 1163588586 19:18177554-18177576 CCTAGCCACCCCCATTGGGAAAG 0: 1
1: 0
2: 1
3: 12
4: 193
Right 1163588599 19:18177587-18177609 GATTTGCGAGGCGGGAGGCGGGG 0: 1
1: 0
2: 2
3: 4
4: 137
1163588590_1163588599 0 Left 1163588590 19:18177564-18177586 CCCATTGGGAAAGATGTGCCACT 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1163588599 19:18177587-18177609 GATTTGCGAGGCGGGAGGCGGGG 0: 1
1: 0
2: 2
3: 4
4: 137
1163588591_1163588599 -1 Left 1163588591 19:18177565-18177587 CCATTGGGAAAGATGTGCCACTG 0: 1
1: 1
2: 2
3: 8
4: 135
Right 1163588599 19:18177587-18177609 GATTTGCGAGGCGGGAGGCGGGG 0: 1
1: 0
2: 2
3: 4
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163588599 Original CRISPR GATTTGCGAGGCGGGAGGCG GGG Intronic
901167456 1:7230434-7230456 GCTTTGCGGGGCGGGGGGGGGGG - Intronic
901835622 1:11922377-11922399 GATTTATGATGCGGGAGGAGGGG + Intronic
901841028 1:11954223-11954245 ACTTTGGGAGGCGGGGGGCGGGG + Intronic
902207955 1:14883578-14883600 GATTGGGTAGGCGGGAGGTGAGG - Intronic
902395334 1:16129386-16129408 GGAGTGGGAGGCGGGAGGCGAGG + Intronic
903555077 1:24187286-24187308 GAGGCGGGAGGCGGGAGGCGGGG - Intronic
903850709 1:26304266-26304288 GATTTGGGAGGCTGGATGCTGGG - Intronic
905560854 1:38926174-38926196 GATTTCTGAGGCTGGAGGTGAGG + Exonic
905817201 1:40960847-40960869 ACTTTGGGAGGCGGGTGGCGGGG + Intergenic
906205210 1:43982926-43982948 GATGTGTGGGGCGGGAGTCGCGG + Intronic
907364008 1:53945418-53945440 GAGACGCGCGGCGGGAGGCGTGG - Intronic
908178822 1:61583802-61583824 TATTTGGGAGTGGGGAGGCGAGG + Intergenic
909025478 1:70477287-70477309 GAATCGCGCAGCGGGAGGCGGGG - Intergenic
909373362 1:74913281-74913303 GATTTGGGAGGAGGCAGGGGTGG - Intergenic
909755625 1:79221596-79221618 GATTTGGGAGGGGGCAGGGGTGG + Intergenic
911500456 1:98679403-98679425 GATTTGGGAGGCGCCAGGGGTGG - Intronic
915531005 1:156502023-156502045 TATTCGGGAGGCGGGAGGGGAGG - Intergenic
919793697 1:201308589-201308611 GATTTGGGAGGCTGCAGGTGAGG + Intronic
920398012 1:205660474-205660496 CATTTGCGAGGTGGGAGCCATGG + Intronic
920400991 1:205676227-205676249 GATTAGCGAGGCCGGGGGCAGGG + Intronic
921379528 1:214510110-214510132 GAATAGGGAGGCGGGAGGAGAGG + Intronic
923465676 1:234246192-234246214 GGTTTGGGAGGCAGGAGGAGTGG + Intronic
923702408 1:236312474-236312496 ATTTTGGGTGGCGGGAGGCGGGG + Intergenic
1063462746 10:6224945-6224967 GTGTTGAGAGACGGGAGGCGTGG + Intronic
1064981757 10:21173378-21173400 GATCTGTGGGGCGGGGGGCGGGG + Intronic
1067111882 10:43407274-43407296 CATCTGCGTGGCGGGACGCGAGG - Intronic
1074686235 10:115964713-115964735 GGTTTGCGGGGCGAGGGGCGAGG + Intergenic
1078292436 11:10026163-10026185 GAGTTGTGAGGGGGGAGGAGAGG - Intronic
1081576252 11:44320093-44320115 GATGCGCGGGGCGGGGGGCGGGG - Intergenic
1081649926 11:44817056-44817078 GAAGTGTGAGGCTGGAGGCGAGG + Intronic
1084313408 11:68329850-68329872 GCTTGGCAAGGCAGGAGGCGTGG + Intronic
1084515844 11:69637636-69637658 GTTTTGAGGGGCGGGAGTCGAGG + Intergenic
1092159461 12:6308167-6308189 GAATTGGGAGGCTGGAGGCTTGG - Intergenic
1093753809 12:22830481-22830503 GATTTGCGAGGGGCCAGGCATGG + Intergenic
1096516383 12:52157893-52157915 GACTTGCGAGGAGGGATGAGGGG - Intergenic
1098631025 12:72721446-72721468 GATTTGGGAGGGGTGAGGGGAGG + Intergenic
1098648681 12:72938655-72938677 GATTTGCGAGGGGCCAGGGGTGG - Intergenic
1101488518 12:105190715-105190737 GAGTTCAGAGGAGGGAGGCGGGG - Intronic
1101705971 12:107221610-107221632 GATTTGGGAGGCGGGCGGCGGGG + Intergenic
1102599652 12:114020093-114020115 CATTTGGGAGGCAGGAGGCTGGG - Intergenic
1103208006 12:119145484-119145506 GGTTTGCGTGGAGGGTGGCGAGG - Exonic
1104494442 12:129223648-129223670 GTCTTGCAAAGCGGGAGGCGGGG - Intronic
1112971813 13:105270925-105270947 GATTTGGGAGGGGGCAGGAGTGG + Intergenic
1113485349 13:110648875-110648897 AATCTGCGAGAAGGGAGGCGGGG + Intronic
1114612391 14:24051621-24051643 GATCTGGGAGGCGAGGGGCGGGG - Intergenic
1117717766 14:58598371-58598393 AATTTTGGAGGTGGGAGGCGAGG + Intergenic
1122371798 14:101233191-101233213 GCTTAGGGAGGCGGGAGGCCTGG - Intergenic
1122393557 14:101407166-101407188 GATTCCCGAGGCAGCAGGCGTGG - Intergenic
1123038710 14:105481726-105481748 GCTTGGCGGGGCGGGGGGCGGGG + Intergenic
1125918644 15:43511099-43511121 GCTGTGCGAGGCCGGAGCCGCGG + Intronic
1127791201 15:62399954-62399976 GATTTGGGAGGGGGCAGGGGTGG + Intronic
1128454233 15:67823601-67823623 GAGGTGCGCGGCGGGAGGAGCGG - Intronic
1129580406 15:76802791-76802813 TATTTGCTTGGCAGGAGGCGGGG + Intronic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1137493664 16:48952294-48952316 GAATGGAGAGGCGGGAGGGGTGG + Intergenic
1139364803 16:66426979-66427001 GAGATGCGGGGCGGGGGGCGCGG - Intergenic
1139691696 16:68645698-68645720 GACCTTGGAGGCGGGAGGCGCGG + Exonic
1141213336 16:82001422-82001444 GATTTGCGGTGGGGGAGGTGGGG - Intronic
1142409367 16:89908215-89908237 GAACTGAGAGGAGGGAGGCGGGG - Intronic
1143189560 17:5031734-5031756 GAGGTGCGAGGCGGGCGGGGCGG + Intergenic
1143419204 17:6776032-6776054 GCGTTGGGAGGCGGGAGGCTCGG - Intergenic
1143482244 17:7234406-7234428 GATCTGCGAGGGTGGCGGCGGGG + Exonic
1143689743 17:8550690-8550712 GAATGGAGAGGCGGGAGGGGTGG + Intronic
1143837491 17:9703629-9703651 GACTGGCGAGGCGGTAGGCAGGG + Intronic
1148092666 17:45031994-45032016 GGTTGGGGAGGCGGGAGGCTGGG + Intronic
1150002797 17:61452115-61452137 GATTAGAGAGGCGGGAAGCAAGG - Intergenic
1151319176 17:73342466-73342488 GATCTGTGAGGCAGGAGGCTGGG + Intronic
1152129244 17:78465980-78466002 GAATGGAGAGGCGGGAGGGGTGG + Intronic
1153303436 18:3611571-3611593 TAATTTCGAGGTGGGAGGCGGGG - Intronic
1153765107 18:8367376-8367398 TAATTGCGAGGGAGGAGGCGCGG - Intronic
1157297577 18:46457299-46457321 AATTTGGGAGGCGGGAGGGGGGG + Exonic
1159370399 18:67520954-67520976 GACTTGTGAGGCAGGAGGAGAGG - Intergenic
1159453444 18:68631597-68631619 GATTTGGGAGGGGTGAGGGGAGG + Intergenic
1160338660 18:78067303-78067325 GTTTTCTGGGGCGGGAGGCGGGG + Intergenic
1161961109 19:7523577-7523599 GCTTTGCTAGGCAGGAGGCCAGG + Intronic
1163588599 19:18177587-18177609 GATTTGCGAGGCGGGAGGCGGGG + Intronic
1163677392 19:18662214-18662236 GATTTGCGGGGAGGGATGGGAGG - Intronic
1165479661 19:36055069-36055091 GATTGGTGGGGCGGGGGGCGGGG - Exonic
926678050 2:15642977-15642999 GAGGTGAGAGTCGGGAGGCGGGG - Intergenic
929494050 2:42424050-42424072 GATTTGCAAAGCTGGAGGTGGGG - Intronic
931321355 2:61177341-61177363 GATCTGGGAGGCGGGTCGCGCGG - Intergenic
932210221 2:69921776-69921798 GATTTGGGAGGTGGAATGCGGGG + Intronic
932607871 2:73176536-73176558 AATTTGCGGGGCGGGAGGGCAGG - Intergenic
936499443 2:113054467-113054489 GATTTGCGAGGAGCCAGGGGTGG - Intergenic
936713699 2:115161708-115161730 GCTTTGGGTGGCGGGGGGCGGGG + Exonic
939073177 2:137568196-137568218 AATTGGGGAGGCGGGAGGAGAGG + Intronic
940635674 2:156293865-156293887 GAATGGAGAGGCGGGAGGGGTGG + Intergenic
941366960 2:164621365-164621387 GGTTTGCGCGGCGGGAGGCGAGG + Exonic
941580625 2:167292834-167292856 GGTTTGGGATGGGGGAGGCGCGG - Intergenic
946041973 2:216790539-216790561 GAGGTGGGAGGCGGGAGGCGGGG - Intergenic
1171128786 20:22628798-22628820 GATTTGTGATGGAGGAGGCGGGG + Intergenic
1172051316 20:32121647-32121669 GAATGGAGAGGCGGGAGGGGTGG - Intronic
1181094420 22:20495822-20495844 GAGGCGCGAGGCGGGAGGCTGGG + Exonic
1181808160 22:25387679-25387701 GCTTGGCAAGGCAGGAGGCGTGG - Intronic
1182147591 22:28006155-28006177 GAATTGCTAGATGGGAGGCGAGG + Intronic
1184706140 22:46214825-46214847 GATGTGCGGGGCGGGATGTGTGG + Intronic
1184787038 22:46676915-46676937 GACTTGGGAGGAGGGAGGCACGG + Intronic
1185173454 22:49306295-49306317 GATTAGGCAGGAGGGAGGCGGGG + Intergenic
1185313724 22:50170180-50170202 CATCTGCGTGGCGGGGGGCGGGG + Intergenic
1185397420 22:50600307-50600329 GGCGGGCGAGGCGGGAGGCGCGG - Intronic
961252537 3:125519700-125519722 GATGGGCGAGGCTGGAGGAGGGG - Intronic
961869699 3:129978258-129978280 GATTTGGGAGGCGGGGGTGGTGG + Intergenic
965270604 3:166613172-166613194 AATTTGGGAGGCGGCAGGGGTGG - Intergenic
966211719 3:177460228-177460250 GATTTCAGAGGTGGGAGGAGGGG + Intergenic
968224840 3:196967136-196967158 CATCTGCGGGGCGGGAGGAGGGG + Intronic
968875917 4:3267909-3267931 GATTTGGGAGGCAGGAGGTCAGG + Intronic
969439412 4:7208395-7208417 GATTGGCGGGGAGGGAGGCAGGG + Intronic
970302187 4:14692846-14692868 GATTTGGGAGGGGGCAGGGGTGG + Intergenic
971262307 4:25068516-25068538 GATTTTAGAGGCTGGAGGCTGGG + Intergenic
976310395 4:83606043-83606065 GATTTAAGCGGCGGGAGGGGAGG - Intergenic
985330477 4:188826392-188826414 GAATTGGGAGGCTGGAGGAGAGG - Intergenic
992400102 5:76403767-76403789 GAATTGGGGGGCGGGAGGAGCGG - Intronic
1000270751 5:159680918-159680940 GATTTGGGAGGGGGCAGGAGTGG + Intergenic
1001313798 5:170629057-170629079 GATGTGCGAGGTGGGAGTGGAGG - Intronic
1002091927 5:176810940-176810962 ACTTTGCGAGGCGGGACGCGGGG + Intronic
1002554801 5:180027951-180027973 GATTTGAAAGAAGGGAGGCGTGG - Intronic
1004720176 6:18261963-18261985 GATTTGCAATGCTGGAGGTGAGG + Intronic
1006518499 6:34557611-34557633 GAGTGGGGAGGAGGGAGGCGTGG - Intergenic
1006814547 6:36840985-36841007 GATGTGCCAGGCGGTGGGCGAGG - Intergenic
1007208104 6:40169235-40169257 GATTTGCAAGGTGGTAGGAGGGG - Intergenic
1008242347 6:49128320-49128342 GATTTGCGAGGGGCCAGGGGTGG + Intergenic
1010005666 6:70992362-70992384 GATTTGGGAGGGGGCAGGGGTGG + Intergenic
1010744260 6:79542849-79542871 GTTTTGCGGGGTGGGAGGAGAGG - Intergenic
1012683318 6:102210315-102210337 GATTTGGGAGGGGGCAGGAGTGG + Intergenic
1022351732 7:29572538-29572560 GATTTGCCAGGCAGGTGGTGGGG - Intergenic
1022396390 7:29990760-29990782 AATTAGCGAGGCTGGTGGCGTGG - Intergenic
1024383081 7:48722197-48722219 GATTTGGGAGGGGGCAGGGGTGG - Intergenic
1029706631 7:102279892-102279914 GATCTCAGAGGCGGGAGGAGAGG - Intronic
1034680239 7:152923021-152923043 TATTTGAGAGGAGGGAGGGGAGG + Intergenic
1039804467 8:40986704-40986726 GACTTGCGAGCAGGGAGGGGTGG - Intergenic
1042319175 8:67457029-67457051 GTTTTGCCAGGCTGAAGGCGTGG - Intronic
1056742100 9:89266299-89266321 GATTTCCAAGGTGGGAGGTGTGG - Intergenic
1058357014 9:104094531-104094553 GAGGCGGGAGGCGGGAGGCGGGG + Intronic
1059540220 9:115123008-115123030 GATTTGGGGGGTGGGGGGCGGGG - Intergenic
1060389453 9:123267038-123267060 GATTTCTGAGGCGGGAAGTGTGG - Intronic
1061365883 9:130172327-130172349 GAGGGGGGAGGCGGGAGGCGGGG + Intergenic
1190485783 X:50923508-50923530 GGTTTGCTGGGAGGGAGGCGTGG + Intergenic
1193256579 X:79355710-79355732 GATTTGCGAGGGGCCAGGAGTGG + Intergenic
1194257036 X:91646859-91646881 GATTTGGGAGGGGGGAGGGGTGG + Intergenic
1196340197 X:114585910-114585932 GATTTGGGGGGCGGGGGGTGAGG + Intronic
1200255845 X:154582390-154582412 GATTTGGGAGGGGGCAGGGGTGG + Intergenic
1200261924 X:154622013-154622035 GATTTGGGAGGGGGCAGGGGTGG - Intergenic
1200575747 Y:4886125-4886147 GATTTGGGAGCAGGGAGGGGTGG + Intergenic
1201489361 Y:14524438-14524460 GAATTGGGAGGTGGGAAGCGGGG - Intronic