ID: 1163591363

View in Genome Browser
Species Human (GRCh38)
Location 19:18195923-18195945
Sequence CTGGCCCAAGGGCAGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163591354_1163591363 7 Left 1163591354 19:18195893-18195915 CCTGCCAAGTCTGTTGAGCAGGG 0: 1
1: 0
2: 1
3: 6
4: 150
Right 1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG 0: 1
1: 0
2: 5
3: 30
4: 296
1163591349_1163591363 20 Left 1163591349 19:18195880-18195902 CCTCAGCCCGGTCCCTGCCAAGT 0: 1
1: 0
2: 0
3: 23
4: 237
Right 1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG 0: 1
1: 0
2: 5
3: 30
4: 296
1163591350_1163591363 14 Left 1163591350 19:18195886-18195908 CCCGGTCCCTGCCAAGTCTGTTG 0: 1
1: 0
2: 1
3: 24
4: 386
Right 1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG 0: 1
1: 0
2: 5
3: 30
4: 296
1163591356_1163591363 3 Left 1163591356 19:18195897-18195919 CCAAGTCTGTTGAGCAGGGCTGA 0: 1
1: 0
2: 2
3: 9
4: 136
Right 1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG 0: 1
1: 0
2: 5
3: 30
4: 296
1163591351_1163591363 13 Left 1163591351 19:18195887-18195909 CCGGTCCCTGCCAAGTCTGTTGA 0: 1
1: 0
2: 0
3: 5
4: 163
Right 1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG 0: 1
1: 0
2: 5
3: 30
4: 296
1163591352_1163591363 8 Left 1163591352 19:18195892-18195914 CCCTGCCAAGTCTGTTGAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG 0: 1
1: 0
2: 5
3: 30
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163591363 Original CRISPR CTGGCCCAAGGGCAGGTAGA GGG Intronic
900208318 1:1440954-1440976 CTGGGCCCAGGGCAGGTGGCTGG + Exonic
900245548 1:1634489-1634511 CTCGCCCAGGGCCAGGTAGCCGG - Exonic
900256777 1:1701646-1701668 CTCGCCCAGGGCCAGGTAGCCGG - Intronic
901257306 1:7841217-7841239 GTGGCCCATGGGCAGGAAGGGGG + Intronic
901614559 1:10528081-10528103 CTGCCCTAAGGGCAAGAAGATGG - Intronic
901629333 1:10640667-10640689 CTACCCCAAGGGCTGGGAGAGGG + Intronic
902210147 1:14899165-14899187 CTGTACCAAGGTCAGGAAGATGG + Intronic
902874728 1:19333965-19333987 TTGGCCCTAGGGCAGGGAGTGGG + Intergenic
902960618 1:19960692-19960714 GTGGGCCAAGGGCAAGAAGAAGG - Intergenic
903225976 1:21894454-21894476 CTGCCCCAAGGGCAGCTGGCAGG + Intronic
903757017 1:25669439-25669461 CTGGCAAAAGGGCTGGTACATGG + Intronic
904273398 1:29364942-29364964 CTGGCTCAGGGGCAGGCAGATGG + Intergenic
904398678 1:30241249-30241271 CTTGCCCAAGGCCTGGCAGAAGG - Intergenic
904408256 1:30308046-30308068 CTGGCCCGAGGGCCGGCAAATGG - Intergenic
904558548 1:31381609-31381631 CTGGCCCAAGGTCACAGAGAAGG - Intergenic
905396906 1:37672554-37672576 CAGGCCCAAGGGCAACTGGACGG + Intergenic
906955832 1:50372903-50372925 ATGGCCCATGGGTAGGAAGAAGG - Intergenic
907359050 1:53900083-53900105 CTGACCCAAGGACAAGGAGAGGG + Intronic
908975624 1:69894277-69894299 CTTGCCCAAGGTCAGGAAGCTGG + Intronic
914001354 1:143697665-143697687 CTGGCCCAAGGTCAAACAGAAGG + Intergenic
914676934 1:149913037-149913059 CTGACCCAAGGCCAAGAAGAGGG + Intronic
914725329 1:150322402-150322424 CTTGCCCAAGGGCTTGTAAATGG + Intronic
914854644 1:151342427-151342449 CTTGCCCAGGGTCAGGGAGATGG - Exonic
915082557 1:153361961-153361983 ATAGCCAAAGGGCAGGAAGATGG - Intergenic
915261992 1:154683672-154683694 CTGGCCCAAGGTTAGGCAGCTGG + Intergenic
915914777 1:159934374-159934396 CTGGCCCAGGGGAAGGGAGCAGG + Intronic
916693669 1:167215925-167215947 CTGGCTGAAGGGGACGTAGAGGG + Intergenic
916715305 1:167442614-167442636 CTGGCCCAGGGGCAGGAAGGGGG - Intronic
917630772 1:176889247-176889269 CTATCCCAAGGGGAGGGAGAGGG + Intronic
920370734 1:205477746-205477768 CTGGACCAGGGACAGCTAGAGGG - Intergenic
920375232 1:205504669-205504691 CTGGCCGAGGAGGAGGTAGAAGG - Exonic
922797355 1:228347017-228347039 CTCCCCCAAGGGAAGGCAGAGGG - Intronic
922974008 1:229768752-229768774 CTGGGCCAAGGGAAGGCAGGTGG + Intergenic
923527275 1:234782208-234782230 CTCGCCCAAGGTCACATAGACGG - Intergenic
923766076 1:236893446-236893468 CTGGCCCAAGGTCAGACAGTGGG - Intronic
1062826653 10:574488-574510 CTGGCCCAAGCCCAGCTAAATGG + Intronic
1062839223 10:657395-657417 CAGGTCCAAGGGCAGGTCCAGGG - Intronic
1062839399 10:658019-658041 CAGGTCCAAGGGCAGGTCCAGGG - Intronic
1062928331 10:1335150-1335172 CTGCCCCAGGCGCAGGTAGCTGG - Intronic
1062996132 10:1869179-1869201 CTGGGCCAAAGGCAGGGAAAGGG + Intergenic
1064294800 10:14069061-14069083 CTGCCCCCAGGGTAGGAAGAGGG + Intronic
1065144254 10:22751959-22751981 CTGGCCCAATGGCAGGGGGAAGG + Intergenic
1071706175 10:88001263-88001285 CTGGCTAGATGGCAGGTAGAAGG + Intergenic
1072300992 10:94061953-94061975 CTTGCCCAACGGCATGTAGTTGG - Intronic
1073219641 10:101859887-101859909 CTGGTCCATGGGCAGATGGAGGG + Intronic
1073314586 10:102570149-102570171 CTGGCCCAGGCGCTTGTAGAGGG + Intronic
1073626057 10:105098413-105098435 CTTGCCCAAGGTCACATAGACGG + Intronic
1073724203 10:106210826-106210848 CGGAACAAAGGGCAGGTAGAAGG - Intergenic
1074495912 10:113979929-113979951 ATGGCCCATGGGGAGGTAGAAGG + Intergenic
1074621054 10:115123590-115123612 CTAGCCCAACTGCAGGTAGTTGG - Intronic
1075747690 10:124739273-124739295 CTGGCCCAAGGCCACATAGCCGG - Intronic
1076141360 10:128080949-128080971 CAGGCACAAGGGCAAGCAGATGG - Intronic
1076850860 10:133092008-133092030 CTGGCCCAAAGGCAGGTTGTGGG + Intronic
1077059783 11:613047-613069 CTGCCCGAAGCCCAGGTAGATGG + Exonic
1077179296 11:1205001-1205023 CTGGCCCAGGTGCAGAGAGATGG + Intergenic
1077316721 11:1922614-1922636 CTGGAGCCAGGGCAGGAAGAGGG + Intronic
1077343769 11:2037299-2037321 CTGGCCCAAGGAGAGGGAGTGGG - Intergenic
1078175262 11:8964981-8965003 CTGGACCAAGGGGAGGCACATGG - Intronic
1078660596 11:13282541-13282563 CTGGGCCAAGGGCTGGTACAGGG - Intronic
1080429593 11:32185942-32185964 CTGGCCCAAGGGAAGTGGGAAGG - Intergenic
1081537200 11:44004637-44004659 CTTGCCCAAGGTCAAGTAGTGGG + Intergenic
1083278650 11:61611752-61611774 CTCTCCTGAGGGCAGGTAGATGG - Intergenic
1083593912 11:63910063-63910085 CTGACCCCAGGGCTGGGAGAGGG + Exonic
1084028838 11:66468883-66468905 CTGGCCCAAGGGCACACAGCTGG + Exonic
1084393976 11:68896842-68896864 CAGGCACAAGGGCAGGCACAGGG + Intronic
1084424484 11:69077039-69077061 ATGGCACGAGGGCAGGTGGAGGG - Intronic
1084748587 11:71189132-71189154 CTGGAACAAGGGGAGGGAGAGGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089207968 11:116780270-116780292 CTGGCCCAGTTGAAGGTAGAGGG + Intronic
1089207999 11:116780465-116780487 CTGGCCCAGTTGAAGGTAGAGGG - Intronic
1089625743 11:119749540-119749562 CCTGCCCAAGGCCAGTTAGATGG - Intergenic
1090991755 11:131823486-131823508 CTGGCCACAGGTCAGCTAGAGGG - Intronic
1202826755 11_KI270721v1_random:92488-92510 CTGGCCCAAGGAGAGGGAGTGGG - Intergenic
1091781541 12:3217198-3217220 GAGGCCCAGGGGCAGGTGGAAGG - Intronic
1091984803 12:4900732-4900754 CTGGCACATGGCTAGGTAGAAGG + Intergenic
1096002431 12:48140857-48140879 CTGGCCAAGGGGCAGGTATGGGG + Exonic
1096573588 12:52539157-52539179 CTGGGACAAGGGAGGGTAGAGGG - Intergenic
1097992040 12:65845944-65845966 ATGGCCAAAGGGCAGGCAGCAGG - Intronic
1100759817 12:97794907-97794929 CTGGGCAAAAGGCAGGGAGAGGG - Intergenic
1102785630 12:115602247-115602269 CCTGCCCAAGGACAGGTAGTTGG - Intergenic
1103292391 12:119857515-119857537 TTGGCCCAGGAGCAGGTAGGAGG - Exonic
1103562921 12:121801362-121801384 CTGCCCCAAGGGCGAGAAGACGG - Intronic
1103934738 12:124469127-124469149 CTGGCCCAAGGTCAGATGGAAGG + Intronic
1105759760 13:23503216-23503238 CTGGGGCAAGGGCAGGAACATGG - Intergenic
1106133502 13:26958257-26958279 GTGCTCCATGGGCAGGTAGAGGG + Intergenic
1106255579 13:28019607-28019629 GTGGGCAAAGTGCAGGTAGATGG - Intronic
1110915967 13:81021207-81021229 TTGTCCCAAGGGCAGGTTGGAGG - Intergenic
1113666137 13:112143196-112143218 CTGGCCTCAGGGCTGGTACATGG + Intergenic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1115028646 14:28768496-28768518 CTGGCCCGCGAGCAGGTTGACGG - Exonic
1115137742 14:30131318-30131340 CTTGCCCAAGGGCACATAGCTGG + Intronic
1116754340 14:48927062-48927084 ATGGCAGAAGGGCAGGGAGATGG + Intergenic
1119220489 14:72902558-72902580 CTGGCCCAAGGCCTAGCAGATGG + Intergenic
1122599585 14:102914654-102914676 CTGGGCACAGGGCAGGAAGAGGG + Intergenic
1122644901 14:103187894-103187916 CAGGATCAAGGGCAGGTAAAAGG - Intergenic
1122647650 14:103206058-103206080 CAGGCTCAAGGGCAGGTGAAGGG - Intergenic
1122808961 14:104278392-104278414 CTGGCCCAAGGGGAGGCAGGAGG - Intergenic
1123003211 14:105307673-105307695 CTTGCCCAAGGCCAGGCAGCAGG - Exonic
1202900614 14_GL000194v1_random:34453-34475 CATGTCCAAGGGCAGGAAGAAGG - Intergenic
1123432586 15:20231343-20231365 CAGGCCCTAGGGGAGGCAGAGGG - Intergenic
1124243814 15:28053431-28053453 CTGGCACAGGGGCTGGGAGAGGG - Intronic
1125342154 15:38685780-38685802 CTTGCCCAAGGTCATGTAGCTGG + Intergenic
1125676569 15:41505300-41505322 CTGGCCCTGGGTCAGGCAGAGGG + Exonic
1126228711 15:46300212-46300234 CTTGCCCAAGGTCACGTAGCTGG - Intergenic
1127758324 15:62113950-62113972 CTGCCCTGAGGGCAGGTGGAGGG - Intergenic
1128349198 15:66877825-66877847 CTGACCCAAGCCCAGGTGGAAGG + Intergenic
1129146018 15:73648129-73648151 CTGGCTCTAGCGCAGGGAGAGGG - Intergenic
1129297620 15:74608618-74608640 CTGGCCCAGGGGCAGGTGGGAGG - Intronic
1129775478 15:78233715-78233737 CTGGCCAGAAGGCAGGAAGAAGG - Intronic
1129876660 15:78979786-78979808 CTGGTCCAAGGCCACGTGGACGG - Intronic
1130012144 15:80160278-80160300 CTGGCCCCAGGCCAGCCAGAAGG + Intronic
1131559140 15:93424347-93424369 CTGGCCCAGGGGGTGGTGGAGGG - Intergenic
1132294505 15:100725616-100725638 CAGGCCCAAGAACAGGTGGAGGG - Intergenic
1132656216 16:1043034-1043056 CTGGCCGAGGGGCGGGCAGAGGG - Intergenic
1133969146 16:10554697-10554719 CAGGCACAAGGGCAGGCATAGGG - Intronic
1135731230 16:24896703-24896725 CTTGCCCAAGGTCAGATAGGCGG + Intronic
1136385953 16:29926106-29926128 CTGGCCCAAGGGCTGGGGGCCGG - Exonic
1136852050 16:33619813-33619835 CAGGCCCTAGGGGAGGCAGAGGG + Intergenic
1137249778 16:46732960-46732982 TGGGCCCAGGGGAAGGTAGAGGG - Intronic
1137670432 16:50275229-50275251 CTGGCCCACAGGCAGGTGCATGG + Intronic
1139046014 16:63061229-63061251 CTTGCCCAAAGTCAGGTAAAGGG + Intergenic
1141793076 16:86249786-86249808 CTGACCCCAGGGCAGAGAGAGGG - Intergenic
1142150563 16:88510793-88510815 CTGGCCCAAGGGTAGGCAGTGGG - Intronic
1203113649 16_KI270728v1_random:1468281-1468303 CAGGCCCTAGGGGAGGCAGAGGG + Intergenic
1143680791 17:8474743-8474765 CTGTCCAAAGGGAAGGGAGAAGG + Exonic
1144467680 17:15509312-15509334 CTGGACCAAGGGGAGGTGGTAGG + Intronic
1147176329 17:38658357-38658379 CTGGCCTAAGGGGAGGTCCACGG + Intergenic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1147577279 17:41610075-41610097 CTGACTCCAGGGCAGGGAGAAGG + Intronic
1148021219 17:44555267-44555289 CTGGCCCTAGGCCAGGAAAACGG + Intergenic
1148151922 17:45402160-45402182 CTGGCTCAGGGGCAGGGAAAGGG + Intronic
1148161259 17:45451450-45451472 CTCCTCCAAGGGCAGGCAGAAGG + Intronic
1150229905 17:63544146-63544168 GTGTCCCCAGGGCAGGTAGGGGG + Intronic
1150247794 17:63689264-63689286 CTGGCCAAAGGGAAGGTGTATGG - Intronic
1150410728 17:64938886-64938908 CTCCCCCAGGGGCAGGCAGAAGG - Intergenic
1151939287 17:77282537-77282559 ATGGCCCAAAGGCAGGGGGATGG - Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1153424210 18:4944946-4944968 CTAGCCCAAGGGCAGGGGCAGGG - Intergenic
1153816060 18:8791211-8791233 CTGGCCCCAGGGCAGGGAGCAGG + Intronic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1158177316 18:54671058-54671080 CTTGACCAAGGGCTGGTAGGGGG - Intergenic
1158668568 18:59454782-59454804 CTTGGCCAAGGCCAGGTGGAAGG - Intronic
1158894641 18:61901395-61901417 CTGGACCTGGGGCAGGTACAGGG - Intergenic
1160573674 18:79835723-79835745 GTGGCTCTAAGGCAGGTAGAGGG + Intergenic
1161457191 19:4375314-4375336 CTGGCCCAAGGCCAGACAGCAGG + Intronic
1161482880 19:4519529-4519551 CTGTCTCAGGGGCAGGTAGGAGG - Intergenic
1161530375 19:4785380-4785402 CTGGCGCGGGGGCAGGTAGCGGG + Intergenic
1162110289 19:8396385-8396407 CTGCCCCAAGGGCAGGAATCAGG - Intronic
1163045518 19:14638648-14638670 CAGTCCCAAGGGCAGGTTGAAGG - Intronic
1163291650 19:16383272-16383294 AGGGCCCAAGGACAGGCAGAGGG + Intronic
1163449225 19:17365775-17365797 CTTGTCCAGGGGCAGGCAGAGGG + Exonic
1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG + Intronic
1165028833 19:32982733-32982755 CAGGCCCTAGGGGAGGCAGAGGG - Intronic
1165794801 19:38512494-38512516 CTGACCCAAGGGCAGGTTGCGGG + Intronic
1165849234 19:38839725-38839747 CTGTCCCATGGGAAGGCAGAAGG + Intronic
1166359625 19:42247750-42247772 CTGGCCCATGGGCAGGCGGGTGG - Exonic
1166786160 19:45368594-45368616 CTGGGCTAAGGGCAAGGAGAAGG + Intronic
1167045213 19:47045581-47045603 CAGGCCCAGGGGCGGGTAAAAGG - Exonic
1167360965 19:49030150-49030172 GTGGCCCAGGGGTAGGTGGAGGG + Intronic
1167363450 19:49042542-49042564 GTGGCCCAGGGGTAGGTGGAGGG + Intergenic
1167367291 19:49061530-49061552 GTGGCCCGGGGGCAGGTGGAGGG - Exonic
1168243657 19:55099272-55099294 CTGGTCCAAGGGGAGGGACAAGG - Intronic
925801594 2:7607457-7607479 CTGGCCCAAGAGCATGGAGAAGG - Intergenic
926126680 2:10276648-10276670 CTGGCCCAGGGGTGGGTGGAGGG - Intergenic
927146281 2:20168583-20168605 CCAGGCCAAGGGCAGGCAGATGG + Intergenic
927374191 2:22394212-22394234 CTGGCACAAAGGCAGTAAGAAGG - Intergenic
927853174 2:26512622-26512644 CTGGCCCAGGGGCAGGTATAGGG - Intronic
930377548 2:50587067-50587089 CTCGCCCAAGGTCAGGGAGCTGG - Intronic
930377826 2:50589767-50589789 CTTGCCCAAGGTCAGGGAGCTGG + Intronic
931248776 2:60512427-60512449 GTGGCACAGGGGCAGGTAGAAGG - Intronic
931746846 2:65298435-65298457 CTTGCCCAAGGTCACATAGAAGG + Intergenic
932405945 2:71512772-71512794 CTGGCCCCAGGTCAGGCACAGGG - Intronic
932494627 2:72140245-72140267 CTGGCACAAGGGCATGCAGAGGG + Intronic
933258215 2:80104315-80104337 CTGTCCCAAAGGCAGATAGATGG + Intronic
933687603 2:85155766-85155788 CTGGCCCTAGGACAGGTATCAGG - Intronic
934945085 2:98534958-98534980 CTTAGCCAAGGGCAGGTGGAGGG + Intronic
935170574 2:100608451-100608473 ATGGCACAAGGGCAGTGAGATGG - Intergenic
936381902 2:111993841-111993863 CTGGTTCAAGGGCAGGTGGCAGG + Intronic
936943835 2:117913185-117913207 TTGGCCCAAGGACAGGATGAAGG - Intergenic
937097629 2:119245963-119245985 CTGGCCCAAGGGATGGTAACAGG + Exonic
938209005 2:129449287-129449309 CTAACCCAAAGGCAAGTAGAAGG + Intergenic
938236903 2:129712625-129712647 CTGGCCCAAGGCCACACAGAGGG + Intergenic
938581608 2:132651506-132651528 CTGGCATAAGGGCAGTCAGAAGG + Intronic
939776546 2:146394437-146394459 CTGACAGAAGGGCAGGTACATGG + Intergenic
944676311 2:202035836-202035858 CTGGCCATGGGCCAGGTAGACGG + Exonic
946276805 2:218637744-218637766 ATGGCTCAAGGACAGGGAGAAGG + Intergenic
946957260 2:224944594-224944616 CTTGCCCAAGGTCATATAGATGG + Intronic
947250391 2:228096444-228096466 CGTGCTCAAGGGCAGGGAGAGGG - Intronic
947834652 2:233166612-233166634 CTGGCCCCAGGGCAGAGAGGAGG - Intronic
948198495 2:236112746-236112768 CTGGTCCCTGGGCAGGTTGAAGG + Intronic
948205841 2:236162512-236162534 CTGCCCCAAGAACAGGGAGATGG + Intergenic
948264806 2:236628659-236628681 CTGGCCCATGGGCAGGGACAAGG + Intergenic
948600692 2:239106106-239106128 CTGGGCCAGGGGCTGGCAGAGGG - Intronic
1168807617 20:681738-681760 CTTGCCCAAGGGCATGTGGCAGG + Intergenic
1171893781 20:30742132-30742154 CATGTCCAAGGGCAGGAAGAAGG + Intergenic
1172130021 20:32649485-32649507 CTGGCCCAAGGCCACAGAGATGG + Intergenic
1172192577 20:33070855-33070877 CTGGCCCAAGTGCAGATTCAGGG - Intronic
1174408258 20:50317156-50317178 CTGACGCATGGGCAGATAGATGG - Intergenic
1175371612 20:58496391-58496413 CTGCCCCCAGGCCAGGCAGAGGG + Intronic
1175949843 20:62577596-62577618 CTCGCCCAAGGGCAGCTGGAGGG + Intergenic
1176619989 21:9049231-9049253 CATGTCCAAGGGCAGGAAGAAGG - Intergenic
1179210134 21:39317485-39317507 ATGGCCCAAGGGCATATAGCTGG + Intronic
1180139270 21:45881675-45881697 CTGGCACAAGTTCAGTTAGACGG - Intronic
1181015028 22:20063801-20063823 CTGGCCCATTGGCAGGTGCAGGG + Intronic
1181780153 22:25186669-25186691 CTGGACCACGGGCAGTGAGAGGG + Intronic
1181947256 22:26527988-26528010 CTGGATCAAGGACAGGGAGAGGG - Intronic
1182572188 22:31247892-31247914 CTGTCCCCAGGACAGGCAGAGGG + Intronic
1183543051 22:38441016-38441038 CTGGGCCAAGGGCATGGAAAAGG + Intronic
1183964990 22:41436288-41436310 TGGCCCCACGGGCAGGTAGATGG + Exonic
1184804003 22:46780680-46780702 GCGGCCCAAGGACAGGGAGAGGG + Intronic
1185285769 22:49999455-49999477 CTGGCTGTAGGGCAGGAAGACGG + Exonic
949294629 3:2507182-2507204 CTGGCCCAAGGGAAGCATGATGG - Intronic
949913782 3:8940053-8940075 CTGGCCCAAGGGCCGAGTGAAGG + Intronic
953143477 3:40250850-40250872 CTGCCCAAAGGGCAGGGAGATGG + Intronic
954582729 3:51711848-51711870 CCGGCCAAGGGCCAGGTAGAGGG - Intronic
954794069 3:53152595-53152617 CAAGCCCAAGGCCAGGTAGCAGG - Intergenic
955319482 3:57964110-57964132 CTTGCCCAAGGTTAGGTAGCTGG - Intergenic
956015812 3:64881442-64881464 CTGGCCCATGCGCAAGGAGAAGG + Intergenic
960139626 3:114139614-114139636 CACTCCAAAGGGCAGGTAGAAGG + Exonic
961448493 3:126992023-126992045 CTGGGCCAAGGGCAGGGCAAGGG + Intronic
961450235 3:126999353-126999375 CGGGCCCCAGGGCTGGGAGAAGG - Intronic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
961577770 3:127852130-127852152 CTGGCCATATGGCAGGTGGAGGG - Intergenic
961791606 3:129380605-129380627 CTGTCCCCAGGGCAGGGAGCAGG + Intergenic
962236340 3:133710651-133710673 CGCACCCAAGTGCAGGTAGAGGG - Intergenic
962875687 3:139534496-139534518 CAGGGCCATGGGCATGTAGAGGG - Intronic
963009229 3:140753704-140753726 CAGGCCCATGGGGATGTAGATGG - Intergenic
963043612 3:141086880-141086902 CTTGCCCAAGGTCACGTAGCTGG + Intronic
963984574 3:151576902-151576924 CAGCCCCAAGGGCTGGTAGCTGG - Intergenic
965084697 3:164079912-164079934 CTGCCCCAAAGGCAGAAAGAAGG - Intergenic
966940244 3:184741491-184741513 CTGCCCCAAGGGCTGTCAGATGG - Intergenic
968771924 4:2512905-2512927 CTGCCCCAAGGGCATGTGGGAGG - Intronic
969521422 4:7679983-7680005 CTGTCCTCAGGGCAGGTAGAAGG - Intronic
971185350 4:24370613-24370635 CTGGCCCAAGGCCAGCCACAAGG + Intergenic
971263088 4:25074904-25074926 CTGGCCCAGGGACAGGATGACGG + Intergenic
971924287 4:32986796-32986818 CTGGCTCAAGGGCACTTGGAAGG - Intergenic
972310511 4:37877971-37877993 CTGGCCCCAGGGCTGCTAAAAGG - Intergenic
972869845 4:43284094-43284116 CTGGTCCAAGGACAGGGAGAGGG - Intergenic
973610895 4:52635249-52635271 ATGGCCAAAGGGCAGGGTGAGGG - Intronic
974107208 4:57483801-57483823 CTGGCCTCTGGGAAGGTAGAAGG + Intergenic
977597065 4:98894986-98895008 CAGGCCCAAGGACAAGAAGATGG + Intronic
979542791 4:121905273-121905295 CTGGGCCAAGGGTAGGGAGAAGG + Intronic
982586432 4:157247171-157247193 CTGGCACAAGGCCAGGCACAGGG - Intronic
984133343 4:175905536-175905558 CTGGCACAAGAGAAGGGAGAAGG + Intronic
1202771189 4_GL000008v2_random:209117-209139 CATGTCCAAGGGCAGGAAGAAGG + Intergenic
986236415 5:5914642-5914664 CTTGTCCCAGAGCAGGTAGAAGG - Intergenic
987001693 5:13666529-13666551 CTTGCTCAAGGTCATGTAGATGG - Intergenic
988446405 5:31290683-31290705 CTGGCCCCAGGGGAGTTTGATGG + Intronic
990491088 5:56303704-56303726 CTGGTCCAAGGCCTGGGAGATGG + Intergenic
993542890 5:89174298-89174320 CTAGACTAAAGGCAGGTAGAAGG - Intergenic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
995017712 5:107330628-107330650 CTGTCCCAAGGGCAGGTTTCAGG - Intergenic
995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG + Intergenic
996492563 5:124115290-124115312 CTGGCACAAGGCCAGGCATATGG - Intergenic
997358121 5:133277612-133277634 CTTGCCCAGGGGCAGAGAGAAGG - Intronic
997367849 5:133337142-133337164 CTGGTGCAAGGGCAGGTTGGGGG - Intronic
999271458 5:150298540-150298562 CTGGTCCAGGGGCAGGCAGTTGG + Exonic
999977571 5:156927105-156927127 CTGCTGGAAGGGCAGGTAGAGGG + Intronic
1000126928 5:158254549-158254571 CTGGCTCAAGGCCAGGAACACGG + Intergenic
1005682065 6:28217620-28217642 CCGGCCCCAGGGCAGGTAGACGG + Intergenic
1006152295 6:31995986-31996008 TTGGCCCAGGAGCAGGTAGGAGG + Exonic
1006158598 6:32028724-32028746 TTGGCCCAGGAGCAGGTAGGAGG + Exonic
1006400505 6:33814591-33814613 CTGGCCCAAAGGCTGGATGAGGG + Intergenic
1006592311 6:35167380-35167402 CTGGCACAAAGGCAGGTACATGG - Intergenic
1006640396 6:35486498-35486520 CCGGCCGCAGGGCGGGTAGATGG + Exonic
1007303904 6:40889897-40889919 ATGGGCCAAGGGCAGATGGAAGG - Intergenic
1007392535 6:41558349-41558371 CTGAACCAAGGGCTGGGAGAGGG + Intronic
1007549395 6:42717439-42717461 CCGGCAAAAGGGCAGGGAGAGGG - Intronic
1007697918 6:43745173-43745195 CCAGCCGAAGGGGAGGTAGACGG + Intergenic
1008712670 6:54247656-54247678 GTGGCCCAATGCCAGGAAGATGG + Intronic
1010660614 6:78566777-78566799 CAGGCCCAAGCCCAGGTAGCAGG + Intergenic
1011801460 6:91020720-91020742 TTGGCCCTAGAGCAGGGAGAGGG - Intergenic
1011986302 6:93451030-93451052 CTAGTCAAAGGGCAGGAAGAAGG + Intergenic
1012276793 6:97283533-97283555 CTGGCCCCAGAGCGGGAAGAGGG - Intergenic
1012643755 6:101654439-101654461 CTTTCCCAAGGTCAGGTAGTTGG + Intronic
1012996370 6:105979782-105979804 CACCCCCAGGGGCAGGTAGATGG + Intergenic
1014254161 6:119144800-119144822 CTGGCCTAGGGGGTGGTAGATGG + Intronic
1016487001 6:144552064-144552086 AAGGCCCAAGGGCAGAAAGACGG - Intronic
1018663690 6:166113835-166113857 CTGGCCCCAGGGCAGGCAGAAGG + Intergenic
1019491204 7:1314400-1314422 CAGGCCCAAGAGCAGGTCGGAGG - Intergenic
1019581070 7:1763456-1763478 CTTGCCCAAGGCCAGGAAGCTGG + Intergenic
1021386012 7:20031413-20031435 CTTGCCTAAGGTCAGGTAGCTGG - Intergenic
1022492552 7:30832059-30832081 TTGGCCCAAGTGCAGGGAGTTGG - Intronic
1023161724 7:37303065-37303087 GTGACCCAAGGGCAGGCATAGGG - Intronic
1027343641 7:77235672-77235694 CTGGCAGAAGGGCAGTTAGGAGG + Intronic
1027463022 7:78478890-78478912 CTGGCCGAAGGGCAAGGAAAGGG + Intronic
1029371776 7:100155080-100155102 CTTGTCCGGGGGCAGGTAGAGGG + Exonic
1029386391 7:100246463-100246485 GTGGCCCAATGGCAGGTGGTCGG - Intronic
1029481678 7:100817220-100817242 CTGGCCGAAGGGCCCGTAGCCGG + Exonic
1031064595 7:117091252-117091274 CAGGGCCAAGGGCAAGGAGAGGG + Intronic
1031627752 7:124009802-124009824 CTGGCCCATGGGAAGGAAGAGGG + Intergenic
1031857333 7:126938200-126938222 CTGGCCCATGGGAAGGGGGAAGG - Intronic
1032515818 7:132505342-132505364 CTTGCCCATGGGCAGCCAGACGG + Intronic
1032705992 7:134421762-134421784 CTGGCCCAATGAAGGGTAGAGGG + Intergenic
1033652176 7:143351822-143351844 CTGGCCCCAGGCAAGGTAGAGGG + Exonic
1034345438 7:150382614-150382636 CTGGCCCAAGGGGATGCAGCGGG - Intronic
1035854915 8:2964389-2964411 CTGGCCCAAGGGAATGTCCAGGG + Intronic
1035931409 8:3783948-3783970 TTTGCCCAAGGGCAGGTAATAGG - Intronic
1037140397 8:15512358-15512380 CTGGCCCAAAGGCAGTCAGCTGG - Intronic
1039491780 8:37953186-37953208 CAGGCCCAAGGGGAGGCACAAGG + Intergenic
1041978931 8:63832860-63832882 CTGGCCCAAGGGCAGGAAGCTGG - Intergenic
1042325075 8:67519728-67519750 CTTGCCCAAGGGCTGACAGATGG - Intronic
1045094347 8:98782246-98782268 CTGCCAGAAGGGCAGGTACATGG + Intronic
1045976140 8:108132066-108132088 CTGGCCCTATGGCAAGCAGACGG - Intergenic
1047503026 8:125456753-125456775 CTTGCCCAAGGGCATGCAGCTGG - Intergenic
1047792894 8:128222830-128222852 GTGGGCCAAGGGGAGGTACAGGG - Intergenic
1049468330 8:142763902-142763924 CTGGCCCAGGGGCATGTATGAGG + Intergenic
1049617628 8:143582560-143582582 CAGGCCCAAGGACAGGGAAAAGG + Intronic
1050264776 9:3878752-3878774 CTTGCCCAAGGGCAAGTGTATGG - Intronic
1053618454 9:39792912-39792934 CTTGCCCAACATCAGGTAGAAGG + Intergenic
1054265701 9:62914517-62914539 CTTGCCCAACATCAGGTAGAAGG - Intergenic
1054354850 9:64050559-64050581 CATGTCCAAGGGCAGGAAGAAGG - Intergenic
1056526429 9:87447018-87447040 CTGTCCAATGGGCAGGTAGGAGG - Intergenic
1056664696 9:88572256-88572278 TTGTCCCAAGGGCAGGCACAAGG - Intronic
1056783318 9:89568204-89568226 CTTGCCCAAGGAAAGGTAAAGGG - Intergenic
1059332978 9:113548190-113548212 CTTGGCCAAGGGCATGTAGTCGG + Intronic
1060723410 9:125992723-125992745 CTTGCCCAGGGGCAGCCAGAAGG - Intergenic
1061498701 9:130990248-130990270 CTGGCCCAAGAGCACGGGGAGGG - Intergenic
1061539697 9:131271532-131271554 CTGGCCCAAGGGTTGGGAGCTGG + Intronic
1061875676 9:133542397-133542419 CTGGACCCAGGGCATGCAGAGGG + Intronic
1061894757 9:133641427-133641449 GTGGCCCCAGGCCAGGTATAGGG + Intronic
1062546517 9:137066081-137066103 ATGGCCCAGGGTCAGGCAGAGGG - Intronic
1062707898 9:137955323-137955345 CTGGCACAAGGGGAGGGAGGAGG + Intronic
1203743188 Un_GL000218v1:19689-19711 CATGTCCAAGGGCAGGAAGAAGG - Intergenic
1203566916 Un_KI270744v1:99826-99848 CATGTCCAAGGGCAGGAAGAAGG + Intergenic
1185973386 X:4690517-4690539 CTGGCCCAAAGTCTGGCAGATGG - Intergenic
1186381492 X:9064889-9064911 CTGGCCCCAAAGCAGGGAGAAGG - Intronic
1187075408 X:15929703-15929725 CTTGCCCAAGTCCAGGCAGACGG - Intergenic
1188307509 X:28576219-28576241 CTGGCTCAAGTGGAGGAAGACGG + Intergenic
1200100078 X:153685885-153685907 CTGGCCCAGGGGCTGGTAGTGGG + Intronic