ID: 1163593099

View in Genome Browser
Species Human (GRCh38)
Location 19:18205147-18205169
Sequence AGGGTTTGAAAGCTGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163593099_1163593105 -9 Left 1163593099 19:18205147-18205169 CCCTACTCCAGCTTTCAAACCCT No data
Right 1163593105 19:18205161-18205183 TCAAACCCTCCAGGGGTGTGTGG No data
1163593099_1163593108 -1 Left 1163593099 19:18205147-18205169 CCCTACTCCAGCTTTCAAACCCT No data
Right 1163593108 19:18205169-18205191 TCCAGGGGTGTGTGGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163593099 Original CRISPR AGGGTTTGAAAGCTGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr