ID: 1163593167

View in Genome Browser
Species Human (GRCh38)
Location 19:18205381-18205403
Sequence TGGGCGTCCCAGTACTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163593167_1163593181 30 Left 1163593167 19:18205381-18205403 CCCTGGGAGTACTGGGACGCCCA No data
Right 1163593181 19:18205434-18205456 GAAATTTATTTTTTCTTTTTAGG No data
1163593167_1163593176 8 Left 1163593167 19:18205381-18205403 CCCTGGGAGTACTGGGACGCCCA No data
Right 1163593176 19:18205412-18205434 TCCCCGCACCGTTTACATTTGGG No data
1163593167_1163593175 7 Left 1163593167 19:18205381-18205403 CCCTGGGAGTACTGGGACGCCCA No data
Right 1163593175 19:18205411-18205433 GTCCCCGCACCGTTTACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163593167 Original CRISPR TGGGCGTCCCAGTACTCCCA GGG (reversed) Intergenic
No off target data available for this crispr