ID: 1163594053

View in Genome Browser
Species Human (GRCh38)
Location 19:18210736-18210758
Sequence GGTCAGAGTGGACCCCAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 2, 2: 2, 3: 38, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163594048_1163594053 7 Left 1163594048 19:18210706-18210728 CCCTTAGAGAGCTCTTTTAGGCA 0: 1
1: 0
2: 1
3: 8
4: 116
Right 1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG 0: 1
1: 2
2: 2
3: 38
4: 295
1163594047_1163594053 8 Left 1163594047 19:18210705-18210727 CCCCTTAGAGAGCTCTTTTAGGC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG 0: 1
1: 2
2: 2
3: 38
4: 295
1163594045_1163594053 29 Left 1163594045 19:18210684-18210706 CCAGGGCATCGTAAGAGGCTGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG 0: 1
1: 2
2: 2
3: 38
4: 295
1163594049_1163594053 6 Left 1163594049 19:18210707-18210729 CCTTAGAGAGCTCTTTTAGGCAA 0: 1
1: 0
2: 0
3: 10
4: 254
Right 1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG 0: 1
1: 2
2: 2
3: 38
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163594053 Original CRISPR GGTCAGAGTGGACCCCAGCC AGG Exonic
900151744 1:1181952-1181974 GGTCAGCGTGGATCTCGGCCTGG - Intronic
900188716 1:1344488-1344510 GGGCAGAGTGGACAGCAGGCAGG + Intronic
900245837 1:1635740-1635762 GGTCAGAGTGGACCCCGTCATGG - Exonic
900257062 1:1702883-1702905 GGTCAGAGTGGACCCCGTCATGG - Exonic
900318213 1:2069890-2069912 GGACAGGGTGGTCCCCAGTCAGG + Intronic
900882624 1:5392945-5392967 GGTCAGGGTGGATCCCATGCTGG + Intergenic
901378119 1:8854395-8854417 GGTCCCAGTGGACAGCAGCCCGG + Intergenic
902278161 1:15354472-15354494 GGTCACAGAGGACCCCTGCAGGG + Intronic
902529944 1:17084577-17084599 GGTAAGGGGTGACCCCAGCCTGG - Exonic
902777308 1:18682973-18682995 GGTGAGCAGGGACCCCAGCCAGG - Intronic
902841392 1:19076267-19076289 GGTCACAGTTGACCCCAGGGAGG - Intronic
903904070 1:26671165-26671187 GGTGAGAGTGCACTCCAGCCTGG - Intergenic
906313339 1:44769492-44769514 GGCCAGATTGGAGACCAGCCTGG + Intergenic
906322626 1:44826628-44826650 GGTAGGCGTGCACCCCAGCCTGG + Exonic
906376446 1:45300393-45300415 AGGCTGAGTGGTCCCCAGCCTGG - Intronic
906404723 1:45532843-45532865 GGTGACACTGGACTCCAGCCCGG - Intergenic
907123952 1:52033020-52033042 GGGCAGAGCGGATCCCCGCCAGG + Exonic
907636034 1:56135421-56135443 GGTCAGAGAGGATGCCAGGCAGG - Intergenic
907847042 1:58218363-58218385 GGTCAGGGTTGAGCCAAGCCAGG + Intronic
908238908 1:62172672-62172694 GGTCAGTTTCAACCCCAGCCAGG + Intergenic
913483403 1:119311206-119311228 GCTCAGATTGCACCCCAACCTGG + Intergenic
915331387 1:155114889-155114911 GGTCTGAGTGCACTCCAGCCTGG - Intergenic
915726216 1:158019546-158019568 GGTCAGTGTGGAGCTCAGCCTGG - Intronic
916577513 1:166080886-166080908 GGTCAGAGGGGAGCCAGGCCAGG + Intronic
916640084 1:166718070-166718092 GGTCAGACTGGACCCCAAAGGGG + Intergenic
917232999 1:172857971-172857993 GGTGAGAGAGGACCAGAGCCAGG - Intergenic
917362647 1:174194082-174194104 GGTCAGTGTTGACCCCATGCTGG - Intronic
919981059 1:202643256-202643278 GGTAAGAGGGAACCCCAGGCGGG - Exonic
921115454 1:212086597-212086619 GCTCATAGTTGAGCCCAGCCTGG - Intronic
921775948 1:219100261-219100283 GCCAAGAGTGGAGCCCAGCCTGG + Intergenic
922162913 1:223091309-223091331 GGAGAGAGTTGACCCCAGCCTGG - Intergenic
922822781 1:228495312-228495334 GGTCAGAGAGGAACCCAGTCAGG + Exonic
1062868650 10:879296-879318 GGTCAGAGTATCCCCCATCCTGG + Intronic
1062925377 10:1312341-1312363 GGTCAGAGTGAGCCCCCGGCAGG + Intronic
1064119322 10:12605517-12605539 GGTCAGAGTGGGCCCCTGAGTGG - Intronic
1064998585 10:21317425-21317447 GGTCCCACTGGACTCCAGCCTGG - Intergenic
1065047123 10:21754556-21754578 GACCAGAGGGGCCCCCAGCCTGG + Intergenic
1065871722 10:29961424-29961446 GTGCACAGTGGACCCCAGCTGGG + Intergenic
1066410233 10:35161448-35161470 GGTCCCAGTGGACTCCAGCCTGG + Intronic
1067294032 10:44964313-44964335 GGACAGAGTGTCCTCCAGCCTGG + Intronic
1067569566 10:47361434-47361456 GGCCAGAGTAGCCCCCAGGCCGG - Intergenic
1071596958 10:86935086-86935108 GGTGACACTGCACCCCAGCCTGG - Intergenic
1074586160 10:114768821-114768843 GTTCAGAGTGGTCACCAGCCCGG - Intergenic
1075690051 10:124388613-124388635 GATCAAGGTGGGCCCCAGCCAGG + Intergenic
1075710380 10:124527536-124527558 GGGCAAAGGGCACCCCAGCCTGG - Intronic
1077462050 11:2715581-2715603 GGTCCCAGGGGACCCCAGCAGGG - Intronic
1078133390 11:8632497-8632519 CGTCTGACTGCACCCCAGCCTGG - Intronic
1080849956 11:36059604-36059626 GGTAAGAGGGGACAGCAGCCAGG - Intronic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1080990878 11:37533274-37533296 GGTCTTATTGGACCCCACCCAGG - Intergenic
1083687194 11:64383615-64383637 GGTCTGGGTTGACCCCAGGCAGG - Intergenic
1084091919 11:66884366-66884388 GGTCCCAGTGCACTCCAGCCTGG + Intronic
1084180025 11:67441572-67441594 GGGCAGAGTGGGCCTCAGCCTGG - Intronic
1088059077 11:105623536-105623558 GACCAGAGTGGACCCCAGAATGG - Intronic
1089559698 11:119337691-119337713 GGGCAGACTGGACTCCAGGCAGG - Intergenic
1089893527 11:121904704-121904726 GGTCAGAGTTGAGGCCAGCCTGG - Intergenic
1090330945 11:125931896-125931918 GGTCCCCGTGGACCCCAGCTGGG - Intergenic
1091663179 12:2399527-2399549 GGTCAGAGAGGAGTTCAGCCGGG - Intronic
1091740324 12:2956621-2956643 GGTCGGAGGGGAATCCAGCCAGG - Intergenic
1091772658 12:3163064-3163086 GCTCTGTGTGGACCGCAGCCAGG - Intronic
1095941097 12:47727392-47727414 TGTCAGAGTGGAGTACAGCCTGG + Intergenic
1095942731 12:47737364-47737386 CCTCGGAGTGGACCCGAGCCAGG - Exonic
1096252353 12:50041209-50041231 GGTCAGAATGGAGCCCATCCTGG + Intergenic
1097447078 12:59684657-59684679 GGGCAGAGTGGAACCCAGTCAGG + Intronic
1101095859 12:101340229-101340251 GGTTAGAGTGAACTCCAGTCTGG - Intronic
1101441670 12:104708673-104708695 TGTCAGAGGGGAGCCCAGCCTGG - Intronic
1103964590 12:124630690-124630712 GGGCACAGTGGACCCCAGGATGG + Intergenic
1104854620 12:131895919-131895941 GGGCCCAGTAGACCCCAGCCTGG - Intronic
1106375368 13:29181416-29181438 TGTCACACTGGACACCAGCCTGG + Intronic
1108707808 13:53005958-53005980 GGTCTGAGCGGATCACAGCCAGG + Intergenic
1109301315 13:60592854-60592876 CTTCAGAGTTGCCCCCAGCCAGG - Intergenic
1112015134 13:95325441-95325463 GGTCACACTGTACTCCAGCCTGG + Intergenic
1114606340 14:24000958-24000980 GGTGAGAGGGGACCCCACACAGG + Intronic
1115141486 14:30176540-30176562 AGCCACAGTGCACCCCAGCCGGG - Intronic
1115575494 14:34706685-34706707 GGTGAGATTGCACTCCAGCCTGG + Intergenic
1115651083 14:35403655-35403677 GGTCAGAGAGAACCCGGGCCAGG + Intronic
1118974512 14:70665213-70665235 GGTCAGAGAGGACTTCAGGCAGG + Intronic
1124025000 15:25957791-25957813 GGGAAGAGTGGACCCCGGCTGGG + Intergenic
1124496759 15:30191998-30192020 GGTAAGAGGGAACCCCAGGCGGG - Intergenic
1124662380 15:31560818-31560840 GGTCAGTGTGGACCTCAGAGGGG - Intronic
1124746817 15:32346649-32346671 GGTAAGAGGGAACCCCAGGCGGG + Intergenic
1124954414 15:34350724-34350746 GGTCATAGTGGGCTTCAGCCGGG - Exonic
1125605049 15:40935371-40935393 GGTCAGAGGCCACCCCAGCCAGG - Intronic
1127877328 15:63122293-63122315 GGGCTGAGTGGACCCCACCCGGG + Intronic
1128345061 15:66848313-66848335 GGTCGGAGGGGAGGCCAGCCAGG - Intergenic
1128977350 15:72163398-72163420 GGGCAGGCAGGACCCCAGCCTGG + Exonic
1129524463 15:76205011-76205033 GTCCAGAGTGGTTCCCAGCCAGG + Intronic
1129986686 15:79924539-79924561 GGTCAGGGTCGAGACCAGCCTGG - Intergenic
1131157359 15:90083479-90083501 GGTGAAAGTGAACCCAAGCCTGG + Exonic
1131622536 15:94082812-94082834 GGGCAGAGGAGACCCGAGCCCGG + Intergenic
1132500217 16:281667-281689 GGCCAGAGGGGGCTCCAGCCTGG + Intronic
1132583523 16:695834-695856 GCTCAGGCTGGACCACAGCCCGG + Exonic
1132692460 16:1187687-1187709 GGTCAGAGTGGCCCCCAAGCAGG - Intronic
1132702987 16:1229862-1229884 GGGCAGGGTGGACCCCGGCTGGG + Intronic
1132705336 16:1241006-1241028 GGGCAGGGTGGACCCCGGCTGGG - Intronic
1132708467 16:1256369-1256391 GGGCAGGGTGGACCCCGGCTGGG - Intronic
1132871534 16:2117703-2117725 GGTCAGTGTGGGCCCAAGACGGG + Intronic
1134520995 16:14919192-14919214 GGTCAGTGTGGGCCCAAGACGGG - Intronic
1134550577 16:15136781-15136803 GGTCAGTGTGGGCCCAAGACGGG + Intronic
1134708671 16:16317843-16317865 GGTCAGTGTGGGCCCAAGACGGG - Intergenic
1134715884 16:16357876-16357898 GGTCAGTGTGGGCCCAAGACGGG - Intergenic
1134950933 16:18350802-18350824 GGTCAGTGTGGGCCCAAGACGGG + Intergenic
1135667597 16:24349131-24349153 AGGCAGAGTGAACACCAGCCAGG - Intronic
1136778480 16:32883727-32883749 ACTCAGGGTGGCCCCCAGCCAGG + Intergenic
1136892140 16:33977787-33977809 ACTCAGGGTGGCCCCCAGCCAGG - Intergenic
1138298373 16:55906408-55906430 GGTCACAGAGGAGCCAAGCCAGG + Intronic
1139558516 16:67727643-67727665 GGAAAGAGTGGGCTCCAGCCAGG - Intronic
1139594282 16:67949008-67949030 GGTGGGCGAGGACCCCAGCCTGG + Intronic
1139632305 16:68237913-68237935 TGTAAGAGTGGAACCCAGACAGG - Intronic
1141485855 16:84339861-84339883 GGTCACTGAAGACCCCAGCCAGG + Intergenic
1141504428 16:84465298-84465320 GGTCAGAGTGGACCCCTGCCAGG + Intergenic
1141530385 16:84642409-84642431 GGTCACTGAGGTCCCCAGCCAGG - Intergenic
1142133647 16:88442078-88442100 GGTCAGAGTAGACCCCTGACTGG + Intergenic
1142221221 16:88856246-88856268 GGTAAGACTGGAGCCCAGCGGGG + Intronic
1142262862 16:89050806-89050828 GGGCAGGGTGGGCCCCAGCATGG - Intergenic
1203080902 16_KI270728v1_random:1145836-1145858 ACTCAGGGTGGCCCCCAGCCAGG + Intergenic
1142933917 17:3311313-3311335 GGTGACAGTCCACCCCAGCCAGG - Intergenic
1143448420 17:7022088-7022110 GGTCTGAGCGCACCCCAGGCCGG + Intergenic
1143598448 17:7929356-7929378 CGTCTGTGTGGACCCCGGCCGGG - Exonic
1144295406 17:13870463-13870485 GGTTAGCGTGGACCACAGCAAGG - Intergenic
1144954338 17:19011620-19011642 GGGCAGGGTGGGCCCCAGACGGG + Intronic
1145151710 17:20516076-20516098 GGGAAGAGAGGACCCCAGGCAGG - Intergenic
1145238906 17:21228138-21228160 GGAGAGAGTGGCCCCCAGGCAGG - Intergenic
1145900489 17:28487753-28487775 GGTCAAAGTGGCCCCAATCCTGG + Intronic
1146382910 17:32344545-32344567 AGGCAGAGTGCACTCCAGCCTGG + Intronic
1147662744 17:42125715-42125737 GGTTAGAGTGGATTCCAGTCGGG + Exonic
1147839862 17:43363610-43363632 GATCAGAGTGGCTCCCAGGCAGG - Intergenic
1148739849 17:49886554-49886576 GGAGAGAGTGGATCTCAGCCTGG - Intergenic
1149090496 17:52772399-52772421 GGTCACATTGCACTCCAGCCTGG + Intergenic
1149545591 17:57501216-57501238 GGTCAGCTTGGACCCTAGCAGGG - Intronic
1151835903 17:76582647-76582669 GATTAGAGTGGAGCCCAGTCTGG - Intronic
1151837324 17:76590974-76590996 AGTGAAAGTGGACTCCAGCCTGG - Intergenic
1152168349 17:78725668-78725690 CGACAGAGTGGATCACAGCCGGG + Intronic
1152388887 17:79991529-79991551 AGTGAGTGTGCACCCCAGCCCGG + Intronic
1152591268 17:81213808-81213830 GGACAGTGTGGACCCCAGACAGG + Intronic
1152643964 17:81460426-81460448 GGACACAGTGGAGCCCAGGCAGG - Intronic
1153707068 18:7756918-7756940 GCCCAGTGTGGACCCCAGCTTGG + Intronic
1154195162 18:12260238-12260260 GGCCACAGTGCACTCCAGCCTGG - Intronic
1156844495 18:41648612-41648634 GGTCAGAGTGGAAGCAAACCAGG - Intergenic
1157718172 18:49903592-49903614 GGTCAGGGTGGAGCACACCCTGG - Intronic
1158137469 18:54223848-54223870 GGTGAGAGTTGACCCCAGTGCGG - Intronic
1159043965 18:63351034-63351056 GGGCAGCGTGTACCCCAGCCGGG - Exonic
1160099285 18:75905063-75905085 GTTCAGAGGGGTCCCCAGCGTGG - Intergenic
1160819676 19:1052231-1052253 GGGCAGTGTGGACACCAGGCAGG + Exonic
1160831191 19:1105555-1105577 GGTCGGGGTGGGCTCCAGCCTGG + Intronic
1160924196 19:1535261-1535283 GGTCAGAGTGGACCCCTGCATGG + Exonic
1161139515 19:2639373-2639395 GGTCAGCAAAGACCCCAGCCTGG + Intronic
1161161711 19:2765359-2765381 GGTCTGTGTGGACACCAGGCCGG - Intronic
1161833329 19:6626369-6626391 GGTGACAGTGCACTCCAGCCTGG + Intergenic
1163004355 19:14388405-14388427 GGTCAGAGGGGATCCCAGGGTGG - Intronic
1163018163 19:14469517-14469539 TGTGAGCCTGGACCCCAGCCCGG + Exonic
1163063108 19:14774329-14774351 GGTCAGAGGGGATCCCAGGGTGG + Intronic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1163602535 19:18257674-18257696 GGTCAGACATGACCCCGGCCCGG + Exonic
1163604709 19:18267583-18267605 GGCCAGTGTCCACCCCAGCCAGG - Intronic
1163609080 19:18291939-18291961 GGGGAGAGAGGACCCCACCCCGG + Intergenic
1163676996 19:18660280-18660302 TGTCAGAATGGCCCCTAGCCCGG + Intronic
1164643578 19:29843315-29843337 ATTCAGAGTCGGCCCCAGCCTGG - Intergenic
1164879578 19:31720802-31720824 GGGCAGGGTGGGTCCCAGCCAGG - Intergenic
1167470030 19:49670406-49670428 GGCCAGGGTGCCCCCCAGCCCGG - Exonic
1167687151 19:50963455-50963477 AGTCAGGGTGGATCACAGCCCGG + Exonic
925847708 2:8048821-8048843 ACTCAGAGTGGACTCCAGCAGGG - Intergenic
927961356 2:27242349-27242371 GGTCGGAGAGCACCCCACCCAGG + Exonic
928156893 2:28885041-28885063 GCTGAGATTGCACCCCAGCCTGG + Intergenic
929050785 2:37834911-37834933 TGTCAGAGTGCCCCCCACCCTGG - Intergenic
929879845 2:45826071-45826093 AGTCAAAGTAGACCCCACCCAGG + Intronic
931570897 2:63668231-63668253 AGTTAGAGATGACCCCAGCCAGG - Intronic
932138335 2:69251804-69251826 GAACAGAGTCCACCCCAGCCAGG - Intergenic
932428704 2:71660224-71660246 TCACAGAGAGGACCCCAGCCTGG + Intronic
932558984 2:72850763-72850785 TGTCAGTGTGGACCCCATCCCGG - Intergenic
932569999 2:72933637-72933659 GGTCAGAGGGGACCCCGGCCTGG + Intronic
933727218 2:85433787-85433809 GGTCAGCCTGGACCACAGGCAGG - Intronic
937100450 2:119264300-119264322 CGTCAGAGTTGAGCCCTGCCTGG + Exonic
937307199 2:120879558-120879580 GGTCGGATGGCACCCCAGCCAGG + Intronic
937337916 2:121072986-121073008 TGCCTGAGTGGAGCCCAGCCCGG - Intergenic
937426296 2:121801710-121801732 GGTGTCAGTGGGCCCCAGCCGGG + Intergenic
937516397 2:122660822-122660844 GGACAGAGAGGACCGCAGCCTGG - Intergenic
938817186 2:134917092-134917114 GGTGAGGTTGCACCCCAGCCTGG - Intergenic
940844527 2:158625203-158625225 GGTCAGTGGGGACCCCACTCTGG - Exonic
942334890 2:174872816-174872838 GATCAGAGTAGTCCCCAACCAGG - Intronic
944311383 2:198237414-198237436 GATCATAGTGCACCACAGCCTGG + Intronic
945142319 2:206699836-206699858 GCTCAGATTGGACCCAAGACAGG + Exonic
946851284 2:223909350-223909372 GGTCAAAGGGGAGGCCAGCCAGG - Intronic
947856436 2:233327587-233327609 GGTCACATTGCACTCCAGCCTGG - Intronic
948706037 2:239792980-239793002 GGATAAAGTGGAGCCCAGCCTGG - Intronic
948997718 2:241592185-241592207 GCTCAGAGAGGCCCCCAGCCTGG - Intronic
1171205247 20:23273980-23274002 GGGCACAGTGGGCCCAAGCCTGG + Intergenic
1172202441 20:33136039-33136061 TGCCAGAGTGCACCCCAGCAGGG - Intergenic
1172290194 20:33770418-33770440 TGCCAGGCTGGACCCCAGCCAGG - Intronic
1172781144 20:37437655-37437677 GGCCAGAGTGGAGCCTGGCCAGG - Intergenic
1172786953 20:37474705-37474727 GGTAAGAGTGGATCCAAGCAGGG - Intergenic
1173903709 20:46610464-46610486 GGTTCGAAAGGACCCCAGCCAGG - Exonic
1174197682 20:48785279-48785301 TGTCAGAGGAGACCCCAGGCAGG - Intronic
1174499783 20:50976108-50976130 GGGCAGAGTGGAGCCCATCCTGG + Intergenic
1175248348 20:57594515-57594537 GGCCACCGTGGACCCCGGCCTGG - Intergenic
1175851927 20:62098230-62098252 GGGAACAGTGGACCCCAGGCAGG - Intergenic
1175967005 20:62664786-62664808 GGTCAGAGTGGGCCAGACCCAGG - Intronic
1176008615 20:62880194-62880216 GGTCAGAGAGGACCACCCCCTGG - Exonic
1176063483 20:63182416-63182438 GGCCAGGGTGGGGCCCAGCCCGG + Intergenic
1179585716 21:42372931-42372953 GCTCTGAGTGGATCCCAGGCAGG + Intronic
1179640713 21:42745726-42745748 GGGCAGAGGGGAACCCTGCCAGG - Intronic
1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG + Intergenic
1182166831 22:28183267-28183289 GGCCAGACTGGAGACCAGCCTGG - Intronic
1183347931 22:37318261-37318283 AGGCAGAGTGGGCCCCTGCCAGG + Intergenic
1183361746 22:37386504-37386526 GGTCAGTATGGACACCAGCTGGG + Intronic
1184687678 22:46103945-46103967 GGTTGGAGTGGTCCCCAGACAGG - Intronic
949571295 3:5295878-5295900 GGTCAGGATGGACCCCAGTGAGG + Intergenic
953320154 3:41964084-41964106 GGGCAGAGGGGAGCCGAGCCAGG + Intergenic
954369023 3:50160664-50160686 GGGCTGAGTCGACCCCACCCAGG - Intronic
954459350 3:50617529-50617551 GCTCAGAGGCGGCCCCAGCCTGG - Exonic
960234326 3:115264119-115264141 GGAGAGAGGGGACCACAGCCAGG - Intergenic
960609828 3:119545290-119545312 GCTGAGATTGCACCCCAGCCTGG + Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961103978 3:124225472-124225494 GGTCAGGGAGGACCCTGGCCTGG + Intronic
961268707 3:125671554-125671576 GGCCAGAGTGGGCGCCAGCGAGG - Intergenic
961684811 3:128622444-128622466 GGTCAGAGTGGACCCAAGCCTGG - Intronic
961861356 3:129919008-129919030 GGTCAGAGTGGCTCCCATCAGGG + Intergenic
962559783 3:136593239-136593261 GGGCAGGGTGGGTCCCAGCCTGG - Intronic
963266922 3:143249123-143249145 GGTCAGAGTGGAAGCCAGTAGGG - Intergenic
964091107 3:152876615-152876637 GGTAACACTGCACCCCAGCCTGG + Intergenic
964725893 3:159814214-159814236 GTTCAAAGTGGATCCAAGCCGGG - Intronic
965358381 3:167706991-167707013 TGACAGAGTGGACTCCAGTCTGG - Intronic
967164116 3:186765453-186765475 GGTGACAGTGCACTCCAGCCTGG + Intergenic
967340936 3:188397343-188397365 GGTCATAGAGAACCCCAGCTAGG - Intronic
968518984 4:1027287-1027309 GGTCAGAGGTGACCTGAGCCTGG - Intergenic
969680202 4:8639204-8639226 GGTCAGCAGGGACCCCAGACAGG - Intergenic
971384838 4:26133100-26133122 GGCCAGAGAGGACACCTGCCTGG - Intergenic
977253239 4:94711666-94711688 GGTCAAATTCGACACCAGCCTGG - Intergenic
979045078 4:115852319-115852341 GGTCTGTGTGGGCCCAAGCCAGG - Intergenic
979867100 4:125770256-125770278 AGTCAGAGTGGTGCCCAGGCTGG + Intergenic
982398544 4:154940311-154940333 GGTCACAGTGGAATACAGCCTGG - Intergenic
983939517 4:173525391-173525413 GGTCATAGTGGACACCAGCTAGG + Intronic
983949437 4:173622302-173622324 GGACAGAGTGGAGCCCACCGCGG - Intergenic
984069520 4:175093963-175093985 GTTCAGAGATGACCCCAGCTGGG - Intergenic
985577029 5:678261-678283 GGGCAGAGTGGAGCCAAGCGAGG + Intronic
985591949 5:770314-770336 GGGCAGAGTGGAGCCAAGCGAGG + Intergenic
986027658 5:3865767-3865789 GGGCACACTGGACTCCAGCCTGG - Intergenic
986775402 5:11009266-11009288 GGGCAGAGTGTACCAGAGCCAGG + Intronic
988626034 5:32875981-32876003 AGGCAGAGTGCACTCCAGCCTGG - Intergenic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
989601579 5:43205191-43205213 GGTGAAACTGGACCCCAGACTGG + Intronic
990514831 5:56521332-56521354 TGTCAGAGTGGGAGCCAGCCAGG - Intronic
991084497 5:62636263-62636285 GGTGAGACTGCACTCCAGCCTGG - Intergenic
992081645 5:73239228-73239250 GGTAAGAATGGAGACCAGCCAGG + Intergenic
997693573 5:135844183-135844205 GTTCAGAGTGCACCTCAGCACGG + Intronic
998181814 5:139951397-139951419 GGACATAGTGGATCACAGCCAGG + Intronic
1000134836 5:158337226-158337248 TGGCAGAGTGGAACCCAGCAAGG - Intergenic
1000742503 5:164987171-164987193 GGTCAGAGAGGAGTTCAGCCAGG + Intergenic
1001396410 5:171421780-171421802 AGTCACTGGGGACCCCAGCCTGG - Intronic
1001534478 5:172488973-172488995 GGTCAGCGTGGGCCCCAGTCTGG + Intergenic
1002374440 5:178778236-178778258 GGTGCCAGTGCACCCCAGCCTGG + Intergenic
1003033207 6:2620669-2620691 GGTCAGTGTGAACCCGGGCCAGG - Intergenic
1004492247 6:16128549-16128571 GGTCAGATTCGAGACCAGCCTGG - Intergenic
1004622567 6:17343853-17343875 GGTGAGATTGCACTCCAGCCTGG + Intergenic
1006452185 6:34111692-34111714 GGTCAGAATGGGCAGCAGCCAGG + Intronic
1006611645 6:35297820-35297842 TGTCAGAGCCGCCCCCAGCCGGG + Intergenic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1008819039 6:55609001-55609023 AGTGAGAGTGGTACCCAGCCAGG + Intergenic
1009027097 6:58013355-58013377 TGACAGAGTGTACTCCAGCCTGG - Intergenic
1009202642 6:60764831-60764853 TGACAGAGTGTACTCCAGCCTGG - Intergenic
1010198705 6:73264191-73264213 GGGCAGAGTTGACCTCAGACAGG - Intronic
1012525893 6:100177483-100177505 GGTGAGAGGAGACCCCAGCCTGG + Intergenic
1016727503 6:147392096-147392118 GTTCAGAGTCGAACTCAGCCCGG - Intergenic
1018903882 6:168064189-168064211 GGTCAGGGTGGGGCCCAGCCAGG - Intronic
1019140396 6:169938851-169938873 GGGGAGAGTGGACCCCAGTCAGG - Intergenic
1019428131 7:986909-986931 GCTCTGAGAGGCCCCCAGCCAGG - Intronic
1019713851 7:2529564-2529586 GGCCAGGGTAGCCCCCAGCCAGG - Intergenic
1022785893 7:33636195-33636217 GAGCAGAGTGGACACCAGACAGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024261678 7:47578264-47578286 GGCCCGACTGGACTCCAGCCTGG + Intronic
1024947293 7:54821811-54821833 GCACAGAGTGGACCCCTGCGAGG - Intergenic
1026144138 7:67731179-67731201 GGTGCCAATGGACCCCAGCCTGG - Intergenic
1027202586 7:76072967-76072989 CCTCACAGTGGACCCCCGCCAGG - Intergenic
1031478668 7:122252240-122252262 GGTCAGAGATGAGCCCAGCAAGG - Intergenic
1033501048 7:141950091-141950113 GGTCATAGTGGAACTCAGACTGG - Intronic
1034224999 7:149475070-149475092 GGCCATCTTGGACCCCAGCCAGG - Exonic
1035469406 7:159100086-159100108 GGTCAATGTGGTCCCCAGCCAGG + Intronic
1036980137 8:13461164-13461186 GGTGCGAGTGCACCCCAGCCTGG + Intronic
1037415469 8:18644935-18644957 GGTTAGAGAAGACCCCAGCAAGG - Intronic
1037582676 8:20254884-20254906 GGTCAAAGTCCACCCCAGCCTGG + Exonic
1037882462 8:22579710-22579732 GGGCAGGGTGGTGCCCAGCCTGG + Intronic
1038028914 8:23619472-23619494 GGTGCCACTGGACCCCAGCCTGG + Intergenic
1039290457 8:36088952-36088974 GGTCAGAGAGGAGTTCAGCCAGG - Intergenic
1039728588 8:40250184-40250206 GGTCAGAGTGGAGGCAAGCAAGG - Intergenic
1044481863 8:92699819-92699841 GGCCAGAGTGGCCCACAGCCGGG - Intergenic
1045273402 8:100680695-100680717 GGTGAGAATGGGACCCAGCCAGG - Intergenic
1045653663 8:104365864-104365886 GGTCAGGGTGCCCCTCAGCCAGG - Intronic
1047803932 8:128339121-128339143 GGTGTGAGTGGACACCAACCTGG + Intergenic
1048440911 8:134458414-134458436 GGTCAGAGAGGTCCCGGGCCAGG + Intergenic
1049234560 8:141506039-141506061 TCCCAGAGTGGGCCCCAGCCAGG - Intergenic
1049237854 8:141521462-141521484 GGTCAGAAACGACCCCAGGCTGG + Intergenic
1049336548 8:142089697-142089719 GGTCAGAGGGGGCCCGAGTCAGG - Intergenic
1049393703 8:142385968-142385990 GCTAAGAGTGGTCCCCTGCCAGG - Intronic
1049575011 8:143385897-143385919 TTTCAGAGTGGTCCCCAGGCAGG + Intergenic
1049636370 8:143691692-143691714 GTGCAGAGGGGACCCCGGCCAGG + Exonic
1049678233 8:143903036-143903058 GGGTAGAGTGGGACCCAGCCAGG + Intergenic
1050242939 9:3657996-3658018 GGTGACAGTGGACACCATCCTGG - Intergenic
1052269728 9:26615112-26615134 GGTCTGAGGGGACCCCAGAATGG + Intergenic
1052438723 9:28465333-28465355 GGTCAGAGAGGAGTTCAGCCGGG - Intronic
1053350453 9:37410497-37410519 GGGCAGAGGGGATCCCAGGCGGG + Intergenic
1053591299 9:39517254-39517276 GTTCAGAGTGGACCCTTGCAGGG + Intergenic
1053849143 9:42272611-42272633 GTTCAGAGTGGACCCTTGCAGGG + Intergenic
1054575009 9:66848039-66848061 GTTCAGAGTGGACCCTTGCAGGG - Intergenic
1054919718 9:70530087-70530109 GGTCAATGTGAACACCAGCCGGG + Exonic
1055646305 9:78364607-78364629 GGTCACACTGCACACCAGCCTGG - Intergenic
1056099956 9:83291827-83291849 GGTCAGAGTGTTCCCTAGACCGG + Intronic
1057221191 9:93258888-93258910 TGTCAGTGTGGGCCCCAACCAGG - Intronic
1057424913 9:94940548-94940570 GCTCAGACTGCACTCCAGCCTGG + Intronic
1057527902 9:95818818-95818840 GGTCACCCAGGACCCCAGCCTGG - Intergenic
1058670159 9:107354542-107354564 GGTCAGAGTGGAACCATGCATGG + Intergenic
1058817930 9:108702986-108703008 GGTCAGAGATGAATCCAGCCAGG + Intergenic
1059266803 9:113040994-113041016 GGTTACAGTGCACTCCAGCCTGG - Intronic
1060112912 9:120919384-120919406 GGTCACAGTGGGCCCTAGCGGGG + Intronic
1060529914 9:124342057-124342079 GGCCAGAGTGGCCACCTGCCTGG - Intronic
1060989146 9:127838378-127838400 GGGCAAAGGGGACCCCTGCCTGG - Intronic
1061105896 9:128530089-128530111 GATAAGAGTAGATCCCAGCCGGG - Intronic
1062026561 9:134343323-134343345 GTTCAGAGGCAACCCCAGCCAGG - Intronic
1062192846 9:135256538-135256560 GGACAGAGAGGACCCCAGGGAGG - Intergenic
1062217466 9:135397040-135397062 GGTCCCTGTGGACCCCAGGCTGG - Intergenic
1062278403 9:135741294-135741316 GGACACAGTGGGCCCCAGCAGGG + Intronic
1062532530 9:137008169-137008191 GGGCAGAGGGGACCAGAGCCGGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1189333912 X:40158458-40158480 GGTCAGCGTGGCCCGCAGCGGGG - Intronic
1191875207 X:65788499-65788521 GGGCAGAGGGAGCCCCAGCCGGG - Intergenic
1192232821 X:69277814-69277836 GGGCTCAGTGGGCCCCAGCCAGG + Intergenic
1192738037 X:73867286-73867308 GGTCAGGTTGGAGACCAGCCTGG - Intergenic
1193479605 X:82010916-82010938 GCTCTGAGTGGAACCCAGACAGG + Intergenic
1194798375 X:98240582-98240604 GGGCAGAGTCCACCACAGCCAGG - Intergenic
1195736550 X:108018235-108018257 GGTCAGTGTGGATGCCAGCTGGG + Intergenic
1195792286 X:108601410-108601432 GGTCAGACTATAACCCAGCCGGG + Exonic
1197285925 X:124594348-124594370 GAGGAGAGTGGACCCCAGGCTGG + Intronic
1198952129 X:142083201-142083223 GGTCTGAGACTACCCCAGCCTGG + Intergenic
1200101351 X:153690329-153690351 ACTCAGGGTGGCCCCCAGCCAGG - Intronic
1202095367 Y:21243903-21243925 GGTACCAGTGGCCCCCAGCCTGG + Intergenic
1202165575 Y:21984067-21984089 GGTGAGACTGCACCCCAGCCTGG - Intergenic
1202225782 Y:22602305-22602327 GGTGAGACTGCACCCCAGCCTGG + Intergenic
1202317331 Y:23593356-23593378 GGTGAGACTGCACCCCAGCCTGG - Intergenic
1202553434 Y:26076702-26076724 GGTGAGACTGCACCCCAGCCTGG + Intergenic