ID: 1163594302

View in Genome Browser
Species Human (GRCh38)
Location 19:18211871-18211893
Sequence CACTGGCGGTACAGGGGCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163594294_1163594302 -6 Left 1163594294 19:18211854-18211876 CCATGATGCGGTCCGTCCACTGG 0: 1
1: 1
2: 1
3: 3
4: 35
Right 1163594302 19:18211871-18211893 CACTGGCGGTACAGGGGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 228
1163594292_1163594302 12 Left 1163594292 19:18211836-18211858 CCTGCTGGAAGAACTCGGCCATG 0: 2
1: 0
2: 0
3: 9
4: 107
Right 1163594302 19:18211871-18211893 CACTGGCGGTACAGGGGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 228
1163594291_1163594302 13 Left 1163594291 19:18211835-18211857 CCCTGCTGGAAGAACTCGGCCAT 0: 2
1: 0
2: 0
3: 10
4: 84
Right 1163594302 19:18211871-18211893 CACTGGCGGTACAGGGGCAGCGG 0: 1
1: 0
2: 0
3: 19
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163594302 Original CRISPR CACTGGCGGTACAGGGGCAG CGG Exonic
900095582 1:938838-938860 CTGTGGCGGGACAGGGGCACAGG - Intronic
900301709 1:1981243-1981265 CACTGCGGGCACAGGGGCACTGG - Intronic
902595940 1:17509543-17509565 CACTGGCTTCAGAGGGGCAGGGG + Intergenic
902954554 1:19916224-19916246 CACTGATGGTTCAGGAGCAGAGG + Intergenic
903917488 1:26774897-26774919 CATGGGGGGCACAGGGGCAGAGG - Exonic
904493952 1:30876561-30876583 CTCTGTGGGTCCAGGGGCAGTGG + Exonic
904774074 1:32896004-32896026 GGCTGGAGGAACAGGGGCAGGGG + Intronic
905536210 1:38723968-38723990 CACTGTGGGTGAAGGGGCAGAGG - Intergenic
906354083 1:45088182-45088204 CACTGCTGGTTCAGAGGCAGTGG + Exonic
910065143 1:83143139-83143161 CACTGCAGTTACAGTGGCAGAGG + Intergenic
916415564 1:164589133-164589155 CCCAGGCGGGAGAGGGGCAGTGG + Intronic
916696050 1:167237678-167237700 AACTGGAGGAACAGGGGAAGAGG - Intronic
917452398 1:175157935-175157957 CAGTGGCAGTTCAGGGACAGAGG + Intronic
919888050 1:201949491-201949513 CAAAGGGGGTACAGGGGGAGGGG - Intergenic
920107737 1:203566309-203566331 CACTGGCGCAGGAGGGGCAGAGG + Intergenic
920357606 1:205386279-205386301 CACAGGGAGTACAGGGGAAGGGG - Intronic
924700998 1:246452216-246452238 CACTTGCGGGCCAGGGGCGGTGG + Intronic
924798477 1:247309943-247309965 AGCTGGCAGTGCAGGGGCAGTGG + Intronic
1062970610 10:1645409-1645431 CAATGGCACTGCAGGGGCAGTGG - Intronic
1063137573 10:3230496-3230518 CGCTGGAGGTGCAGGCGCAGAGG + Intergenic
1063377432 10:5562410-5562432 CACTGGGGCTCCAGGAGCAGTGG - Intergenic
1064989417 10:21243134-21243156 CACTCCCGGAACAGGAGCAGTGG - Intergenic
1068520146 10:58068725-58068747 CACTGGATGGCCAGGGGCAGAGG + Intergenic
1069642181 10:69963198-69963220 CCCTGGGGGTACAGGGGCCGTGG - Intronic
1070864908 10:79702488-79702510 CACTGCAGGGGCAGGGGCAGGGG - Intergenic
1070878697 10:79840620-79840642 CACTGCAGGGGCAGGGGCAGGGG - Intergenic
1071631802 10:87224709-87224731 CACTGCAGGGGCAGGGGCAGGGG - Intergenic
1071645256 10:87356930-87356952 CACTGCAGGGGCAGGGGCAGGGG - Intergenic
1073530996 10:104232045-104232067 CACTGGGGGCAGAGGGGAAGAGG + Intronic
1074529796 10:114289284-114289306 CACAGGCGGGAGAGGCGCAGAGG + Exonic
1074573551 10:114647317-114647339 CAGTGGCATTATAGGGGCAGTGG - Intronic
1075815199 10:125259743-125259765 CACAGGAGGGGCAGGGGCAGGGG + Intergenic
1076362066 10:129896549-129896571 CACTCGCTGTGCAGGGACAGGGG - Intronic
1076680028 10:132167112-132167134 CCCTGGCAGGGCAGGGGCAGAGG - Intronic
1076680531 10:132169182-132169204 CACTGACGGGACAGGGCCTGGGG + Intronic
1077284230 11:1758749-1758771 CCCAGGGGGTACAGGGGCAGGGG - Intronic
1078096548 11:8300823-8300845 CACTGGGGGCAGAGGGGCTGGGG - Intergenic
1078620656 11:12904120-12904142 CACTGATGGTACAAGAGCAGTGG + Intronic
1078957313 11:16214569-16214591 CACTGACAGTATAGGAGCAGCGG - Intronic
1080820886 11:35805400-35805422 CACTGTTGGTACAGGGACTGGGG - Intronic
1083228107 11:61297243-61297265 CATTGGTGGTTTAGGGGCAGTGG - Intergenic
1083279075 11:61614268-61614290 CACTGGCAGACCAGGGGAAGAGG + Intergenic
1083317427 11:61825277-61825299 AGTTGGAGGTACAGGGGCAGGGG - Intronic
1083656205 11:64230870-64230892 CACAGCCGGCACAGGCGCAGGGG - Exonic
1085537652 11:77233363-77233385 CACTGTTGCTACAGGAGCAGAGG - Intronic
1085850665 11:80115794-80115816 TACTGGAGGTACATGGGCAGAGG + Intergenic
1089460641 11:118651200-118651222 CAGTGGCTGGACAGGTGCAGTGG + Intronic
1090765678 11:129874163-129874185 CACTGCCGATACAGGTGGAGGGG + Exonic
1091112352 11:132981480-132981502 CACTGGCGGGAAAGGGCCTGAGG + Intronic
1092059650 12:5537968-5537990 CACAGGCTGTGGAGGGGCAGAGG + Intronic
1092132682 12:6123666-6123688 CACTTGTGGTACAGAGTCAGGGG - Intronic
1093675692 12:21937500-21937522 CACTGGGGATTCCGGGGCAGAGG + Intronic
1097902032 12:64882843-64882865 CACCGGAAGTACATGGGCAGAGG - Intergenic
1098931496 12:76420465-76420487 CACTATGGGTACAGGGGCAGGGG + Intronic
1100721977 12:97368935-97368957 TGCTGGAGGGACAGGGGCAGAGG - Intergenic
1100926840 12:99558354-99558376 CACTGGCAGCAGTGGGGCAGCGG + Intronic
1101445479 12:104734134-104734156 CACTGGCGCCAGAGGGGCACAGG + Intronic
1102009580 12:109609959-109609981 CAATGGCTGGAGAGGGGCAGTGG + Intergenic
1102948507 12:117011309-117011331 CACTGGCGGGACAGAGGCCTGGG - Intronic
1104170187 12:126273245-126273267 CACTGGCGGGACCTGGGTAGAGG - Intergenic
1113124763 13:106964955-106964977 CACTGGATCTTCAGGGGCAGAGG - Intergenic
1114034773 14:18613064-18613086 GACTAGGGGTACAGGGGTAGTGG + Intergenic
1114123869 14:19701952-19701974 GACTAGGGGTACAGGGGTAGTGG - Intergenic
1114272185 14:21107581-21107603 GGCTGGCGGGACAGTGGCAGTGG + Intergenic
1116315755 14:43389996-43390018 CCCTGGCTGTAGTGGGGCAGTGG + Intergenic
1118137477 14:63045493-63045515 CACCGGCGGGACAGCGACAGCGG - Intronic
1122877027 14:104672261-104672283 ACCTGGGGGTACAGGGGCTGGGG + Intergenic
1125820700 15:42627580-42627602 CAGTGGCGGTAGAGGGAAAGGGG - Intronic
1128408409 15:67367700-67367722 CACTGGTGGTACGGGGGTAGGGG + Intronic
1135764418 16:25165149-25165171 AACTGGCTGTAAATGGGCAGTGG - Intronic
1136566986 16:31076543-31076565 CACAGGTGGTACAGGGGAAAAGG - Exonic
1138360800 16:56425578-56425600 CGCTGGCGGGACGGGCGCAGGGG + Intergenic
1138629917 16:58285381-58285403 AACTGGAAGTACAGAGGCAGTGG - Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1141025319 16:80541169-80541191 CACGGGCGGTCCAGGGGCCGCGG + Intronic
1141380563 16:83572661-83572683 CACTTCCGGGACATGGGCAGAGG + Intronic
1141630143 16:85283237-85283259 CACGGGAGGCACAAGGGCAGCGG - Intergenic
1142149069 16:88504832-88504854 CCCTGGCCCCACAGGGGCAGTGG - Intronic
1142920679 17:3182669-3182691 CAGAGGTGGTACAGGGGGAGAGG + Intergenic
1143475067 17:7197846-7197868 TACAGGAGATACAGGGGCAGAGG - Intronic
1143580310 17:7821773-7821795 CACTGGCCGCGCAGGGACAGAGG - Intronic
1143672260 17:8404982-8405004 CACTGGGTGTCCAGGCGCAGGGG + Intergenic
1144021977 17:11245704-11245726 CACTGCCTGCACAGGAGCAGAGG + Intronic
1144118494 17:12125972-12125994 CACAGGTCGTACAGGAGCAGGGG + Intronic
1147405498 17:40208954-40208976 CACTGGAGGGCCAGGTGCAGTGG + Intergenic
1147662724 17:42125667-42125689 CACTGGGGGGGCAGGGGGAGGGG - Exonic
1147911618 17:43859426-43859448 CAGTGGAGGCAGAGGGGCAGGGG + Intronic
1148578074 17:48725275-48725297 GACTGGGGGTTCAGGGGAAGAGG - Exonic
1148860275 17:50600963-50600985 CACTGGAGGGGCAGGGGCTGCGG + Intronic
1149602035 17:57899289-57899311 CACAGGCGGAGCAGGGGCTGAGG - Intronic
1151771054 17:76161891-76161913 CACAGGTGTTACAGAGGCAGAGG + Exonic
1152389919 17:79997521-79997543 CATGGGCTGTACAGAGGCAGAGG - Intronic
1152702076 17:81824169-81824191 CCCTGGAGGGGCAGGGGCAGGGG + Intronic
1157649035 18:49308708-49308730 CACTGGCGGGAGACGGGAAGGGG + Intronic
1159894317 18:73982195-73982217 CACTGGCTGTGCAATGGCAGTGG - Intergenic
1161276984 19:3423850-3423872 CCCTGGGACTACAGGGGCAGAGG + Intronic
1161689132 19:5720694-5720716 CCGTGGCGGTTGAGGGGCAGTGG + Exonic
1162404226 19:10463841-10463863 CACTGGCGGTACAGCTCCAGCGG - Exonic
1163594302 19:18211871-18211893 CACTGGCGGTACAGGGGCAGCGG + Exonic
1165735924 19:38175576-38175598 CACTGGTGGTAGCGGGGGAGGGG - Intronic
1166707181 19:44914557-44914579 CGCTCACGGGACAGGGGCAGAGG + Intronic
1166851609 19:45764095-45764117 CACTGGAGGTGCGGGGGCAGCGG - Exonic
1167284260 19:48590061-48590083 CCCTGGAGGCAGAGGGGCAGAGG - Intronic
1168413675 19:56155691-56155713 CACAGCTGGTTCAGGGGCAGGGG + Intronic
925069606 2:956206-956228 CAGGGGCGGGGCAGGGGCAGGGG - Intronic
925893199 2:8452574-8452596 CACTGGCGGTTCAGGTGGACAGG - Intergenic
926107351 2:10160639-10160661 CACGGGTGGTCCTGGGGCAGAGG - Intronic
927712635 2:25335353-25335375 CACTGGCTTGGCAGGGGCAGGGG + Intronic
928270101 2:29848106-29848128 CCCTGGGGGATCAGGGGCAGCGG + Intronic
928359989 2:30655041-30655063 CCCTGTGGCTACAGGGGCAGTGG + Intergenic
928834716 2:35529951-35529973 CACTGGCGGTAGCTTGGCAGGGG - Intergenic
930103025 2:47617763-47617785 CACTGGGTGTCCAGTGGCAGAGG + Intergenic
931243968 2:60477676-60477698 CACTGTGGAAACAGGGGCAGTGG + Intronic
932430247 2:71669900-71669922 CACTGGCAGTGCTGGGACAGTGG - Intronic
937989131 2:127652704-127652726 AAGTGGTGGTACAGTGGCAGAGG + Intronic
938310025 2:130283820-130283842 CACTGTCTGTACAGAGGGAGAGG + Intergenic
938317519 2:130340323-130340345 AACTGGCTGTACAGGGTCACAGG - Intronic
938444894 2:131368549-131368571 CACTGTCTGTACAGAGGGAGAGG - Intergenic
939199665 2:139018276-139018298 CAATGGTGGTATGGGGGCAGGGG + Intergenic
940856280 2:158730859-158730881 CACTGGCTGGGCAGGGGCACTGG - Intergenic
942446687 2:176082971-176082993 CCCTGAGGGCACAGGGGCAGGGG + Intronic
944938476 2:204595263-204595285 CACTGGCTGGACTCGGGCAGTGG + Intronic
948237262 2:236400421-236400443 CCCTGGCGGCAGAGGGGCAGAGG - Intronic
948612787 2:239180308-239180330 CACAGGCGGTGCAGGGGATGAGG + Intronic
948725096 2:239929677-239929699 CAGTGGAGGAGCAGGGGCAGTGG - Intronic
948725123 2:239929796-239929818 CAGTGGAGGAGCAGGGGCAGTGG - Intronic
948725154 2:239929915-239929937 CAGTGGAGGAGCAGGGGCAGTGG - Intronic
1168773858 20:432730-432752 CAGGGGCAGGACAGGGGCAGGGG + Intergenic
1169043792 20:2519316-2519338 AGCTGGAGGTACAGGGTCAGAGG - Intronic
1172746771 20:37216747-37216769 CACTGGAGGGCCAGGTGCAGTGG - Intronic
1173492040 20:43490735-43490757 CACTGTGGGTCCAGGCGCAGTGG - Intergenic
1174749238 20:53095728-53095750 CACTGGCATCACAGGGGTAGAGG - Intronic
1176284503 21:5012369-5012391 TGCTGGAGGGACAGGGGCAGGGG + Intergenic
1179872678 21:44251106-44251128 TGCTGGAGGGACAGGGGCAGGGG - Intronic
1179993226 21:44959459-44959481 TGCTGGGGGGACAGGGGCAGGGG - Intronic
1180458893 22:15540112-15540134 GACTAGGGGTACAGGGGTAGTGG + Intergenic
1180669439 22:17541980-17542002 CTCTGGAGGTGCAGGTGCAGGGG + Intronic
1181615251 22:24049838-24049860 CAATGGCGGGACAGGTGGAGAGG - Intronic
1182257578 22:29049855-29049877 CACTGGAGGAACAGTGGCACTGG - Exonic
1183049687 22:35250729-35250751 CACTGAAGGGGCAGGGGCAGGGG + Intergenic
1183078491 22:35441614-35441636 CAGTGGGGGTATATGGGCAGAGG + Intergenic
1183176024 22:36225306-36225328 CATGGGAGGGACAGGGGCAGGGG + Intergenic
1183674337 22:39291273-39291295 CACTGGAGGAACAGGGACACAGG + Intergenic
1183711426 22:39506002-39506024 CTTTGGCAGTACAGGGCCAGGGG + Intronic
1183835955 22:40453390-40453412 CACTGACCGGACTGGGGCAGAGG + Intronic
950205400 3:11076502-11076524 CACTAGGGGTACAGGGCCTGAGG - Intergenic
950218608 3:11177668-11177690 CACTGGAGGGAAAGGGGCTGGGG - Intronic
950380933 3:12614153-12614175 AAATGGGGATACAGGGGCAGGGG + Intronic
954147129 3:48640052-48640074 CGCTGGGGAGACAGGGGCAGAGG + Exonic
958741624 3:98080412-98080434 TACTGGCAGGACAGGCGCAGTGG - Intergenic
960631885 3:119740655-119740677 CCCTGGCCTTACAGCGGCAGAGG + Exonic
963504423 3:146165613-146165635 CCCTGGAGGTACAGAGGAAGGGG + Intergenic
964258834 3:154811065-154811087 CACTGGAGGTACACAGGCAGTGG - Intergenic
966878138 3:184335266-184335288 CAGGGGTGGTACAGGGGCTGGGG - Exonic
968445700 4:651088-651110 CACAGGCGGGGCAGGGGCTGAGG + Intronic
968445723 4:651187-651209 CACAGGCGGGGCAGGGGCTGAGG + Intronic
968445737 4:651237-651259 CACAGGCGGGGCAGGGGCTGAGG + Intronic
968551036 4:1223472-1223494 CGCTGGCGGGACAAGGACAGCGG + Intronic
968911517 4:3478971-3478993 CTCGGGTGGTCCAGGGGCAGCGG + Intronic
970930607 4:21507213-21507235 CACTGGCTGCACATGGCCAGTGG + Intronic
971746451 4:30587076-30587098 CACTGGCGGTAGGAGGGCCGTGG - Intergenic
972456843 4:39263458-39263480 CACTGGCATTGAAGGGGCAGAGG - Intronic
976076216 4:81302011-81302033 CACAGAAGGTACAGGGCCAGTGG - Intergenic
977306273 4:95327657-95327679 CACTGGGGCTACAGGGGAAGAGG - Intronic
978954869 4:114599987-114600009 AACTCGCGGTACAGGTACAGAGG - Intronic
979546942 4:121950727-121950749 CCCAGGCGGTGCAGGGTCAGCGG - Intronic
982288935 4:153760532-153760554 CCCTGGAGGTAGAGGGGCAAAGG - Intergenic
983916156 4:173293841-173293863 CACTGCCTGCAGAGGGGCAGTGG + Intronic
985627589 5:997869-997891 CTCTGGGGCAACAGGGGCAGGGG + Intergenic
985712695 5:1438730-1438752 CACTGGCGGGAGTGGGGCACAGG + Intronic
987088216 5:14488294-14488316 AGCTGGCGGGACAGAGGCAGGGG - Intronic
987795892 5:22626202-22626224 CACTGGCAGGAATGGGGCAGAGG - Intronic
989216337 5:38908094-38908116 CAGTGGCAGCACAGGGGTAGGGG - Intronic
990747567 5:58975769-58975791 CACTGGCGGTACAGCTGGAGAGG + Exonic
997581719 5:135021532-135021554 CAGTGGGAGGACAGGGGCAGTGG + Intergenic
1002783673 6:385218-385240 CACTGGCGTTCCAGCTGCAGGGG + Intergenic
1002795883 6:470890-470912 CCCTGGCGGGGCAGGGGGAGAGG - Intergenic
1003011909 6:2434418-2434440 CACTGAAGGACCAGGGGCAGGGG - Intergenic
1003550883 6:7101189-7101211 CACTGGCTGTAGAGGTGGAGAGG - Intergenic
1004022665 6:11789052-11789074 CAGTGGCGGGTCAGCGGCAGGGG - Intronic
1006334854 6:33415137-33415159 CACTGCAGGTACTGGAGCAGGGG + Exonic
1016316581 6:142795870-142795892 CATTGGCGGTACATGGACATAGG + Intronic
1019692723 7:2425616-2425638 CACACGCGGGACAGGTGCAGGGG + Intronic
1019894895 7:3976029-3976051 CACTGGGGGTCCCGGGGCTGAGG + Intronic
1019894974 7:3976335-3976357 CACTGGGGGTCCCGGGGCTGAGG + Intronic
1019895041 7:3976590-3976612 CACTGGGGGTCCCGGGGCTGAGG + Intronic
1019895070 7:3976708-3976730 CACTGGGGGTCCCGGGGCTGAGG + Intronic
1019895164 7:3977073-3977095 CACTGGGGGTCCCGGGGCTGAGG + Intronic
1019895192 7:3977175-3977197 CACTGGGGGTCCCGGGGCTGAGG + Intronic
1019895246 7:3977395-3977417 CACTGGGGGTCCCGGGGCTGAGG + Intronic
1020050176 7:5076224-5076246 CTCTGGGGGTGCAGGGGCAGCGG - Intergenic
1023036316 7:36134412-36134434 CCATGCCAGTACAGGGGCAGGGG + Intergenic
1026073364 7:67142717-67142739 CACTGGCTGGCCAGGCGCAGTGG - Intronic
1026703521 7:72669476-72669498 CACTGGCTGGCCAGGCGCAGTGG + Intronic
1026738012 7:72961044-72961066 CACAGGTGGCACAGGGGCGGAGG + Intronic
1026740460 7:72975717-72975739 CACTGGGTGTCCAGGGCCAGTGG + Intergenic
1026789049 7:73319839-73319861 CACAGGTGGCACAGGGGCGGAGG + Intronic
1026797762 7:73377202-73377224 CACTGGGTGTCCAGGGCCAGTGG + Intergenic
1027103271 7:75389353-75389375 CACTGGGTGTCCAGGGCCAGTGG - Intergenic
1027105722 7:75404024-75404046 CACAGGTGGCACAGGGGCGGAGG - Intronic
1027278965 7:76591609-76591631 CACTGCAGTTACAGTGGCAGAGG - Intergenic
1027620044 7:80472997-80473019 CACTGGCGTGGGAGGGGCAGAGG + Intronic
1033368600 7:140689736-140689758 CACTTGCGGAACAGGGGCTGGGG + Intronic
1034461640 7:151200827-151200849 CACTGGCGCTGCAGGGACTGTGG + Intronic
1034540674 7:151756083-151756105 CACTGGTGGTCCAGGGGGAGAGG - Intronic
1038558839 8:28550994-28551016 CAATGGCGGGAGAGAGGCAGTGG - Intronic
1040061069 8:43103173-43103195 AACTGGTGGGACAGGGACAGAGG - Intronic
1044919169 8:97149577-97149599 CACTGGCAGGACAGCTGCAGAGG - Intronic
1045540280 8:103077768-103077790 CAATGGCCTTACAGGTGCAGAGG - Intergenic
1047588756 8:126303660-126303682 CACTGGCTGAACAGGGGTAGGGG - Intergenic
1047752791 8:127894515-127894537 CACTGGCTGGACAGGAGTAGGGG - Intergenic
1049302707 8:141880035-141880057 CACTGCAGTTACAGGTGCAGGGG + Intergenic
1049353669 8:142177392-142177414 CACTGGAGGGACAGGGGCCCGGG + Intergenic
1049633108 8:143670044-143670066 CAGTGGGGGTACCCGGGCAGAGG + Intergenic
1053739890 9:41127263-41127285 CACTTGCAGCAAAGGGGCAGCGG + Exonic
1054442855 9:65283257-65283279 CACTTGCAGCAAAGGGGCAGCGG + Exonic
1054487423 9:65738244-65738266 CACTTGCAGCAAAGGGGCAGCGG - Exonic
1054688460 9:68304050-68304072 CACTTGCAGCAAAGGGGCAGCGG - Exonic
1055243675 9:74216501-74216523 CACAGGCAGTAGAGAGGCAGTGG - Intergenic
1057276511 9:93678491-93678513 GACTGGCAGGGCAGGGGCAGGGG + Exonic
1057760109 9:97865594-97865616 TACTGGCAGTCCAGGTGCAGTGG - Intergenic
1060662131 9:125410783-125410805 GGCTGTCGGTCCAGGGGCAGGGG + Intergenic
1061273173 9:129555394-129555416 CACTGCAGGGACAGGGACAGGGG + Intergenic
1061330079 9:129886683-129886705 CACTGGCTGGACATGTGCAGTGG - Intergenic
1061941563 9:133886915-133886937 CACAGGAGGCCCAGGGGCAGAGG + Intronic
1062038265 9:134392329-134392351 GAATGGCCGTACAGGGGCACAGG + Intronic
1062451074 9:136616080-136616102 CACCGGAGGGGCAGGGGCAGAGG - Intergenic
1185569958 X:1127455-1127477 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570029 X:1127813-1127835 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570043 X:1127885-1127907 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570051 X:1127921-1127943 CACTGCAGGTACAGGGACAGGGG + Intergenic
1185570074 X:1128029-1128051 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570083 X:1128065-1128087 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570091 X:1128101-1128123 CACTGCAGGTACAGGGACAGGGG + Intergenic
1185570121 X:1128245-1128267 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570142 X:1128353-1128375 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570150 X:1128389-1128411 CACTGCAGGTACAGGGACAGGGG + Intergenic
1185570180 X:1128533-1128555 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570210 X:1128677-1128699 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570234 X:1128783-1128805 CACTGCAGGGACAGGGACAGGGG + Intergenic
1185570250 X:1128855-1128877 CACTGCAGGGACAGGGACAGGGG + Intergenic
1187957350 X:24532638-24532660 AACTGGCGGTTTAGGGCCAGTGG - Intronic
1189689238 X:43598775-43598797 CACTGGTTGTTCAGAGGCAGAGG - Intergenic
1190745784 X:53321123-53321145 TCCTGGCGGCCCAGGGGCAGGGG + Exonic
1191729081 X:64314588-64314610 CAATGGCGGTACAGCAGCGGTGG + Intronic
1191881633 X:65848583-65848605 CACTGTGGGGACAGAGGCAGAGG + Intergenic
1194003041 X:88455798-88455820 CACTGTGGGTGCAGAGGCAGAGG + Intergenic
1195402966 X:104481377-104481399 CACTGGCAGGTCAGGGTCAGAGG + Intergenic