ID: 1163594875

View in Genome Browser
Species Human (GRCh38)
Location 19:18215225-18215247
Sequence CAGGGTGTGCAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 430}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163594875_1163594887 30 Left 1163594875 19:18215225-18215247 CCTTCCTCATTCTGCACACCCTG 0: 1
1: 0
2: 0
3: 44
4: 430
Right 1163594887 19:18215278-18215300 TCTGACCTCTTTGGCTGGTCTGG 0: 1
1: 0
2: 1
3: 12
4: 159
1163594875_1163594883 21 Left 1163594875 19:18215225-18215247 CCTTCCTCATTCTGCACACCCTG 0: 1
1: 0
2: 0
3: 44
4: 430
Right 1163594883 19:18215269-18215291 GAAGCCCTTTCTGACCTCTTTGG 0: 1
1: 0
2: 2
3: 22
4: 217
1163594875_1163594885 25 Left 1163594875 19:18215225-18215247 CCTTCCTCATTCTGCACACCCTG 0: 1
1: 0
2: 0
3: 44
4: 430
Right 1163594885 19:18215273-18215295 CCCTTTCTGACCTCTTTGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163594875 Original CRISPR CAGGGTGTGCAGAATGAGGA AGG (reversed) Intronic
900177306 1:1296521-1296543 CAGCGTGTGCAGAGTGTGGCCGG - Exonic
900185459 1:1331213-1331235 CAGGGTGTGGCAAGTGAGGATGG + Intergenic
900541776 1:3206539-3206561 GAGGGTGAGCAGACTCAGGAAGG - Intronic
900694659 1:4002317-4002339 CAGGTTGTGCTGCGTGAGGAAGG + Intergenic
900850011 1:5135401-5135423 CAGGAGGTGAATAATGAGGAGGG - Intergenic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
904273627 1:29366471-29366493 CAGAGGCTGAAGAATGAGGAGGG + Intergenic
904842205 1:33379659-33379681 GAGGGTGAGCACACTGAGGATGG - Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911170755 1:94768887-94768909 CAGGGTGTAGGGAATGAGGTAGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
912229812 1:107779612-107779634 AAAGATGTGCAGAATGAGAAGGG + Intronic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
913531010 1:119734338-119734360 CAGGGCTTCCACAATGAGGAGGG - Intronic
914353254 1:146858436-146858458 CAGGGTAGGGAGAATAAGGAAGG + Intergenic
915048589 1:153042081-153042103 GTAGGTGTGCAGAGTGAGGAAGG + Intergenic
916456651 1:164977787-164977809 AAGGGTGTGCAGGAAGGGGAAGG + Intergenic
916547973 1:165824592-165824614 CAGGGAGTACAGAATGCAGATGG + Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920306730 1:205023180-205023202 CAAGCGGTGCAGAAAGAGGAGGG - Intergenic
920379530 1:205527664-205527686 CAGGGTGTGCAGGAGAATGAGGG + Intronic
921300890 1:213750514-213750536 CAGGGTGCTGAGAATAAGGATGG + Intergenic
921328814 1:214015105-214015127 CACGGTGTGCAGACTTAGGGTGG + Intronic
921968217 1:221116264-221116286 CAGGCTGTGATGACTGAGGAGGG - Intergenic
922621500 1:226992008-226992030 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
922621506 1:226992026-226992048 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
923629901 1:235642945-235642967 CAGGGTTTCCAGACTGAGCATGG - Intronic
924328141 1:242916144-242916166 AGGGGTTTGTAGAATGAGGAAGG - Intergenic
924611979 1:245580856-245580878 CAGCATGGGCAGAACGAGGAAGG - Intronic
924823188 1:247513807-247513829 GAGGGTGAGCAGAAAGAGGGTGG - Intronic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063573884 10:7243513-7243535 CAGGGTCTGGAGATTCAGGAGGG - Intronic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1065930413 10:30473886-30473908 CAGGGTGAGTAGGATGAGTAGGG + Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068685892 10:59869678-59869700 GTGGGTGTGCAGAATGAGCACGG - Intronic
1071049929 10:81435022-81435044 GAGAGTGAGCAGGATGAGGAGGG + Intergenic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1074265086 10:111893707-111893729 CATGGTGTGAGGAATGGGGAAGG - Intergenic
1075093912 10:119458758-119458780 CAGGGTGTGGAGGAAGAGAAGGG - Intronic
1076608073 10:131702188-131702210 CAGGGTTTGCTGAAAGATGAGGG - Intergenic
1077169670 11:1160595-1160617 CATGGCCTGCAGAAAGAGGAGGG - Exonic
1077394173 11:2313069-2313091 CAGGGGGTGAAGAAGGTGGAAGG - Intronic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1078156932 11:8807444-8807466 CGGGGTGTACAGATTCAGGAGGG - Intronic
1080814054 11:35736842-35736864 AAGGGAGTGAAGAGTGAGGAAGG - Intronic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081741368 11:45443307-45443329 CAGGGTCTGGAGAATGCAGAGGG + Intergenic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1084508675 11:69587692-69587714 TTGGGTCTGCAGAATGAGGCAGG - Intergenic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085431548 11:76454927-76454949 AAGGGTGGGCAGTATTAGGAGGG - Intronic
1085728687 11:78977716-78977738 GAGGATGTGGAGAAAGAGGAAGG + Intronic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1087093992 11:94303106-94303128 TAGGGTGTGAAGAAGGACGAAGG - Intergenic
1088130600 11:106484634-106484656 CATGATGAGGAGAATGAGGATGG - Intergenic
1088187811 11:107193140-107193162 CAGGGTGGGCAGACTGGTGAAGG - Intergenic
1088497538 11:110446657-110446679 CAGGTTGGGAAGAAAGAGGAAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090075873 11:123579722-123579744 TAGGGTGTACAGAATCTGGATGG - Intronic
1091193786 11:133715351-133715373 CAGGGTGTGATGATTGAGGTTGG - Intergenic
1091386418 12:98856-98878 GAGGGCGTGCAGAAGTAGGAAGG + Intronic
1091406024 12:210014-210036 CTGGGTGGGCAGGATGACGAGGG + Exonic
1091917693 12:4281403-4281425 CAGGGTGTGATGAATGGGCAAGG + Intronic
1092181056 12:6447266-6447288 AAGGGTCTGCAGAGTGAGTAGGG - Intronic
1092651688 12:10641784-10641806 CTGGCTGTACAGAATGAGGCAGG - Intronic
1094113111 12:26882349-26882371 CAGGGTGTGGAGAAGAAGGAAGG + Intergenic
1095174303 12:39073339-39073361 CAGTTGGTGCAGAATAAGGAAGG - Intergenic
1095359512 12:41319468-41319490 CAGTTTGTGCAGAATGATGAGGG - Intronic
1095468138 12:42509472-42509494 AAGGGTGAGCAGAATAAGGCAGG - Intronic
1095578843 12:43771382-43771404 CAGGGTGTCCACAATTAGGGTGG + Intronic
1097300228 12:58010131-58010153 GTGGGGGTGCAGAATGATGATGG + Intergenic
1101023992 12:100582894-100582916 CAGGCTGTGAAGACGGAGGAGGG - Intronic
1101492492 12:105222444-105222466 CAGGGTGTGGTGAGTGAGGAAGG + Intronic
1101527461 12:105544689-105544711 CTGGGTGTGCAGGGTGAGGCTGG - Intergenic
1102035830 12:109769908-109769930 CAGGGTTTGGAGAATGGGGATGG - Exonic
1102678106 12:114672171-114672193 CATGGTGTTCAGATTGAGGAAGG + Exonic
1102997761 12:117362756-117362778 AAGGGTGTGGGGGATGAGGAGGG + Intronic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1103561353 12:121794703-121794725 CAGGGTGAGGAGTAAGAGGAGGG - Intronic
1103632439 12:122272964-122272986 CATGGTGTGTGGAATGGGGAGGG + Exonic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104941955 12:132399406-132399428 CAGGGTGTGAAGCACCAGGAAGG - Intergenic
1105873814 13:24535910-24535932 CTGGGTGTGCAAAGTGAGCAGGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1107323621 13:39216008-39216030 CTGGCTTTGAAGAATGAGGAAGG - Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1108715263 13:53072380-53072402 CCTGGTGTGGAGATTGAGGAAGG + Intergenic
1110473106 13:75882759-75882781 CAGGATGTCCAGAATGAGTGTGG + Intronic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1112077919 13:95933083-95933105 CAGGTTTTGCAGAATGAGTTAGG + Intronic
1112638525 13:101245143-101245165 CAGGGGCTGCAGACTGAGGAGGG - Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113370037 13:109715911-109715933 CAGTGGGGGCAGAATGAGGGAGG - Intergenic
1115646429 14:35371452-35371474 AAGTGTGTGCTGAATGTGGATGG + Intergenic
1116198693 14:41762115-41762137 CAGGGTGTGAAGACAGAGGGTGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1119181109 14:72605829-72605851 GAGGTTGTGCAGAGTGATGATGG - Intergenic
1121163124 14:91764007-91764029 CAGGCTTTGCAGAATGAGTCAGG - Intronic
1121553616 14:94820303-94820325 CTGGGGGTGGAGAGTGAGGAGGG - Intergenic
1123132989 14:106001956-106001978 CACGGTGTGGACACTGAGGAAGG + Intergenic
1123147120 14:106142682-106142704 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123162622 14:106293930-106293952 CATGGTGTGGATACTGAGGAAGG + Intergenic
1123197977 14:106635248-106635270 GAGGGTGTGCAGAATTAGACAGG - Intergenic
1123223690 14:106879968-106879990 CATGGTGTGGACACTGAGGAAGG + Intergenic
1202880854 14_KI270722v1_random:58600-58622 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
1123583016 15:21732402-21732424 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123619666 15:22174999-22175021 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1124474759 15:30023180-30023202 GAGGGTGAGCAGAATCAGGGTGG - Intergenic
1124592442 15:31065268-31065290 CAGAGTGGGTAGAATGGGGATGG - Intronic
1125829408 15:42703301-42703323 GAGGGAGTGCAGAATGAGAACGG - Intronic
1126675281 15:51155452-51155474 AAGGGTGTGCGGACTGGGGAAGG + Intergenic
1127818370 15:62632790-62632812 GTGGTTGTGCAGAATGTGGAGGG + Intronic
1128068548 15:64779231-64779253 CTGGGGGTGGAGAGTGAGGATGG - Intergenic
1130892196 15:88142567-88142589 CAGGCAGTGGAAAATGAGGAGGG + Intronic
1131229175 15:90647493-90647515 AGGGGTGTGGAGGATGAGGAGGG - Intergenic
1131229224 15:90647628-90647650 AGGGGTGTGGAGGATGAGGAGGG - Intergenic
1132006285 15:98230380-98230402 CAGCATGGGCAGCATGAGGAGGG + Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1132688196 16:1171045-1171067 AAGGGTGTGCAGGAAGAGGGAGG - Intronic
1132734435 16:1378558-1378580 CAGAGTGCGCAGCATGTGGAGGG + Intronic
1133042415 16:3067684-3067706 CAGGGTGAGAAGGATGAAGAGGG + Intronic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1134249832 16:12566466-12566488 CTGGCTGTGCTGAATGATGATGG + Intronic
1136680084 16:31955619-31955641 CACGGTGTGGACACTGAGGAAGG - Intergenic
1136871972 16:33815969-33815991 CATGGTGTGGACACTGAGGAAGG - Intergenic
1136875194 16:33848764-33848786 CACGGTGTGGACACTGAGGAAGG + Intergenic
1136889980 16:33962485-33962507 CACGGTGTGGACACTGAGGAAGG + Intergenic
1137020393 16:35420022-35420044 CAGGCTGTGCAGATTGAGCAGGG + Intergenic
1139108390 16:63856916-63856938 CAGGCTGTGCTGAATGTTGAAGG + Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139958387 16:70704170-70704192 CAGGGTGGGCAGGAGGAGTAAGG + Intronic
1139980770 16:70857082-70857104 CAGGGTAGGGAGAATAAGGAAGG - Intronic
1140177660 16:72679951-72679973 CAGGGGCTGCAGGGTGAGGAGGG + Intergenic
1140653578 16:77115900-77115922 CAGGCTGTACAGAATTAGGAAGG - Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141527196 16:84618738-84618760 GGGGGTGGGGAGAATGAGGAAGG - Intergenic
1141717422 16:85734902-85734924 CAGGCTGTGGAGAGTGAGGGAGG - Intronic
1142205208 16:88779677-88779699 CTGTGTGTGCAGCATGAGGGAGG + Intronic
1203083054 16_KI270728v1_random:1161129-1161151 CACGGTGTGGACACTGAGGAAGG - Intergenic
1203094614 16_KI270728v1_random:1243417-1243439 CATGGTGTGGACACTGAGGAAGG - Intergenic
1203100200 16_KI270728v1_random:1300099-1300121 CATGGTGTGGACACTGAGGAAGG + Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142698843 17:1647775-1647797 CAGGCTCAGCAGAATGAGGGAGG + Intronic
1143015767 17:3890416-3890438 CCTGGTGTGGAGGATGAGGAGGG - Intronic
1143477448 17:7211027-7211049 CAGGGTTTCCAGAATGTGGCTGG + Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1144653703 17:17022246-17022268 CATGGTGTGCAGAATGAGCTCGG + Intergenic
1146373640 17:32280477-32280499 CAGGCTGTGAAGGAGGAGGAAGG + Intronic
1147371580 17:39996477-39996499 CAGGGGGCCCAGAATGGGGAGGG + Intronic
1147399963 17:40174780-40174802 CTGGGTGGGCAGAAAGAAGAGGG + Intergenic
1147522747 17:41190118-41190140 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147526284 17:41226886-41226908 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147527319 17:41238253-41238275 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147528444 17:41249937-41249959 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147529873 17:41265609-41265631 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147530455 17:41271542-41271564 CAGGGTGTGCTGCAGCAGGAAGG - Intergenic
1147530868 17:41275914-41275936 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148715068 17:49710108-49710130 AAGGCTGTCCAGAATGAAGAGGG - Intergenic
1148782089 17:50128278-50128300 CAGTTTGTGCTGAATCAGGATGG - Intronic
1149391617 17:56197239-56197261 CAGTGTGTGCAGAATCAGATAGG - Intronic
1150104877 17:62455357-62455379 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1152572006 17:81125040-81125062 CAGGGTGAGCAGGGTGAGCAGGG + Intronic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1156472413 18:37385625-37385647 CAGGGTTTGCAGAATGAATCAGG - Intronic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160251988 18:77210692-77210714 CAGGGTGTGAAGAAGAAGGCAGG - Intergenic
1161292314 19:3501248-3501270 TAGGGTGTGCAGTTTCAGGAAGG + Intergenic
1161332885 19:3696715-3696737 CAGGGAGGGCAGAGTGCGGAGGG + Intronic
1161509636 19:4663297-4663319 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509654 19:4663384-4663406 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509665 19:4663431-4663453 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509686 19:4663517-4663539 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509698 19:4663562-4663584 GAGGCTGTGTAGAATGAGGGTGG - Intronic
1161509743 19:4663736-4663758 GAGGCTTTGTAGAATGAGGATGG - Intronic
1161509756 19:4663781-4663803 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509768 19:4663828-4663850 AAGCCTGTGCAGAATGAGGATGG - Intronic
1161945755 19:7435501-7435523 CAGGGTGAGCAGGTTCAGGATGG + Intronic
1162755213 19:12854039-12854061 CAGGGAGGGAGGAATGAGGAGGG - Intronic
1162758463 19:12874331-12874353 CAGAGCGTGCAGACGGAGGATGG + Exonic
1162832163 19:13292136-13292158 CAGGGTGGACAAAATGAGGGTGG - Intronic
1162918963 19:13889289-13889311 CCTGGTCTGCAGAATGAGGCAGG + Exonic
1163207564 19:15814804-15814826 CAGGGTGTAAAGAATCAGGGTGG - Intergenic
1163413563 19:17172061-17172083 CAGCGTGTTCAGCATGAGGCAGG + Intronic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165274057 19:34733206-34733228 CAGATTGTGCAAAGTGAGGAAGG + Intergenic
1165927525 19:39336053-39336075 CGGGCTGTGCAGTAGGAGGAAGG + Exonic
1167146057 19:47681236-47681258 CAGGGAGTCCTGAGTGAGGATGG - Exonic
1167727422 19:51225766-51225788 GAGGGGATGCAGAATCAGGAGGG - Intronic
1168147671 19:54429076-54429098 CAGGGTGTGGGGTATGAGCAGGG - Intronic
1168559448 19:57370859-57370881 GAGGGTGTAGAGATTGAGGAAGG + Intronic
1168669621 19:58230704-58230726 CAGGATGGGCAAGATGAGGAGGG + Intronic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925363443 2:3295356-3295378 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363463 2:3295455-3295477 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363575 2:3295995-3296017 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925912788 2:8584039-8584061 CAAGCTGTGCGGAATGAGGCTGG - Intergenic
926855374 2:17250810-17250832 CAGGGTGTGCTTGATGAGGAGGG - Intergenic
927483637 2:23473632-23473654 CAGGCTGTGCCGAATGAATATGG - Intronic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
927711631 2:25329810-25329832 CAGCGTGTGCAGCATGAGGGGGG - Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929691286 2:44076089-44076111 CAGGGTGAGCAGGCTGGGGAGGG + Intergenic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
930395218 2:50814381-50814403 CAGGGTTTGGGGAATGAGAAGGG - Intronic
931058867 2:58503919-58503941 CAGGGTGAGCAGGGTGAGCAGGG + Intergenic
931199324 2:60081940-60081962 CAGGGTGGCCAGAATGACTAGGG - Intergenic
931954503 2:67405233-67405255 CAGGGTGTGGAGAAAAAGAAAGG + Exonic
932050571 2:68393921-68393943 CAGGGTGTGGAGGATCTGGAAGG + Intronic
932401877 2:71486340-71486362 CAGGCTGTAAAGAATGAGGGAGG - Intronic
933012183 2:77080346-77080368 GAGAGTGTGCAGACTGAGAAAGG - Intronic
933409682 2:81909891-81909913 CAGGATGTGCAAAAGGAGCATGG + Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
935211595 2:100943637-100943659 CAGGCTGTGCAGTAAGAAGAGGG + Intronic
937310854 2:120902501-120902523 CAGAGTGTGCAAAATAAGGAGGG + Intronic
937366328 2:121264509-121264531 CTGGGAGTGCAGAATCAGGAGGG + Intronic
937923239 2:127146921-127146943 CAGGTTGTCCAAAAAGAGGATGG + Intergenic
938900760 2:135796912-135796934 CAGGGTGTGCATTGTGAGGTGGG + Intronic
939339811 2:140880286-140880308 CAGGGTGTGCAGAATCTACAAGG - Intronic
939375170 2:141355980-141356002 CAGGCTGTGTAGACTGAGGAAGG - Intronic
939650635 2:144757876-144757898 CAGGGTGTGGGGAAGAAGGAGGG - Intergenic
939855385 2:147352758-147352780 CAGAGAGAGAAGAATGAGGAAGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
942386175 2:175445499-175445521 CTGGGTGTGCAGCATCAGGCTGG + Intergenic
943147770 2:184066451-184066473 CAGGGGGTGCAGACTACGGAGGG - Intergenic
945339464 2:208634682-208634704 CAGTTTGTTCAGAATGAGGCAGG - Intronic
945363152 2:208916771-208916793 CATCTTGTGTAGAATGAGGAAGG - Intergenic
945774503 2:214088149-214088171 CAGGGAGTGGAGGAAGAGGATGG + Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946152238 2:217784431-217784453 CAAGGCGTGGAGAATGAGGGAGG - Intergenic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948662451 2:239515672-239515694 GTGGGTGTGCAGAATGAGCAGGG - Intergenic
1168761862 20:354803-354825 GAAGGGGTGCAGGATGAGGAGGG - Exonic
1168798352 20:627411-627433 GAGGATGTGGTGAATGAGGATGG + Intergenic
1169192751 20:3668448-3668470 CAGGGTGGGAAGAAACAGGAAGG + Exonic
1169546972 20:6660422-6660444 CAGGGTGTGTAATATTAGGAAGG + Intergenic
1171571850 20:26259868-26259890 GAGGGTGTGGAGCAAGAGGAGGG - Intergenic
1172669189 20:36622701-36622723 CTGGCTGTGAAGACTGAGGAAGG - Intronic
1172852297 20:37975343-37975365 CAGAGTGTGCAGCTTCAGGAGGG + Intergenic
1174404250 20:50293466-50293488 CAGGCTGTGCAGCCTGAGAAAGG - Intergenic
1174541681 20:51294647-51294669 CAGGGTTGGAAGAAAGAGGAAGG - Intergenic
1177285991 21:19050411-19050433 CAGGGTGTGGAGAATGAGTGTGG + Intergenic
1177599475 21:23291371-23291393 CCAGGTGTTCAGAGTGAGGAAGG + Intergenic
1178047977 21:28717123-28717145 CTGGGTTTGTAGAATGAGGGAGG + Intergenic
1178288994 21:31350374-31350396 CAGGGAGTGGAGAATGACGCTGG + Intronic
1179994477 21:44967645-44967667 CAGGGTGTGCAGTGTTAGGTGGG - Intronic
1180375470 22:12088906-12088928 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
1182679024 22:32063851-32063873 GAGGGAGTCCAGAATGAGGAAGG + Intronic
1183266188 22:36827235-36827257 CAAGGTTTGCAGAATGACAATGG + Intergenic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183933003 22:41246799-41246821 CACGGTGTGCAGAAGGCAGAGGG - Intronic
1184096068 22:42317174-42317196 GAGGGTGTGCCGAGTGAGGGCGG - Intronic
1184115184 22:42417982-42418004 CAGGGTGGGCAGACTAAGCAGGG - Intronic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1184834295 22:47012025-47012047 AAGGGTGTGCAGAATCAGCTGGG - Intronic
1184886138 22:47345408-47345430 GAGGGTGTCCTGCATGAGGAGGG + Intergenic
1185128072 22:49022741-49022763 CTTGGTGTGGAGAAAGAGGAGGG + Intergenic
1185299133 22:50070383-50070405 CAGGGCCTGCACAATGAGGAAGG - Intronic
949327866 3:2887380-2887402 CTGGGTGTGGAGAGTGAGGGTGG + Intronic
949441086 3:4081322-4081344 CAGGCAGTGAAGAAAGAGGATGG - Intronic
952629501 3:35448462-35448484 CCTGGTGAGAAGAATGAGGAAGG + Intergenic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
953669673 3:44951967-44951989 GAGAGAGTGCAGAATGAGCAGGG - Intronic
954047397 3:47944350-47944372 CAGACTGTGGAGAATGAGAAAGG - Intronic
955935217 3:64096497-64096519 CAGAGAATGCTGAATGAGGAAGG - Exonic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956231221 3:67018776-67018798 CTTGGTGTTCAGAATGAAGACGG + Intergenic
956959942 3:74387554-74387576 CAGGTGGTGCAGAATGAGCTGGG + Intronic
957457445 3:80470504-80470526 CAGGATGTGTAGAATGAACAAGG - Intergenic
957981546 3:87517881-87517903 CAGGGTGTGCAAAATTATGCTGG + Intergenic
960109901 3:113835882-113835904 AAAGTTTTGCAGAATGAGGATGG + Intronic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961664255 3:128486392-128486414 CAGGGTGGGCAGAAAGATCAGGG + Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
964527353 3:157629749-157629771 CAGGGTGTGGAGGAGGAGGCAGG + Intronic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965888378 3:173477915-173477937 CAGGTTGTGGAGAAATAGGAAGG + Intronic
968538265 4:1148787-1148809 CAGGCTGTGGAGACTGAGGCAGG - Intergenic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969232671 4:5842538-5842560 CAGGGAGTGTGGAAGGAGGAAGG - Intronic
969307146 4:6332343-6332365 TGGGGTGTGCAGTGTGAGGAGGG + Intronic
969817124 4:9695167-9695189 CAGGGTGTGCAGCATGCAGGTGG - Intergenic
970155469 4:13137261-13137283 AAGGGTCTGCAGGTTGAGGAAGG + Intergenic
972272539 4:37524968-37524990 CAGGGTGTCCAGATTTAAGATGG + Intronic
972312937 4:37898401-37898423 CAAGGTGTGTAGAAACAGGAAGG - Intronic
973653544 4:53021976-53021998 CCTGGTGTGAAAAATGAGGAGGG + Intronic
973676481 4:53268577-53268599 CAGAGCCTGCAGAATGAGGAGGG + Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
977185723 4:93933055-93933077 AAGGGTGAGCAGAATCAGGGTGG - Intergenic
977367283 4:96086381-96086403 TAGGGTGAGCAGAAAGGGGAGGG + Intergenic
977474653 4:97490260-97490282 CAGGTTATGTAGAATGATGAGGG - Intronic
978483530 4:109223478-109223500 CAGGGTATGCAGAATTAGTTGGG + Intronic
982495898 4:156091832-156091854 GTGGGTGTGGAGGATGAGGAGGG + Intergenic
982563588 4:156961801-156961823 GATGGCGTGCAGAATGAGGCTGG - Intronic
984137507 4:175959268-175959290 TAAGCTGTGCAGAATGAAGATGG - Intronic
984925321 4:184801361-184801383 ATGGGGGTGCAGAATGAGGGTGG + Intronic
1202757066 4_GL000008v2_random:74348-74370 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
986512530 5:8523395-8523417 TAGGGTCTGCAGGATAAGGAAGG + Intergenic
987211973 5:15692834-15692856 GAAGATGTGAAGAATGAGGAAGG + Intronic
988042844 5:25910939-25910961 CAGGATGAGCAGGATGAGAATGG + Intergenic
990341020 5:54823246-54823268 CAGAGTATGCAGAATGGGGGAGG + Intergenic
991278072 5:64874723-64874745 CAGGGTTTGGAAAATGAGGAGGG - Intronic
991528120 5:67585955-67585977 CCAGGTGTTCAGAAGGAGGAAGG + Intergenic
994939340 5:106301461-106301483 CAAGATGTGCAAAATGATGATGG - Intergenic
995274203 5:110259629-110259651 CAGGGAGAGCAGATTTAGGATGG + Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
999381443 5:151124167-151124189 TAGAGTCTGCAGGATGAGGAAGG - Intronic
999700289 5:154221434-154221456 CAGGATGTGCAGACTCAGTAAGG - Intronic
1000338717 5:160260800-160260822 CAGGGTTGGCTGAGTGAGGAGGG - Intronic
1000664953 5:163983614-163983636 CAGTACGTGCAGAATGAGAAGGG + Intergenic
1002505950 5:179679226-179679248 CCGGATGTCCAGAATGATGAAGG + Exonic
1003324410 6:5081907-5081929 CAGGGGCTGCAGACTGAGCAAGG + Intergenic
1003418286 6:5932826-5932848 GAGGCTGGGAAGAATGAGGAAGG + Intergenic
1003955577 6:11162217-11162239 CAGGGTGTGTGGAATCAGGGAGG + Intergenic
1003980308 6:11383145-11383167 CAAGGAGTGGAAAATGAGGAAGG - Intergenic
1005391121 6:25334233-25334255 CTGTGTGTCCAGAATCAGGAAGG - Intronic
1006144305 6:31949148-31949170 CAGGGTGAGCAAGTTGAGGAAGG - Intronic
1006153456 6:32001528-32001550 CGGGGTCTGCAGGACGAGGATGG + Exonic
1006159764 6:32034265-32034287 CGGGGTCTGCAGGACGAGGATGG + Exonic
1006379847 6:33691134-33691156 CAGGTTGTGGGGAATGAGGTTGG + Intronic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1006735149 6:36268080-36268102 CTGGGGCTGGAGAATGAGGAAGG - Intronic
1006874679 6:37285096-37285118 CAGGGGTTGCAGAAAGTGGAAGG + Intronic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1006937845 6:37730746-37730768 CGGGGTGTTCAGCATGAGCATGG + Intergenic
1007070846 6:39037227-39037249 AAGGGTTTGCATAATCAGGAAGG - Intergenic
1007662751 6:43496579-43496601 CAGGCTGTCCAGACAGAGGAGGG + Intronic
1007937029 6:45741584-45741606 CAGAGTGGGCAGAAACAGGAGGG - Intergenic
1008237527 6:49068324-49068346 GTGGGTGGGCAGACTGAGGATGG + Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008413065 6:51205848-51205870 GGGGGTGTGTAGAAAGAGGAAGG + Intergenic
1008807621 6:55451067-55451089 CAGTGTGTGCACAAAGAGAAGGG + Intronic
1009458670 6:63887502-63887524 GAGGGTGGGCAGAATCAGGGAGG + Intronic
1009860383 6:69322481-69322503 GAGGTTGTGCAGAAAAAGGAAGG - Intronic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1014227191 6:118861927-118861949 CAGGCTGTTCAGGATGAGGGAGG + Intronic
1015853451 6:137598833-137598855 CAGGGCATGCAGAATGCTGATGG - Intergenic
1016154269 6:140784175-140784197 CAGGGGGTGGAGAAGGAGCATGG + Intergenic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1018887293 6:167950777-167950799 GAGGGTGAGGAGGATGAGGATGG + Intronic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1020005712 7:4782948-4782970 CTGGGTGTGCAGAGTGAGGTGGG + Intronic
1020665921 7:11043928-11043950 CAGGCTGAGCAGTATCAGGAGGG - Intronic
1021826766 7:24561237-24561259 CTGGATGTGAGGAATGAGGAAGG - Intergenic
1021964649 7:25905641-25905663 CAGGGTGTGCAGATTACGTAGGG + Intergenic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1022421061 7:30223849-30223871 CAGTATGTGTAGAATGAGAAAGG + Intergenic
1022558857 7:31328183-31328205 GAGGGTGTGGAGAAATAGGAAGG - Intergenic
1022822476 7:33974713-33974735 GAGGGTGTGCAGTATCAAGAAGG + Exonic
1023878714 7:44306825-44306847 GAGTGTGAGTAGAATGAGGAGGG + Intronic
1024137742 7:46428269-46428291 CAGAGTGTGCACTATGATGATGG + Intergenic
1024268664 7:47625872-47625894 CAGGGGGTGAAGAATGAGAGAGG + Intergenic
1024333702 7:48181953-48181975 CAGGGAGTGAGGAAAGAGGAAGG - Intronic
1025190587 7:56892834-56892856 CTGGGTGTGCACAGTGTGGATGG + Intergenic
1026244157 7:68603531-68603553 AAACGTGTGCAGAATGAGGGAGG - Intergenic
1026977571 7:74507836-74507858 TTGGGTGTGCAGACTTAGGAGGG + Intronic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1027652802 7:80891303-80891325 CAGGTTTTGCAAAGTGAGGATGG - Intronic
1028249357 7:88522781-88522803 CAGGCTGTGGAGAAGGAGCAGGG + Intergenic
1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG + Intronic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1032034048 7:128508575-128508597 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1032178248 7:129651110-129651132 CAGGGTGTGCTGAATAAAAATGG + Intronic
1032554126 7:132813779-132813801 CAGGTGGTGGAGAAAGAGGAGGG + Intronic
1033282417 7:140015591-140015613 CATGGTGTGTGGAATGAGGCTGG - Intronic
1033463301 7:141567153-141567175 CAGAGTGTGTAGAATGAGAATGG - Intronic
1033653018 7:143356234-143356256 CAGTGTGTGCACCCTGAGGACGG - Exonic
1034293082 7:149947647-149947669 CAGCGTGTGCAGGATGAGTGGGG + Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034812991 7:154149226-154149248 CAGCGTGTGCAGGATGAGTGGGG - Intronic
1034953983 7:155321957-155321979 CAGAGTGAGAAGAATTAGGAGGG + Intergenic
1035762640 8:2080889-2080911 CAGCCCGTGCAGAATGAGGTTGG + Intronic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1037396788 8:18451884-18451906 CTGGCTTTGGAGAATGAGGAAGG - Intergenic
1038035444 8:23682785-23682807 CAGGATGTCCTGGATGAGGAAGG + Exonic
1038478384 8:27884897-27884919 CAGGGAGTACAGAGTGAGGCAGG + Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040781986 8:51120528-51120550 CAGAGAGTGCTGAATGAGAAAGG - Intergenic
1041709553 8:60881447-60881469 CAGGCTTTGCAGATGGAGGAAGG - Intergenic
1041748491 8:61234200-61234222 CAGGGGGTAGAGAATGAGGGTGG + Intronic
1042540864 8:69906016-69906038 CAGGCTGTGCAGAATGGGGCAGG - Intergenic
1042706400 8:71668703-71668725 CATGGTGTGCAGGATAAGGAAGG - Intergenic
1043889787 8:85642998-85643020 CAGGCTGTGCCCGATGAGGATGG + Intergenic
1043891324 8:85654906-85654928 CAGGCTGTGCCCGATGAGGATGG + Intergenic
1043892398 8:85661743-85661765 CAGGCTGTGCCCGATGAGGATGG + Intergenic
1043893159 8:85715592-85715614 CAGGCTGTGCCCGATGAGGATGG - Intergenic
1043895846 8:85737046-85737068 CAGGCTGTGCCCGATGAGGATGG - Intergenic
1043896833 8:85744762-85744784 CAGGCTGTGCCCGATGAGGATGG + Intergenic
1043899156 8:85763128-85763150 CAGGCTGTGCCCGATGAGGATGG + Intergenic
1043900767 8:85775323-85775345 CAGGCTGTGCCCGATGAGGATGG + Intergenic
1043902731 8:85790598-85790620 CAGGCTGTGCCCGATGAGGATGG + Intergenic
1043904341 8:85802791-85802813 CAGGCTGTGCCCGATGAGGATGG + Intergenic
1043905953 8:85814985-85815007 CAGGCTGTGCCCGATGAGGATGG + Intergenic
1043907561 8:85827172-85827194 CAGGCTGTGCCCGATGAGGATGG + Intergenic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045016971 8:98008688-98008710 CAGGGGGTGCAGAAAGAGGGTGG + Intronic
1045649442 8:104328529-104328551 CAGGTTGGGCAGAAAGAGGGAGG + Intergenic
1047548579 8:125844203-125844225 CAGGGTGAGCAAAAAAAGGATGG - Intergenic
1048971817 8:139649388-139649410 CTGAGGGTGTAGAATGAGGAAGG + Intronic
1049137697 8:140919060-140919082 CAGTGTGTGCAGCACCAGGAAGG + Intronic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1052677285 9:31643697-31643719 CAGGGTGTGCACCATCAGGTTGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053463083 9:38285576-38285598 CAAGGTGAGGAGAATGAAGAAGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1055719930 9:79161589-79161611 TGGGGTGTGCAGCATAAGGAAGG - Intergenic
1056147907 9:83752546-83752568 CGGGGTGTGGAAAATGAGAATGG + Intronic
1057185246 9:93053820-93053842 CTTGGTGTGCAGGATGAGCATGG + Intergenic
1057311549 9:93946251-93946273 CAGGGTGTCCGGAACGAGCAAGG - Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1060218470 9:121752286-121752308 CAGGGTTTGCAGGCTGAGGGAGG + Intronic
1060732449 9:126047127-126047149 CATGGAGTGCAGAATGAGGCAGG - Intergenic
1203537858 Un_KI270743v1:59208-59230 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
1186719690 X:12289929-12289951 TGGGTAGTGCAGAATGAGGAGGG + Intronic
1189982791 X:46528040-46528062 CAGGGTGAGAGGAATGAGAAGGG + Intronic
1191112152 X:56812370-56812392 TAGGGAGGGCAGAAAGAGGAGGG - Intergenic
1191694349 X:63974158-63974180 TGGGGGTTGCAGAATGAGGATGG + Intergenic
1191870178 X:65739063-65739085 CAGGATGAGCAGGATGAGAATGG + Exonic
1192225255 X:69222996-69223018 CAGAGTGAGCAAAATGAGGCAGG + Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1192341298 X:70265717-70265739 CCGGGTGTACAGAATGAGGGTGG + Intergenic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1194996642 X:100598254-100598276 TATGCTGTGCAGAATGAGGGAGG - Intronic
1195256089 X:103092807-103092829 CAGGGTTTGAGGTATGAGGAGGG - Intronic
1195821828 X:108954005-108954027 GGGGGTGTGCAGAATGTGTATGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197487872 X:127075528-127075550 CAGGGTGGGGAGAATGTGGGAGG + Intergenic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1198018325 X:132633910-132633932 AATGGTGTCAAGAATGAGGAAGG - Intronic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1201225537 Y:11815109-11815131 AGGGGTTTGTAGAATGAGGAAGG - Intergenic
1201458095 Y:14193350-14193372 CAGGTCTTGAAGAATGAGGAAGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic