ID: 1163595018

View in Genome Browser
Species Human (GRCh38)
Location 19:18216200-18216222
Sequence GGGTACAGCCAGGATCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163595011_1163595018 1 Left 1163595011 19:18216176-18216198 CCAGAAACGGTTTCCACATTGCC 0: 1
1: 0
2: 1
3: 6
4: 96
Right 1163595018 19:18216200-18216222 GGGTACAGCCAGGATCTGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 163
1163595009_1163595018 3 Left 1163595009 19:18216174-18216196 CCCCAGAAACGGTTTCCACATTG 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1163595018 19:18216200-18216222 GGGTACAGCCAGGATCTGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 163
1163595010_1163595018 2 Left 1163595010 19:18216175-18216197 CCCAGAAACGGTTTCCACATTGC 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1163595018 19:18216200-18216222 GGGTACAGCCAGGATCTGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 163
1163595008_1163595018 10 Left 1163595008 19:18216167-18216189 CCTGACACCCCAGAAACGGTTTC 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1163595018 19:18216200-18216222 GGGTACAGCCAGGATCTGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163595018 Original CRISPR GGGTACAGCCAGGATCTGCT GGG Intronic
900309923 1:2028756-2028778 GGGCACAGCCAGGCTCTGGAAGG - Intronic
900539684 1:3196586-3196608 GGGTTCAGCCAGGAACCGCAGGG + Intronic
900892514 1:5459712-5459734 TGGTGCAGCCAGGGTCTGATAGG + Intergenic
901460896 1:9391036-9391058 GGGGACAGTCAGAAGCTGCTTGG - Intergenic
902721785 1:18308928-18308950 AGGTGCAGCCTGGAGCTGCTGGG + Intronic
904917620 1:33981821-33981843 GGGCACAGTGAGGTTCTGCTGGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906244231 1:44261972-44261994 GAGTAGAGGGAGGATCTGCTTGG + Intronic
910199223 1:84681336-84681358 TGGTACAGCCAGGCTATTCTGGG + Intronic
910674827 1:89806242-89806264 GGGTACAGCAAGTATCTAGTGGG - Intronic
913509505 1:119549109-119549131 GGGCACAGGCAGGATCACCTGGG + Intergenic
916221252 1:162446915-162446937 GGGCACAGCCTGGCTCTCCTGGG - Intergenic
917678505 1:177342310-177342332 GGGTATAGCCATGATCTGAGAGG - Intergenic
918687632 1:187438398-187438420 TGGTACAGCCAGTGCCTGCTAGG + Intergenic
919820264 1:201468160-201468182 GGGGAAAGTCCGGATCTGCTGGG + Intronic
920061015 1:203227045-203227067 GGGTACAGACAGACCCTGCTGGG - Intronic
924636474 1:245792749-245792771 GGGTGCAGACATGATCTGCAGGG + Intronic
1068484655 10:57642349-57642371 GGGTACAACTAGGATCTAGTTGG - Intergenic
1069381201 10:67844526-67844548 GCATGCAGCCAGCATCTGCTTGG - Intergenic
1069761382 10:70814010-70814032 GGGCTCTGCCAGGAACTGCTAGG + Intergenic
1069902754 10:71715399-71715421 GGGTGCTGCCAGCATCTGCCTGG - Exonic
1071100957 10:82037199-82037221 GAGTGCAGCCAGGATCTGCCAGG - Intronic
1076300470 10:129421750-129421772 GGATACAGCCAGAATCTTCTGGG - Intergenic
1077024370 11:432753-432775 GGGCTCAGCCAGGGCCTGCTTGG - Intronic
1077633717 11:3827680-3827702 GCGCACAGCGTGGATCTGCTTGG + Exonic
1078553013 11:12293354-12293376 GGGTCCTGCCAGGATCTGCCTGG - Intronic
1078868169 11:15318037-15318059 ATGTACAGCCAGGACCTGCCAGG + Intergenic
1080684735 11:34505580-34505602 GAGTGCAGCCAGGATGGGCTAGG - Intronic
1080804584 11:35640920-35640942 TATTGCAGCCAGGATCTGCTGGG + Intergenic
1080939405 11:36898393-36898415 GGGTGCAGCCTGGTTCAGCTGGG - Intergenic
1083878258 11:65536077-65536099 GAGCACAGGCAGGATCTTCTGGG - Exonic
1087386191 11:97471664-97471686 GCCTAGACCCAGGATCTGCTGGG - Intergenic
1089875955 11:121722533-121722555 AGGAACAGCCAAGCTCTGCTGGG - Intergenic
1090964311 11:131584896-131584918 TGGTGCTGCCAGGATCCGCTTGG + Intronic
1094490400 12:30957264-30957286 CTGTGCTGCCAGGATCTGCTGGG + Intronic
1101806655 12:108069932-108069954 GGCTACAGCCTGGAACTGCAGGG + Intergenic
1102981830 12:117247700-117247722 GGGTAAAGCCCTGATCTGATAGG + Intronic
1103704074 12:122861980-122862002 GGGTGCAGCCAGGACCCGGTAGG + Exonic
1103843656 12:123886345-123886367 GAGTAGTGCCAGGAGCTGCTGGG + Intronic
1105529230 13:21203155-21203177 GGGTGCAGACAGAACCTGCTTGG + Intergenic
1107004988 13:35599487-35599509 TGGAACAGCCAGGAACTGCCTGG + Intronic
1109356255 13:61232855-61232877 TAGCTCAGCCAGGATCTGCTGGG + Intergenic
1109829457 13:67768579-67768601 AAGTATAGCCAGGATCTGCTAGG + Intergenic
1112202126 13:97286947-97286969 GTGTACAGCCAGTAGCTGCCAGG - Intronic
1112312202 13:98328786-98328808 ACGGACAGCCTGGATCTGCTGGG + Intronic
1112694708 13:101935246-101935268 GGCTACATCCAGCAGCTGCTTGG + Intronic
1113948933 13:114060503-114060525 GAGGACAACCAGGATTTGCTCGG - Intronic
1115870297 14:37793311-37793333 GGTTTCAGCCAGGATAAGCTAGG + Intronic
1115920593 14:38368057-38368079 GGGTACAGGCAGGATAGGCAGGG + Intergenic
1120740816 14:88106647-88106669 CTGTTCAGCCAGGATCTGCTGGG - Intergenic
1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG + Intergenic
1127897017 15:63310041-63310063 CATTAAAGCCAGGATCTGCTTGG - Intergenic
1129172246 15:73815281-73815303 GGCTACAGGCAGGATGTGCCAGG - Intergenic
1130984752 15:88837505-88837527 GGGTACAGCCAGGGGCTGCATGG - Intronic
1131512167 15:93055465-93055487 GGGGAAAGCCGGGCTCTGCTGGG + Intronic
1132804439 16:1769132-1769154 GGGTAGAGCCAGGACCACCTCGG - Exonic
1132822419 16:1881707-1881729 GGGTACAGCCAGGCACAGCCGGG - Intronic
1135421428 16:22308031-22308053 GGGTAAGGCCAGTCTCTGCTTGG + Intronic
1137586363 16:49666121-49666143 GGGGCCAGCCAGGATCTGGGGGG - Intronic
1143868022 17:9938175-9938197 GGGTGCAGCCCTGATCTGATAGG + Intronic
1143938548 17:10513411-10513433 GGGAACTGCCAGGAACTGCTGGG - Intronic
1144114565 17:12074768-12074790 GGGTACTGCCAGGATCTTCCTGG + Intronic
1144387596 17:14763817-14763839 GGGTATAGCCAGGTCATGCTAGG + Intergenic
1146151061 17:30472691-30472713 GGTTTCTGCCCGGATCTGCTTGG - Intergenic
1146185102 17:30719626-30719648 GGGTCCAGCCAGGAGATGATGGG + Intergenic
1147653211 17:42073544-42073566 GGAGACAGCCAGAGTCTGCTGGG + Intergenic
1148947602 17:51278158-51278180 GGGTAAACCAAGGATCTACTTGG - Intronic
1150205509 17:63402601-63402623 GGAAACAGCCAGAGTCTGCTTGG - Intronic
1152040046 17:77897228-77897250 GGGTACAGACAGGGTCTACTGGG - Intergenic
1152119408 17:78408959-78408981 GGGTACAGGCAGGAGCAGCCCGG + Intronic
1153780351 18:8490090-8490112 GGGTTAAGCCAGGTTCTGCAGGG + Intergenic
1156716491 18:40018581-40018603 GGGTACAGCCTGGGTGTGTTTGG - Intergenic
1157569630 18:48703903-48703925 GGTTACAGCAAGGATATGCCAGG + Intronic
1157699444 18:49751622-49751644 GGGGACAGCCAGGATAGGGTGGG + Intergenic
1158500993 18:58001712-58001734 GGCTGCAGCCAGGAACTCCTGGG + Intergenic
1158764817 18:60437306-60437328 GGGTATAGACAGGATCTGGAGGG - Intergenic
1161680986 19:5679698-5679720 GTGTACGACCAGGAGCTGCTGGG - Exonic
1162973677 19:14196063-14196085 GGGTCCAGCCAGGAGATGATGGG - Intronic
1163595018 19:18216200-18216222 GGGTACAGCCAGGATCTGCTGGG + Intronic
1165064326 19:33220174-33220196 GGGGACATCCAGGATGTGCCTGG + Intronic
1165430056 19:35767314-35767336 GGGTAGAGCCCAGATGTGCTAGG - Intronic
1166823527 19:45595394-45595416 GGGGAGAGCCAGGAGCTGCTGGG + Intronic
1168264794 19:55216874-55216896 GGGGCCAGCCAGGACCTGCCCGG + Intergenic
925057994 2:870182-870204 GTGCACAGCATGGATCTGCTGGG + Intergenic
925282331 2:2693331-2693353 GGGTACAGGCAGGAGCAACTTGG - Intergenic
928214464 2:29349851-29349873 GAGTAGAACCAGGACCTGCTGGG + Intronic
928455085 2:31413422-31413444 GGGGACAGCCATGTTCTTCTGGG - Intronic
931638014 2:64358074-64358096 GGGAACAGCCAGGATGGGGTTGG - Intergenic
934557100 2:95293289-95293311 GGGCACACCCAGCATATGCTAGG - Intergenic
934677273 2:96258455-96258477 GGGCCCAGCCAGCCTCTGCTGGG - Intronic
935094812 2:99934379-99934401 GGCCACAGGGAGGATCTGCTTGG - Intronic
936155401 2:110043545-110043567 GGGTGCAGCCAGGGTCTGGCAGG - Intergenic
936189279 2:110327868-110327890 GGGTGCAGCCAGGGTCTGGCAGG + Intergenic
939964933 2:148600795-148600817 AGGTACAGCATGGTTCTGCTGGG - Intergenic
946190923 2:218007575-218007597 GGGTTCAGCCAGGTCTTGCTTGG + Intergenic
946839106 2:223802247-223802269 AGGTACAGTCACTATCTGCTGGG + Intronic
948584855 2:239012915-239012937 GGGTACTGCCAGGTGCTGCTGGG + Intergenic
1169506828 20:6220352-6220374 CGGTACAGCCAGCAGCTTCTTGG - Intergenic
1171307646 20:24119892-24119914 GGGGATAACCAGGATCGGCTTGG + Intergenic
1171424709 20:25042330-25042352 CGCTACAGCCAGAATCTGATAGG - Intronic
1172243382 20:33428649-33428671 GGGTACAGCCTTGAACTCCTGGG + Intronic
1177615142 21:23507756-23507778 GGATACACCCAGGACCTGATGGG + Intergenic
1179563283 21:42230744-42230766 GGGAACCGCCGGGATCTCCTGGG - Intronic
1180937665 22:19636858-19636880 GGGTAGAGCCTGGATGTGCATGG - Intergenic
1181014343 22:20060705-20060727 GGAGACAGCCTGGCTCTGCTGGG - Intronic
1181075500 22:20373359-20373381 GAGAACAGCCAGCATTTGCTAGG + Intronic
1181534096 22:23532944-23532966 GGGTCCAGCCTGGCTCTGGTGGG - Intergenic
1181610442 22:24007979-24008001 GGTCAGAGCCAGGATCTGCCTGG - Intergenic
1182249655 22:28990045-28990067 AGGTACAGTCAGGATCAGCTAGG + Intronic
1183264633 22:36817620-36817642 AGGGACAGGCAGGAGCTGCTGGG + Intronic
1184761761 22:46548944-46548966 GGGTCAAGCCAGGTTCTGCTGGG + Intergenic
953419966 3:42746904-42746926 GGGGAGACCCAGGATCTACTGGG + Intronic
961152524 3:124651373-124651395 GAGTAGAGACAGGACCTGCTTGG - Intronic
962333654 3:134505434-134505456 GGCTATAGCAAGGCTCTGCTGGG + Intronic
963948558 3:151172506-151172528 AGGCACAGCCAGGATCTTTTGGG + Intronic
967907399 3:194513010-194513032 GGGTAAACACAGGCTCTGCTGGG + Intergenic
968600758 4:1508318-1508340 GGGGACAGCGAGGACCTGCAAGG - Intergenic
968896720 4:3408646-3408668 GGGCACAGACGGGACCTGCTGGG - Intronic
969816579 4:9691796-9691818 GGGTATGGCCAGGCGCTGCTCGG - Intergenic
974902568 4:68019393-68019415 GGGATAAGCCAGGATTTGCTAGG - Intergenic
979014194 4:115411988-115412010 TGCTACAGCCTGGACCTGCTGGG + Intergenic
979598331 4:122558585-122558607 GGGTAGAGCAAGGGTCTACTAGG - Intergenic
980009595 4:127580591-127580613 GCATAGTGCCAGGATCTGCTTGG - Intergenic
981580954 4:146247874-146247896 GGGTACAGCCAGCCACTCCTGGG + Intergenic
984417582 4:179480528-179480550 TGGTACAGCCTGTTTCTGCTAGG - Intergenic
984581712 4:181517467-181517489 AGGTACAGCCTGGCTCTGCAGGG - Intergenic
987304626 5:16625675-16625697 GGCCACAGCCAGGATGTTCTTGG - Intergenic
994852992 5:105080613-105080635 GAGAACAGCCAGAATCTTCTTGG - Intergenic
995815704 5:116165772-116165794 GGGTACAGCACTGATCTGTTAGG - Intronic
998040285 5:138947151-138947173 GGCTACTTCCAGGAGCTGCTGGG - Exonic
999386229 5:151156343-151156365 GGTTACAGTCCGGATGTGCTGGG - Intronic
1001479627 5:172079043-172079065 GGTTAGACCCAGTATCTGCTTGG - Intronic
1005194986 6:23271868-23271890 GGGTAGAGCCCTGATCTGATGGG - Intergenic
1006180604 6:32151538-32151560 AGGTACAGCCAGGTTTTGCAGGG - Intronic
1006522607 6:34580495-34580517 GGGCACACTCAGGAGCTGCTGGG + Intergenic
1007591013 6:43021004-43021026 AGGGCCAGCCAGGTTCTGCTGGG + Exonic
1010324727 6:74551006-74551028 TAGTACAGGCAGCATCTGCTGGG - Intergenic
1010444285 6:75933659-75933681 GAATACAGCCAGAATCTACTGGG - Intronic
1011366944 6:86593033-86593055 GTGTACAGCTAGGCTCAGCTAGG - Intergenic
1011418482 6:87147784-87147806 CACTACAGCCTGGATCTGCTAGG - Intergenic
1012491927 6:99791880-99791902 TTGTTCAGCCAGGATCAGCTGGG + Intergenic
1013706037 6:112835244-112835266 GGGCTCAGCTGGGATCTGCTGGG + Intergenic
1014577790 6:123094780-123094802 GAGCACAGACAGGAGCTGCTGGG - Intergenic
1017628324 6:156370639-156370661 GGGGACAGCCAGGCTCTGGAGGG - Intergenic
1017742133 6:157416027-157416049 GGGAAGATCCAGGTTCTGCTTGG - Intronic
1018590830 6:165419995-165420017 GGGCACAGCCAGTATTTGTTTGG - Intronic
1020126735 7:5536970-5536992 GGGCACAGCCAGGAGCTGAAGGG + Intronic
1022176486 7:27876121-27876143 GGGGACACCCAGGATGTACTGGG - Intronic
1024259481 7:47563156-47563178 GGTCACAGCCAGGAGCTGCATGG + Intronic
1025143313 7:56483625-56483647 GGGAACAACCAGGCTCTCCTTGG + Intergenic
1025609913 7:63068705-63068727 GGGAACAGCCAGGCTCCCCTTGG - Intergenic
1026154950 7:67818627-67818649 GTGAATAGCCAAGATCTGCTTGG - Intergenic
1029443314 7:100600103-100600125 GAGTTCAGCAAGGAGCTGCTGGG + Exonic
1029724158 7:102391067-102391089 GGTTCCCGCCAGGGTCTGCTGGG + Intronic
1033467131 7:141603757-141603779 GGGGACAGCCAGCATCAACTTGG - Intronic
1038360698 8:26873031-26873053 AGGTTCTGCCAGGATCTCCTGGG - Intergenic
1039535946 8:38312764-38312786 GGATAGTGCCAGTATCTGCTTGG - Intronic
1044194008 8:89353089-89353111 GGGTACAGCCTGGCTTTTCTAGG + Intergenic
1045339645 8:101241760-101241782 GGGTACAGTCCATATCTGCTGGG - Intergenic
1047204063 8:122789381-122789403 GGGTACACCCAGGGGCTGGTGGG - Intronic
1051018981 9:12516984-12517006 GGCTACATCCAGGGTCTCCTTGG - Intergenic
1051585603 9:18723661-18723683 GGGCACAGCCAGGAGTTTCTTGG + Intronic
1051599512 9:18858641-18858663 CGGTGCAGGAAGGATCTGCTTGG + Intronic
1056854580 9:90115321-90115343 GGGTTCAGCCAGGATTATCTTGG + Intergenic
1057177025 9:93007830-93007852 GGGTGCACCCAGCATCTGGTGGG + Intronic
1057476400 9:95406515-95406537 GTATACTGCCAGGCTCTGCTGGG - Intergenic
1058137508 9:101323417-101323439 GAGTACAGCCTTGATCTGCTGGG - Intronic
1058688395 9:107498769-107498791 GGGTACTGAAAGGGTCTGCTGGG + Intergenic
1061246394 9:129403020-129403042 GGGTCCAGCCTGGCTCTGGTGGG + Intergenic
1062288887 9:135785839-135785861 GGGCAAGGCCAGGATGTGCTGGG + Intronic
1062521700 9:136960579-136960601 GGGTACAGCCTGCAGCTGCGGGG + Intergenic
1193149663 X:78111688-78111710 TGGTACAGCAGGGATGTGCTTGG - Intronic
1194142520 X:90222778-90222800 GGGGACAGCAAAGATCTGCAGGG - Intergenic
1194268204 X:91780016-91780038 GGGTACAGCCAGCTTCAGCGAGG + Intronic
1200488275 Y:3791879-3791901 GGGGACAGCAAAGATCTGCAGGG - Intergenic
1200585405 Y:5000937-5000959 GGGTACAGCCAGCTTCAGCGAGG + Intronic
1202177164 Y:22108497-22108519 TGGTACAGGCAGAATCTGCCTGG + Intergenic
1202214197 Y:22477887-22477909 TGGTACAGGCAGAATCTGCCTGG - Intergenic