ID: 1163597019

View in Genome Browser
Species Human (GRCh38)
Location 19:18226221-18226243
Sequence GGTCACCGGGACGCCCGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163597019_1163597031 15 Left 1163597019 19:18226221-18226243 CCACACCGGGCGTCCCGGTGACC 0: 1
1: 0
2: 2
3: 2
4: 66
Right 1163597031 19:18226259-18226281 TCCAGCCTCACCACAGCGGATGG 0: 1
1: 0
2: 2
3: 15
4: 144
1163597019_1163597030 11 Left 1163597019 19:18226221-18226243 CCACACCGGGCGTCCCGGTGACC 0: 1
1: 0
2: 2
3: 2
4: 66
Right 1163597030 19:18226255-18226277 TCTGTCCAGCCTCACCACAGCGG 0: 1
1: 0
2: 2
3: 18
4: 248
1163597019_1163597033 16 Left 1163597019 19:18226221-18226243 CCACACCGGGCGTCCCGGTGACC 0: 1
1: 0
2: 2
3: 2
4: 66
Right 1163597033 19:18226260-18226282 CCAGCCTCACCACAGCGGATGGG 0: 1
1: 1
2: 0
3: 13
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163597019 Original CRISPR GGTCACCGGGACGCCCGGTG TGG (reversed) Intronic
901128075 1:6943231-6943253 GGTGTCCTGGACGCCAGGTGAGG - Intronic
905448580 1:38043334-38043356 GGGCACCTGGAAGCCTGGTGAGG - Intergenic
906663310 1:47597921-47597943 GGTCACCAGGACACTCTGTGAGG - Intergenic
1062860787 10:807636-807658 GGCCGCAGGGCCGCCCGGTGGGG - Exonic
1062909962 10:1205917-1205939 GGTCACGGGGCAGCCCGCTGGGG + Intronic
1062909974 10:1205948-1205970 GGTCACGGGGCAGCCCGTTGGGG + Intronic
1069921426 10:71818025-71818047 GGTCACAGGGAAGCCCGGTGAGG + Intronic
1076551300 10:131279675-131279697 GGCCACCCAGCCGCCCGGTGAGG + Intronic
1076722020 10:132396969-132396991 GGTCGGCCGGACGCGCGGTGCGG - Intergenic
1078729875 11:13964308-13964330 GGTCACTGGGGCACCTGGTGGGG + Intronic
1083664161 11:64265643-64265665 GGACACAGGGACGCCTGGTGTGG - Intronic
1089296208 11:117469916-117469938 GGTCACCTGGATGCTCTGTGAGG + Exonic
1096353988 12:50924668-50924690 GGTCACTGGAGAGCCCGGTGGGG + Exonic
1102728802 12:115089708-115089730 GGTCTCTGGGACACCCAGTGGGG + Intergenic
1107019141 13:35733646-35733668 GGTCACAGAGATGCCTGGTGGGG + Intergenic
1114409266 14:22485440-22485462 GGTCACCGGGCTGCTCTGTGAGG + Intergenic
1114612542 14:24052209-24052231 GGTCTCTGGGACGCCCCGTCCGG + Intronic
1118343322 14:64914634-64914656 GGTCACCGGGACCGGCAGTGCGG - Intronic
1128752557 15:70159610-70159632 GGTCAGTGGGAGGCCCTGTGGGG - Intergenic
1134108588 16:11500768-11500790 GGACACCGGGGCCCCGGGTGGGG + Intronic
1135691168 16:24539322-24539344 GCTCACAGGGAGGCTCGGTGGGG - Intronic
1136383989 16:29911416-29911438 GGACACCAGGACCCCCGGGGAGG - Intronic
1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG + Intronic
1139956126 16:70693856-70693878 TGTCAGCGGGACCCCCTGTGTGG - Intronic
1141602803 16:85136708-85136730 GGTCACTGGGTCGCCCAGAGTGG + Intergenic
1142407019 16:89895963-89895985 GGGCACAGGGACGCCAGGGGAGG - Intronic
1142758521 17:2029746-2029768 GGTCACCCGGCCGCCGTGTGGGG - Intergenic
1143532379 17:7512867-7512889 GGACCCCGGGGAGCCCGGTGTGG - Exonic
1152931406 17:83111988-83112010 GGTCTGCAGGACGGCCGGTGGGG + Intergenic
1154292419 18:13121360-13121382 GGCCACCGGAAGGCCTGGTGGGG + Intronic
1155209154 18:23586251-23586273 GGCCACCGGGACGCCCTGTGGGG - Intronic
1158643105 18:59220029-59220051 GGGCGCTGGGACGCCCGGTCCGG - Intergenic
1163597019 19:18226221-18226243 GGTCACCGGGACGCCCGGTGTGG - Intronic
1164492614 19:28728386-28728408 GGTCACCAGGACACCAGGCGGGG + Intergenic
1166054308 19:40279425-40279447 GGCCTCCGGGCCGCACGGTGGGG - Intronic
1166564177 19:43753749-43753771 GGGCACAGGGAGGCCAGGTGCGG - Intronic
1166564320 19:43754542-43754564 GGTCGCTGGGACGTCCGGCGGGG - Intronic
1166996787 19:46723233-46723255 GGCCACGGGGACGCCGTGTGGGG - Exonic
1167001039 19:46746035-46746057 GGCCGCCGGGACGGCCGGCGGGG - Exonic
1167166578 19:47803278-47803300 GGGCACCGGGAGACCCCGTGGGG + Intronic
1167175261 19:47860486-47860508 GGGCACCGGGAGACCCCGTGGGG - Intergenic
1167433035 19:49464186-49464208 GGCCAACGGGACGCCCCGCGGGG + Exonic
926439200 2:12870035-12870057 GGTCACAGGGCCGCCTGGTGTGG - Intergenic
932735616 2:74252152-74252174 GGTCACTGGGAGGCCTGGGGTGG + Intronic
946843107 2:223837300-223837322 GGCCACAGGGACGCACGGTTCGG + Intronic
1175699950 20:61129744-61129766 GGTCCCCGGGAAGCACTGTGTGG - Intergenic
1183437708 22:37804999-37805021 GGCCAGCGGGCCGCCCGGCGGGG + Intergenic
1184658392 22:45953433-45953455 GGTCTCCGGGCTGCCGGGTGTGG + Intronic
1184799644 22:46751820-46751842 GGACCCCGGGAAGCTCGGTGGGG + Intergenic
1185253107 22:49816004-49816026 TGGCACCGGGAGGCCCTGTGTGG - Intronic
952800108 3:37282565-37282587 GGTCACTTGGACACCCAGTGTGG + Intronic
952999911 3:38923129-38923151 GGTCTCCTGGAAGCCAGGTGAGG - Intronic
954028691 3:47803046-47803068 GGGCTCCGTGACGCCGGGTGGGG + Exonic
963784948 3:149525065-149525087 GGTAATCGGGAAGCCTGGTGAGG + Intronic
973315820 4:48759034-48759056 GAACACCGGGACACACGGTGGGG + Intronic
990946528 5:61255144-61255166 AGTCACCAGGCAGCCCGGTGTGG - Intergenic
1001381307 5:171308460-171308482 GGACGCGGGGTCGCCCGGTGGGG - Exonic
1015910093 6:138161583-138161605 GGACACCGGGACCCCCAGCGTGG - Intergenic
1017073960 6:150600515-150600537 GGACCCGGGGACGCGCGGTGGGG + Intronic
1018762149 6:166901993-166902015 CGTCACAGGGACGCACAGTGGGG + Intronic
1019181047 6:170187434-170187456 GGTCCAGGGGACACCCGGTGAGG + Intergenic
1020278131 7:6637012-6637034 GTTCATCGGGGCGCCCGCTGAGG - Intergenic
1032089528 7:128904278-128904300 GGTCACCGGGCCGGCAGATGGGG + Intronic
1035888812 8:3322645-3322667 GGTCACCTGGCCTCCAGGTGTGG + Intronic
1038883581 8:31640008-31640030 GGGGGCCGGGACGCCCGGAGCGG - Intronic
1049585665 8:143431332-143431354 GGGCACCGGGAAGCACGGGGCGG + Intergenic
1049654534 8:143791870-143791892 CCTCCCCGGGACGCCTGGTGAGG - Exonic
1059942041 9:119368524-119368546 AGTCACCGGGAAACCCGCTGTGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1062314757 9:135961209-135961231 GGTCACCGGGAAGGCGGGCGGGG + Exonic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic